infantile epilepsy panel, sequence analysis and exon

5

Test Information Test performed at GeneDx. For clinical utility and genes tested, visit: http://www.genedx.com/wp-content/uploads/crm_docs/info_sheet_epilepsy_infa.pdf Patient Report Patient's results from GeneDx continue on following page(s). Patient: DOB: Age: 0 Gender: F Patient Identifiers: Visit Number (FIN): Client: Physician: ARUP Test Code: 2007535 Collection Date: 10/21/2021 Received in lab: 10/26/2021 Completion Date: 11/22/2021 Infantile Epilepsy Panel, Sequence Analysis and Exon- Level Deletion/Duplication ARUP Enhanced Reporting | November 22, 2021 | page 1 of 5 Chart continues on following page(s) Patient: ARUP Accession: 21-295-400398

Upload: others

Post on 30-Jun-2022

1 views

Category:

Documents

0 download

Report

Download

Embed Size (px):

TRANSCRIPT

Page 1: Infantile Epilepsy Panel, Sequence Analysis and Exon

Test Information

Test performed at GeneDx. For clinical utility and genes tested, visit: http://www.genedx.com/wp-content/uploads/crm_docs/info_sheet_epilepsy_infa.pdf

Patient Report

Patient's results from GeneDx continue on following page(s).

Patient: DOB: Age: 0 Gender: FPatient Identifiers:

Visit Number (FIN):

Client:

Physician:

ARUP Test Code: 2007535

Collection Date: 10/21/2021Received in lab: 10/26/2021Completion Date: 11/22/2021

Infantile Epilepsy Panel, Sequence Analysis and Exon-Level Deletion/Duplication

ARUP Enhanced Reporting | November 22, 2021 | page 1 of 5

Chart continues on following page(s)

Patient: ARUP Accession: 21-295-400398

Page 2: Infantile Epilepsy Panel, Sequence Analysis and Exon

Page 3: Infantile Epilepsy Panel, Sequence Analysis and Exon

Page 4: Infantile Epilepsy Panel, Sequence Analysis and Exon

Page 5: Infantile Epilepsy Panel, Sequence Analysis and Exon

THE EPILEPSY RESEARCH PROGRAM OF THE ONTARIO BRAIN … · 2019-08-20 · Page 3 of 4 Public Education Campaigns Update on Infantile Spasms Awareness Campaign Information about Antidepressants

Chapter 15mmsalemscienceteacher.weebly.com/uploads/2/3/3/6/... · 2018. 9. 9. · Exon 1 Intron Exon 2 Branch point A snRNA Exon 1 Exon 2 Lariat 5′ 5′ 3′ 3′ 5′ 5′ 3′

Treatment Approaches in Infantile Spasms...Treatment Approaches in Infantile Spasms Overview Infantile spasms, also known as West syndrome, is a catastrophic childhood epilepsy with

Standard 4 exon gene -Where is the polyA tail in the gene above? -Draw a 4 exon gene where exon 4 is all 3’UTR

Homozygous TBC1D24 mutation in two siblings with familial ......Homozygous TBC1D24 mutation in two siblings with familial infantile myoclonic epilepsy (FIME) and moderate intellectual

CYP2D6 Variation v1 - PharmVarintron 1, exon 2, intron 2-exon 3, intron 4, exon 5, exon 7-intron 8, intron 7, exon 9 none Panserat et al. 1995 Gaedigk et al. 2010 Gaedigk et al, 2010

Desastre Exon Valdez

ClinicalStudy - Hindawi Publishing Corporationdownloads.hindawi.com/archive/2017/8196434.pdf · ChemotherapyResearchandPractice 3 Exon 19-censored Exon 21-censored Exon 19 Exon 21

Supplemental figure1 89101112131415 Age (weeks) Up to 39 Systemic DMBA Tumor detection Collection A D C loxP AREx2-FAREx4-R Exon 4 Exon 2 Exon 3 Exon 2

Hepatocellular Carcinoma - Exon Publications

Identification of NURR1 (Exon 4) and FOXA1 (Exon 3 ...Parkinson’sDisease 5 100 400 300 200 MNURR1 exon 4 (1) M 349bp (a) 100 200 400 300 500 M NURR1 exon 4 (2) 416bp (b) 100 200

West Syndrome followed by Juvenile Myoclonic Epilepsy: a ... di... · Key words:west syndrome, juvenile myoclonic epilep-sy, idiopathic epilepsy, infantile spasms, hairy elbows syn-drome

target Exon 1 ATG

HANS BERGER SYMPOSIUM · epilepsy syndrome based on ictal semiology 3:45 – 4:30 Update on Infantile Spasms Lawrence Morton, MD Describe new theories of the pathophysiology of infantile

4: Genome evolution. Exon Shuffling 3 types of exon shuffling exon duplication = the duplication of one or more exons within a gene (internal duplication)

EXON - exeter.ox.ac.uk

Epilepsy o Epilepsy overview

Bases genéticas y moleculares del síndrome de … · Bases genéticas y moleculares del síndrome de Brugada 297 Exon 28 Exon 9 ¿Mutación? Exon 28 Exon 28 Exon 9 V2 V2 Figura

Exon Autumn 2010

· Gefitinib Gefitinib 1. Non-small cell lung cancer EGFR DNA EGF-R exon 19 deletion, exon 21 [1.858R] substitution mutations, L861Q G719X EGFR exon 20

Congenital and infantile nephrotic syndrome - sgn.org.br and infantile nephrotic syndrome.pdf · Congenital and infantile nephrotic syndrome 10/05/15 09:37. Congenital and infantile

Epilepsy Epilepsy Overview

Exon Mobil Mock Case

ID and epilepsy panel - cmgg.beANTXR1 606410 GAPO syndrome, 230740 (3), Autosomal recessive; {Hemangioma, capillary infantile, susceptibility to}, 602089 (3), Autosomal dominant AP1S1

Collaborative Team Science to Advance New Therapies for Epilepsy “The CURE Infantile Spasms and Epilepsy Genetics Initiatives”

Epilepsy Awareness Epilepsy Nurse Specialists. Epilepsy Awareness Training Schedule Learning Outcomes What is Epilepsy? Epilepsy – Prognosis Classification

Exon selection factor

CRISPR/Cas9-mediated genome editing induces exon skipping ... · HeLa cells can cause skipping of exon 3, exon 4, or exons 3, 4, and 5 [18]. We also detected infrequent exon skipping

Exon-Mobile Drilling Guide

Genetic Testing for Epilepsy: Infantile Epilepsy Panel ......*This panel does not include deletion/duplication testing of the DNM1, FOXG1, or SLC6A8 genes Clinical Features: Epilepsy

Recognizing Seizures and Epilepsy: Insights from Pathophysiology · 2020. 1. 20. · Examples of epilepsy syndromes are infantile spasms, Lennox–Gastaut syndrome, febrile seizures,

Exon Mobile Drilling Guide

Exon Mobil Interest Netting

Supporting Information - PNAS · Supporting Information Aoki et al. 10.1073/pnas.1204638109 Fig. S1. Applicability of antisense-mediated exon skipping targeting each exon and exon

Dysferlin-Exon-42-deletion in pUC57-Kan 8545 bp€¦ · Dysferlin-Exon-42-deletion_in_pUC57-Kan 5' gcctgccgctggcctccaccactcagtacagccgtgcagtctttgacgggtgccactactactacctacc Dysferlin-Exon-42-deletion