hemiflagellochloris kazakhstanica gen. et sp. nov.: a new coccoid green alga with flagella of...

HEMIFLAGELLOCHLORIS KAZAKHSTANICA GEN. ET SP. NOV.: A NEW COCCOID GREENALGA WITH FLAGELLA OF CONSIDERABLY UNEQUAL LENGTHS FROM A SALINE

IRRIGATION LAND IN KAZAKHSTAN (CHLOROPHYCEAE, CHLOROPHYTA)1

Shin Watanabe2

Department of Biology, Faculty of Science, University of Toyama, 3190 Gofuku, Toyama 930-8555, Japan

Shigeo Tsujimura

Lake Biwa Environmental Research Institute, 5-34 Yanagasaki, Otsu, Shiga 520-0022, Japan

Takahiro Misono

Laboratory of Biology, Faculty of Education, Toyama University, 3190 Gofuku, Toyama 930-8555, Japan

Shogo Nakamura and Hiroshi Inoue

Department of Environmental Science, Faculty of Science, University of Toyama, 3190 Gofuku, Toyama 930-8555, Japan

A coccoid green alga, Hemiflagellochloris kazakh-stanica S. Watanabe, S. Tsujimura, T. Misono,S. Nakamura et H. Inoue, gen. et sp. nov., was de-scribed from soil samples of a saline irrigation landin Ili River basin, Kazakhstan. This alga had a pa-rietal chloroplast with a pyrenoid, which was cov-ered with starch segments and penetrated withthylakoid membranes. Reproduction occurred bythe formation of aplanospores and zoospores. Theaplanospores frequently formed tetrad aggregationsin a mother cell. The zoospores were covered by asingle-layered cell wall and lacked stigmata. Thezoospores had two flagella of considerably unequallengths; the longer flagellum was 17–19 lm in lengthand the shorter one was 9–10lm. The flagellar ap-paratus architecture was of the clockwise orientationgroup type in the Chlorophyceae. Molecular phylo-genetic analysis using 18S and 28S rDNA sequencedata resolved this organism in a separate clade fromthe green algae that had flagella of slightly unequallengths. It was suggested that features such as in-equality in flagellar lengths, parallel exsertion ofbasal bodies, and subapical position of the flagellarapparatus were sporadically evolved.

Key index words: Chlorophyceae; flagella; greenalgae; Hemiflagellochloris; Kazakhstan; unequallengths

Abbreviations: CW, clockwise; d, dexter; MCMC,Markov chain Monte Carlo analysis; ML, maximumlikelihood analysis; OTUs, operational taxonomicunits; s, sinister

While investigating the ecophysiological features ofsoil algal inhabitants in a saline irrigation land in IliRiver basin, Kazakhstan, Tsujimura et al. (1998a, b)found that the algal communities comprised organ-isms belonging to Cyanophyta, Chlorophyta, Bacillar-iophyceae, and Xanthophyceae. Species compositionwas influenced by differences in the salinity of the soilsamples, due to irrigation activity. Most of the greenisolates showed characteristics similar to the species re-ported in the previous taxonomic studies; however, thecharacteristics of certain isolates were not congruentwith the descriptions hitherto made. Tsujimura (1998)found a coccoid green alga (BAKg15) that had twoflagella of considerably unequal lengths.

Currently, it is known that the flagella of motile cellsof green algae are generally equal in length (Bold andWynne 1985). However, Starr (1955) reported that thetwo flagella of the zoospores of Bracteacoccus andDictyochloris had slightly unequal lengths and were ex-serted at the anterior end of zoospores in very closeproximity to each other. Subsequently, the followingorganisms were described to have flagella of slightlyunequal lengths: Fasciculochloris McLean et Trainor(1965), Heterotetracystis Cox et Deason (1968), Het-erochlamydomonas Cox et Deason (1969), Spermatozopsissimilis Preisig et Melkonian (1984), and Microsporaquadrata Hazen (Lokhorst and Star 1999). When theswimming cells of these genera were viewed laterallyusing an electron microscope, two types of basal bodyexsertion were detected among these genera: (1) theparallel type in Bracteacoccus and Dictyochloris (Wata-nabe and Floyd 1992), Heterochlamydomonas (Floydet al. 1990), and Microspora (Lokhorst and Star1999); and (2) the V-shaped type in Spermatozopsis (Me-lkonian and Preisig 1984), Heterotetracystis, andFasciculochloris (Floyd and Watanabe 1992). By usingmolecular methods, Nakayama et al. (1996), Lewis(1997), and Shoup and Lewis (2003) investigated the

1Received 7 September 2005. Accepted 7 February 2006.2Author for correspondence: e-mail [email protected].

696

J. Phycol.42, 696–706 (2006)r 2006 by the Phycological Society of AmericaDOI: 10.1111/j.1529-8817.2006.00214.x

phylogenetic placement of these organisms other thanFasciculochloris, Heterotetracystis, and Microspora.

In this study, we performed pigment analysis, lightand electron microscopic observations of BAKg15, anddetermined 18S rDNA and 28S rDNA sequences ofBAKg15, Heterotetracystis and Fasciculochloris. The firstobjective of this study is to describe a new taxon forBAKg15 and to infer its phylogenetic position amongthe green algae. Further, we investigate the phylo-genetic implications of inequality in flagellar lengths,parallel exsertion of basal bodies, and the subapicalposition of the flagellar apparatus, based on the distri-bution of these features in the trees.

MATERIALS AND METHODS

The algal strain (BAKg15) was isolated by Tsujimura (1998)from the soil samples collected in a Bakbakty farm located inthe Ili River basin, Kazakhstan. The moisture content and pHof the soil sample were 20.2% and 9.1, respectively. StrainBAKg15 was maintained at 20–231 C under a 12:12 light:dark(L:D) photoregime in a C medium (Ichimura 1971) or in a9:1þ V medium that includes nine parts of Bold’s BasalMedium (Deason and Bold 1960), one part of soil extract(Starr and Zeikus 1993), 10mg �L�1 vitamin B1, 0.1mg �L�1

vitamin B12, and 0.1mg �L� 1 biotin. Strain BAKg15 is depos-ited as Hemiflagellochloris kazakhstanica in Microbial CultureCollection, National Institute for Environmental Studies,Japan (NIES) (Applied Biosystems Japan, Tokyo, Japan). Forpigment composition analysis, the algal cells were homoge-nized with 80% acetone. The homogenate was then centri-fuged at 20,000g for 20 min, and the clear supernatant wasused as a total pigment extract. Absorption spectra were meas-ured by using a Hitachi 3210 spectrophotometer (Hitachi Ltd.,Tokyo, Japan). Chlorophyll concentration was determined ac-cording to the method described by Arnon (1949). To confirm

the presence of starch, the cells were stained with aqueous io-dine. For transmission electron microscopy, the zoospores werefixed according to the procedures previously described (Wata-nabe and Floyd 1989).

In order to obtain amplification templates for 18S and 28SrDNA sequence analysis, the cells of BAKg15, Heterotetracystisakinetos Cox et Deason (UTEX1675) and Fasciculochloris boldiiMcLean et Trainor (UTEX1451) were lysed in a hexadecyltri-methylammonium bromide (CTAB) solution, and the totalDNA was extracted using chloroform and precipitated withethanol (Hillis et al. 1996). Using the DNA template, PCR wascarried out with Amplitaq DNA polymerase (Applied Biosys-tems Japan) according to the following program: 30 cycles of1 min at 941 C for denaturing, 2 min at 501 C for annealing,and 3 min at 721 C for extension. After removing excess prim-ers and dNTP by using QIAquick (PCR purification kit; Qia-gen, Tokyo, Japan), the PCR products served as templates forcycle sequence reaction that was conducted using the primerlabeling method with Thermo Sequenase (Amersham Pharma-cia Biotech Japan, Tokyo, Japan). The primers for PCR and thecycle sequence of 18S rDNA were identical to those used pre-viously (Nakayama et al. 1996), and the primers used for 28SrDNA sequencing are listed in Table 1. The sequencing elect-rophoresis was performed on a DSQ-1000L (Shimadzu Cor-poration, Kyoto, Japan).

We analyzed two data sets in order to construct phyloge-netic trees. The first data set comprised the sequence data of18S rDNA, and it was assembled with 62 operational taxonom-ic units (OTUs) (Table 2), which included 44 species of theclockwise (CW) group (Nakayama et al. 1996), 12 of theSphaeropleales, and two each of Microspora, the Chaetophor-ales, and the Chaetopeltidales. Two species of the Trebouxio-phyceae were selected as an outgroup. The sequence data weremanually aligned with the aid of a Clustal X program (Jean-mougin et al. 1998). Some unambiguously aligned sites wereexcluded from the analysis, and the sequences used for analysiscomprised 1705 nucleotide sites. The second data set com-prised the 18S and 28S rDNA combined sequence data, and it

TABLE 1. Amplification and sequencing primers used for 28S rDNA.

Namea Sequence (50–30) Positionb Reference

ITS-4Fc,d GCATATCAATAAGCGGAGGA 1 Present investigationLS1Fc GTACCGTGAGGGAAAGAT 321 Buchheim et al. (2001) ( 5 LS-1)LS1Rc,d ATCTTTCCCTCACGGTAC 339 Buchheim et al. (2001) ( 5 LS-2)LS2Fd AAAGTGCTTGAAATTGTT 365 Present investigationLS2Rc AACAATTTCAAGCACTTT 384 Present investigationLS3Fc CCCGTCTTGAAACACGGAC 617 Hamby et al. (1988) ( 5 26Brc)LS3Rd GTCCGTGTTTCAAGACGGG 636 Present investigationLS4Fd AAAGGTTTGAGTGCGAGC 758 Present investigationLS4Rc GCTCGCACTCAAACCTTT 776 Present investigationLS5Fc CCGAAGTTTCCCCCAGGA 937 Present investigationLS6Fc,d GGCCATTTTTGGTAAGCAGA 1147 Buchheim et al. (2001) ( 5 LS-14)LS6Rd TCTGCTTACCAAAAATGGCC 1167 Present investigationLS7Rc AATCAACACCCTTTGTGGG 1215 Present investigationLS8Fc,d CAAATATTCAAATGAGAACT 1452 Present investigationLS9Rc,d CCACTTCAGTCTTCA 1488 Present investigationLS10Fd GGAAGAGTTCTCTTTTCTT 1678 Present investigationLS11Fc,d ATCATTCGGAGATAGGG 1726 Present investigationLS11Rd CCCTATCTCCGAATGAT 1743 Present investigationLS12Rc TTGGAGACCTGATGCGG 1869 Present investigationLS13Fd TCGCCAAAATGGATCCG 1912 Present investigationLS13Rc,d CGGATCCATTTTGGCGA 1929 Present investigationLS14Rc CAGAGCACTGGGCAGAAAT 2226 Hamby et al. (1988) ( 5 26F)

aF and R accompanied with primer names indicate forward and reverse.bPosition of priming sequence relative to published sequence Chlorococcum echinozygotum (Buchheim et al. 2001).cAmplification primer.dSequencing primer.

HEMIFLAGELLOCHLORIS KAZAKHSTANICA GEN. ET SP. NOV. 697

TABLE 2. Taxa with accession numbers of 18S and 28S rDNA sequence data used for constructing the phylogenetic trees.

Taxa18S rDNA 28S rDNA

Accession no. (straina) Accession no. (straina)

ChlorophyceaeAscochloris multinucleata Bold et MacEntee U63106 (UTEX2013) AF395492 (UTEX2013)Bracteacoccus giganteus Bischoff et Bold U63099 (UTEX1251) AF183451 (UTEX1251)Bracteacoccus minor (Chodat) Petrova U63097 (UTEX66) AF183452 (UTEX66)Carteria crucifera Korshikov D86501 (NIES421) AF183454 (UTEX432)Carteria eugametos Mitra (non C. olivieri G. S. West) U70596 (UTEX1032) AF183457 (UTEX1032)Carteria radiosa Korshilov AF182819 (UTEX835) AF183458 (UTEX835Carteria sp. AF182817 (UTEX2) AF183459 (UTEX2)Chaetopeltis orbicularis Berthold U83125 (UTEX422) AF183465 (UTEX422)Chaetophora incrassata (Huds.) Hazen D86499 (UTEX1289) AF183471 (UTEX1289)Characiochloris acuminata Lee et Bold AF395435 (UTEX2095) AF395493 (UTEX2095)Characiosiphon rivularis Iyengar AF395437 (UTEX1736) AF395494 (UTEX1736)Chlamydomonas asymmetrica Korshikov U70788 (SAG70.72) AF395496 (SAG70.72)Chlamydomonas baca Ettl U70781 (SAG24.87) AF395498 (SAG24.87)Chlamydomonas moewusii Gerloff U41174 (CC-1419) AF183461 (SAG11-11)Chlamydomonas noctigama Korschikov AF008239 (SAG22.72) AF183460 (SAG33.72)Chlamydomonas oblonga Pringsheim AF395434 (SAG11-60a) AF395501 (SAG11-60a)Chlamydomonas rapa Ettl U70790 (SAG78.72) AF395503 (SAG78.72)Chlamydomonas reinhardtii Dangeard M32703 (CC-400) AF183463 (CC-400)Chlamydomonas zebra Korschikov ex Pascher U70792 (SAG10.83) —Chlorococcum diplobionticum Herndon U70587 (UTEX950) AF395505 (UTEX950)Chlorococcum echinozygotum Starr U57698 (UTEX118) AF183469 (UTEX118)Chlorogonium euchlorum Ehrenberg U70588 (SAG12-3) AF395507 (SAG12-3)Chloromonas radiata ( 5 Chlamydomonas radiata Ettl) Proschold,Marin, Schlosser et Melkonian

U57697 (UTEX966) AF395502 (UTEX966)

Chloromonas reticulata ( 5 Chlmomonas clathrata Korschikov)Proschold, Marin, Schlosser et Melkonian

U70791 (UTEX1970) AF395508 (UTEX1970)

Chloromonas rosae Ettl U70796 (UTEX1337) —Chlorosarcinopsis minor (Gerneck) Herndon AB049415 (UTEX949) —Desmotetra delicata (Chlorosarcinopsis delicata S. Watanabe) S. Watanabe AB218711 (UTEX962) —Desmotetra stigmatica (Deason) Deason et Floyd AB218710 (NIES153) —Dictyochloris fragrans Vischer ex Starr AF367860 (UTEX33) AY206712 (UTEX33)Dictyochloris pulchra Deason et Herndon AF367862 (UTEX2527) AY206713 (UTEX2527)Dunaliella parva Lerche M62998 (UTEX1983) AF183473 (UTEX1983)Fasciculochloris boldii McLean et Trainor AB244240 (UTEX1451)b AB244241 (UTEX1451)b

Floydiella terrestris ( 5 Planophila terrestris Grooveret Hofstetter) Friedl et O’Kelly

D86498 (UTEX1709) AF183480 (UTEX1709)

Haematococcus zimbabwiensis Pocock U70797 (UTEX1758) AF183475 (UTEX1758)Hemiflagellochloris kazakstanica S. Watanabe, Tsujimura,Misono, S. Nakamura et H. Inoue

AB244244 (BAKg15)b AB244245 (BAKg15)b

Heterochlamydomonas inaequalis Cox et Deason AF367857 (UTEX1705) AY206708 (UTEX1705)Heterochlamydomonas lobata Langford et Cox AF367858 (UTEX728) AY206710 (UTEX728)Heterochlamydomonas rugosa Langford et Cox AF367859 (SAG45.86) AY206709 (SAG45.86)Heterotetracystis akinetos Cox et Deason AB244242 (UTEX1675)b AB244243 (UTEX1675)b

Hormotila blennista Trainor et Hilton U83123 (UTEX1239) —Hydrodictyon reticulatum (L.) Lagerheim M74497 (CBS) AF183477 (CBS)Lobocharacium coloradoense Kugrens, Clay et Aguiar AF395436 (UTEX2772) AF395509 (UTEX2772)Lobochlamys culleus ( 5 Chlamydomonas culleus Ettl) Proschold,Marin, Schlosser et Melkonian

AJ410461(SAG17.73) —

Lobochlamys segnis( 5 Chlamydomonas fimbriata Ettl) Proschold,Marin, Schlosser et Melkonian

U70784 (SAG17.72) AF395500 (SAG17.72)

Microspora sp. AF387160 (UTEX LB 472) —Microspora stagnorum (Kuzing) Lagerheim AF387153 (SAG51.86 —Neochloris aquatica Starr M62861 UTEX138) AF277653 (UTEX138)Neochloris vigensis Archibald M74496 (UTEX1981) AF277654 (UTEX1981)Neochlorosarcina auxotrophica (Groover et Bold) S. Watanabe AB218696 (UTEX722) —Neochlorosarcina deficiens (Groover et Bold) S. Watanabe AB218697 (UTEX1700) —Neochlorosarcina pseudominor (Groover et Bold) S. Watanabe AB218714 (UTEX1702) —Oogamochlamys gigantea ( 5 Chlamydomonas gigantea Dill) Proschold,Marin, Schlosser et Melkonian

AJ410467 (UTEX1753) —

Oogamochlamys zimbabwiensis ( 5 Chlamydomonas zimbabwiensisHeinke et Starr) Proschold, Marin, Schlosser et Melkonian

AJ410471 (UTEX2213) —

Paulschulzia pseudovolvox Skuja U83120 (UTEX167) —Pediastrum duplex Meyen M62997 (UTEX1364) AF183479 (UTEX1364)Protosiphon botryoides Kutzing (Klebs) U41177 (UTEX99) AF183481 (UTEX99)Pteromonas angulosa Lemmerman AF395438 (SAG64-3) AF395510 (SAG64-3)Sarcinochlamys stigmatica S. Watanabe, Mitsui, Nakayama et Inouye AB218709 (ASIB.T105) —Spermatozopsis similis Preisig et Melkonian X65557 (SAG1.85) —Spongiochloris spongiosa Starr U63107 (UTEX1) AF395511 (UTEX1)

SHIN WATANABE ET AL.698

was assembled with 45 OTUs (Table 2), which included 30species of the CW group, eight of the Sphaeropleales, and twoeach of the Chaetophorales and the Chaetopeltidales. Onespecies of the Trebouxiophyceae was selected as an outgroup.The sequence data were manually arranged with reference tothe alignment used by Buchheim et al. (2001). The sequencescomprised 2147 nucleotide sites of the 50 end of 28S rDNA and1691 of 18S rDNA.

Bayesian and maximum likelihood (ML) analyses were em-ployed with the identical procedures for the two data sets. TheBayesian analysis of the 18S data was conducted twice usingMrBayes ver. 3.0b4 (Huelsenbeck and Ronquist 2001) onSYMþ invariableþ gamma (SYMþ IþG) as the best-fit mod-el selected by hLRT in the program MrModeltest ver. 2.2(Nylander 2004): base 5 equal, rate matrix ([A–C] 5 0.9629,[A–G] 5 2.8657, [A–T] 5 1.3893, [C–G] 5 1.0797, [C–T] 54.7616, [G–T] 5 1.0000), proportion of invariable sites(I) 5 0.4364, shape parameter (G) 5 0.5702. Markov chainMonte Carlo (MCMC) analysis was performed with 5,000,000generations in length. Trees were sampled every 100 genera-tions to yield 50,000 trees, in which the first 1% trees werediscarded in the burn-in phase. The remaining trees were usedto construct a 50% majority-rule consensus tree and to estimateposterior probability as a percentage at the nodes. The top-ologies obtained from the two runs were identical with lessthan 4% difference in the posterior probability, and the lowerposterior probabilities of the two runs are cited in the illustrat-ed tree. For ML analysis, the tree was constructed using PAUPver. 4.0b10 (Swofford 2002) on TrNefþ invariableþ gamma(TrNefþ IþG) as the best-fit model of DNA substitution se-lected by hLRT in Modeltest ver. 3.04 (Posada and Crandall1998): base frequencies (A 5 0.2609, C 5 0.2117, G 5 0.2681,T 5 0.2593), rate matrix ([A–C] 5 1.0000, [A–G] 5 2.8349,[A–T] 5 1.3012, [C–G] 5 1.3012, [C–T] 5 5.5985, [G–T] 51.0000), proportion of invariable sites (I) 5 0.4622, and shapeparameter (G) 5 0.5836. The ML tree was constructed by theheuristic search using a stepwise approach with 10 randomadditions of taxa and tree bisection–reconnection branch-swapping algorithm (TBR) to find the best tree. Bootstrap val-ues were calculated with 100 data replications using the fast-stepwise heuristic search.

The Bayesian analysis of the 18S and 28S combined datawas conducted twice on GTRþ invariableþ gamma(GTRþ IþG) as the best-fit model with base frequencies(A 5 0.2549, C 5 0.2143, G 5 0.2871, T 5 0.2436), rate matrix([A–C] 5 0.9144, [A–G] 5 2.3390, [A–T] 5 1.1861, [C–G] 50.8398, [C–T] 5 4.8074, [G–T] 5 1.0000), proportion of invar-iable sites (I) 5 0.3867, and shape parameter (G) 5 0.5324.The MCMC was performed with 2,000,000 generations inlength. The topologies obtained from the two runs were iden-

tical, with less than 2% difference in the posterior probability.For the ML analysis, the tree was constructed on the TrNþ in-variableþ gamma (TrNþ IþG) model with base frequencies(A 5 0.2613, C 5 0.2064, G 5 0.2814, T 5 0.2509), rate matrix([A–C] 5 1.0000, [A–G] 5 2.3647, [A–T] 5 1.0000, [C–G] 5 1.0000, [C–T] 5 4.9313, [G–T] 5 1.0000), I 5 0.3857,and G 5 0.534.

RESULTS

Morphological observations. During the prolongedculturing period, we observed various shapes ofBAKg15 cells at different stages of the life cycle.Young vegetative cells derived from zoospores werecylindrical, ellipsoidal to fusiform with attenuatedand rounded ends (Fig. 1A). With progression ofgrowth, these cells attained a spherical shape occa-sionally with a protuberant thickening that was aremnant of the attenuated end of the zoospore (Fig.1B). Young vegetative cells derived from aplano-spores were spherical and had a minimum diameterof 5 mm. Mature cells attained a diameter of 20 mm.Vegetative cells maintained a uninucleate conditionduring the period of growth. The cell wall wassmooth but slightly thickened (up to 2 mm) in oldercultures. The chloroplast was parietal and had a hol-low spherical shape. The chl a and b content ratio was2.62. The pyrenoid (Fig. 1, A–D) was embedded inthe chloroplast and covered by a prominent starchthat was proved by the aqueous iodine test. Thepyrenoid matrix was penetrated with several thy-lakoid membranes (Fig. 2A). In old cultures, oil drop-lets were deposited in the cytoplasm, and with age,the plant mass color changed from green to orangeon the agar media.

Asexual reproduction occurred by the formation ofaplanospores and zoospores, which resulted from suc-cessive cell divisions. Two, four, or eight aplanosporeswere contained in a mother cell (Fig. 1C). In activelygrowing cultures, we found assemblages of daughtercells of different generation (Fig. 1D). In case a singlemother cell contained four daughter cells, they werearranged in tetrad aggregation (Fig. 1D). When oldcultures were transferred into fresh media, four- to

TABLE2 (Continued).

Taxa18S rDNA 28S rDNA

Accession no. (straina) Accession no. (straina)

Tetracystis aeria Brown et Bold U41175 (UTEX1453) AF395513 (UTEX1453)Tetraspora sp. U83821 (UTEX234) AF395514 (UTEX234)Uronema belkae (Mattox et Bold) O’Kelly et Floyd AF182821 (UTEX1179) AF183489 (UTEX1179)Volvox carteri Iyengar X53904 (UTEX1885) AF183490 (UTEX1885)Wislouchiella sp. U70591 (UTEX1030) AF395515 (UTEX1030)

TrebouxiophyceaeFusochloris perforata (Lee et Bold) Floyd et Watanabe M62999 (UTEX2104) AF183467 (UTEX2104)Trebouxia magna Ahmadjianb Z21552 (UTEX902) —

aStrains: UTEX, Culture collection at the University of Texas at Austin; CC, Chlamydomonas Genetic center at Duke University;SAG, Sammlung von Algenkulturen in Gottingen; NIES, Microbial culture collection, National institute for environmantal studies,Japan; ASIB, Algensammlung am Institut fur Botanik, Universitat Innsbruck.

bPresent study.


16-walled zoospores were formed in a mother cell(Fig. 1C). The zoospores began to swim after the startof the light period; they were cylindrical to ellipsoidalin shape, 3–4mm in width and (8–) 11–14 mm in length(Figs. 1E and 2H). Electron microscopy revealed thatthe cell wall was composed of a single layer and thepapilla extended between the two basal bodies (Fig. 2,B and H). The zoospores had two flagella of consider-ably unequal lengths, which were exserted at the an-terior end of the cell (Fig. 1E). The longer flagellumattained a length of 17–19 mm, and the shorter one,9–10mm. When zoospores were swimming, the longerflagellum extended in the forward direction, while theshorter often beat laterally. The flagellar apparatus wassubapically located in the zoospore, that is, the axis be-tween the two basal bodies was bent at an angle of25–551 from the longitudinal axis of the cell (Fig. 2, Band H). The longer flagellum was exserted at a moreanterior position than the shorter one (Figs. 1, E and 2,B and H). The chloroplast occupied most of the cellbody except for an anterior part, and had a centralpyrenoid (Fig. 2H). The stigma was absent. The nu-cleus was usually situated in the anterior region of thezoospore (Fig. 2H); however, it was rarely found in the

median to posterior region (not shown). Two contrac-tile vacuoles were present at the anterior end. Whenthe zoospores ceased their motility, they remained cy-lindrical, ellipsoidal to fusiform shape, and graduallybecame spherical shape during the subsequent growthperiods.

The top view of the flagellar apparatus revealed thatthe basal bodies were displaced in the CW orientation(Fig. 2, C–E). The two basal bodies were connectedwith the distal fiber (Fig. 2, B and C) and the proximalfiber (Fig. 2, D and G). Each basal body was coveredwith a proximal sheath (Fig. 2B). Two types of rootletswere alternatively arranged in a cruciate pattern (Fig.2, D and E), including the s-rootlet with four microtu-bules arranged in a 3-over-1 configuration (Fig. 2F)and the d-rootlet with two microtubules (Fig. 2G). Be-tween the d-rootlet of one basal body and the s-rootletof the second, an accessory basal body was present(Fig. 2, D and E).

Phylogenetic analysis. The Bayesian and ML meth-ods used for 18S rDNA data resulted in identicaltopologies, and only the Bayesian tree is shown here(Fig. 3). Microspora stagnorum, one of the two speciesof the genus, first diverged in the ingroup taxa. The

FIG. 1. Light microscopy images of Hemiflagellochloris kazakhstanica. (A) Young vegetative cells derived from zoospores. Scalebar 5 10mm for A–E. (B) Mature spherical to ellipsoidal cells in actively growing culture. Note a protrusion on the surface of the cell,which is a remnant of the attenuated end of the zoospore (arrowhead). (C) Aplanospores in an aplanosporangium (large arrow) andzoospores in a zoosporangium (small arrow). (D) Aplanospores of different generations in a single mother cell (arrow). Aplanosporeswere occasionally arranged in tetrad aggregation. (E) A zoospore with two flagella of considerably unequal lengths. The longer flagellumis exserted at a more anterior position than the shorter one. Scale bar, 10mm.


Sphaeropleales, Chaetophorales, Chaetopeltidales,and the CW group formed separate branches; how-ever, their phylogenetic relationships could not beresolved. The Sphaeropleales included the genera

Bracteacoccus and Dictyochloris, and Microspora sp. Inthe CW group, the Carteria II and Spermatozopsis di-verged in the root region. In the remaining taxa, 13extant clades were recognized, which were divided

FIG. 2. Transmission electron microscopy images of Hemiflagellochloris kazakhstanica. (A) A young vegetative cell with a single nucleusand a hollow chloroplast with a pyrenoid. The pyrenoid matrix is penetrated by the thylakoid membranes (arrow). Nucleus (N), pyre-noid (P). Scale bar, 1 mm. (B) The anterior region of zoospore with longitudinal sections of the flagella. Note that the longitudinal axis offlagellar apparatus (between the two empty thick arrows) is bent at an angle against the longitudinal axis of zoospore (between the twoblack thick arrows). The zoospore is covered by a single-layered cell wall (arrowhead). Two basal bodies are connected by the distal fiber(large arrow), and the proximal end of the basal body is covered by the proximal sheath (small arrow). Chloroplast (c), longer flagellum(LF), mitochondrial profile (M), shorter flagellum (SF). Scale bar, 200 nm. (C–E) Consecutive cross-sections of the flagellar apparatus of azoospore viewed from top to bottom. (C) A horizontal section of the distal fiber with striations (arrow). Scale bar, 200 nm (C–E). (D) Twobasal bodies are connected by the proximal fiber (large arrow). (D and E) Basal bodies are displaced in a clockwise orientation, and d- ands-rootlets are alternatively arranged in a cruciate pattern. Dexter-rootlet (d), sinister-rootlet (s). Accessory basal body is present (smallarrow) between d-rootlet of one basal body and s-rootlet of the second. (F) A cross-section of s-rootlet with four microtubules arranged inthe 3-over-1 configuration (arrow). Scale bar, 200 nm (F and G). (G) A cross-section of d-rootlet with two microtubules (small arrow), andlateral and longitudinal sections of the proximal fiber (large arrow). (H) Longitudinal section of a zoospore. The longitudinal axis of azoospore is indicated between the two thick arrows. Note that the flagellar apparatus is bent at an angle against the longitudinal axis, andthe longer flagellum is exserted at a more anterior position than the shorter one. Chloroplast (C), longer flagellum (LF), nucleus (N),shorter flagellum (SF). Scale bar, 1 mm.


FIG. 3. The Bayesian tree constructed on the SYMþ IþG model for 18S rDNA sequence data. These data include the organismswhose flagella are unequal in length and/or whose flagellar apparatus is subapical, namely Hemiflagellochloris, Spermatozopsis, Het-erochlamydomonas, Fasciculochloris, Heterotetracystis, Desmotetra, Bracteacoccus, Dictyochloris, and Microspora. This tree is representative of themaximum likelihood (ML) tree constructed on the TrNefþ IþG model. The species typed in bold letters have two flagella of unequallengths, and the sequence of the species marked with an asterisk was determined in this study. Two numbers at the nodes indicate theposterior probability (�100) in the Bayesian analysis (Bpp) and bootstrap values of ML analysis (ML).


into three large assemblages in the tree: the firstcomprised organisms from Desmotetra clade to Volvoxclade; the second, from Lobochlamys clade to Oogamo-chlamys clade; and the third, from Carteria I clade toProtosiphon clade.

Strain BAKg15 was placed in the root region of theVolvox clade with Paulschulzia, Tetraspora, Chlamydomo-nas, and Volvox. The Volvox clade was not well support-ed with 68% posterior probability and 54% bootstrapvalues. This clade was sister to the combined clades ofHeterochlamydomonas, Asymmetrica, and Neochlorosarcina,and the assembled branch of these four clades wassupported with 100% in the Bayesian and 74% in theML analyses. Fasciculochloris boldii and Heterotetracystisakinetos were resolved in the Asymmetrica clade alongwith three species of Chlamydomonas. Because F. boldiiand H. akinetos were sisters to Chlamydomonas rapa andC. oblonga, respectively, both F. boldii and H. akinetos didnot construct a single branch. The three species ofHeterochlamydomonas formed a robust clade in a sisterposition to the joined clade consisting of the Asymmet-rica clade and the Neochlorosarcina clade.

The two phylogenetic methods used for the 18S and28S rDNA combined data resulted in similar topologieswith slight differences, which do not affect the discus-sion on the position of BAKg15, Fasciculochloris andHeterotetracystis; thus, only the Bayesian tree is shownhere (Fig. 4). Among the ingroup taxa, the Chaeto-peltidales, the Chaetophorales, and the Sphaeroplealessuccessively diverged in the root regions of the tree.Within the Sphaeropleales, Dictyochloris and Bracteacoc-cus were resolved in a separate position. In the CWgroup, the Carteria II clade first diverged, and in theremaining taxa, nine extant clades were recognized.The remaining taxa were divided into three large as-semblages: the first comprised from the Carteria I cladeto Asymmetrica clade; the second, Lobochlamys segnis toChloromonas clade; and the third, Tetracystis clade to Lob-ocharacium clade.

Strain BAKg15 was placed in the root region of theVolvox clade, which was supported with the highestvalues in both the analyses. The Volvox clade was sisterto the combined clade of the Heterochlamydomonas andthe Asymmetrica, and the assembled branch of thesethree clades was robust. In the Asymmetrica clade, F.boldii and H. akinetos were sisters to Chlamydomonas rapaand C. asymmetrica, respectively, and both F. boldii andH. akinetos did not construct a single branch.

DISCUSSION

Taxonomy of BAKg15. The absorption spectrumand the iodine staining test confirmed that BAKg15belongs to the Chlorophyta. Strain BAKg15 has uni-cellular coccoid vegetative cells that frequently formthe tetrad aggregations of daughter cells in activelygrowing cultures, and produces walled zoospores.These features are commonly found in coccoid mem-bers such as Tetracystis and Heterotetracystis. The elec-tron microscopy showed that the present isolate

possessed the typical flagellar apparatus architectureof the CW group (Nakayama et al. 1996) belonging tothe Chlorophyceae, including the basal bodies thatwere displaced in the CW orientation, connections ofbasal bodies by the distal and proximal fibers, and thecruciate flagellar rootlet system; all these features havebeen reported in Tetracystis (Watanabe and Floyd 1989)and Heterotetracystis (Floyd and Watanabe 1992). How-ever, BAKg15 is distinguished from these genera notonly by the considerable inequality in the flagellarlengths but also by the angle formed by bending ofthe subapical flagellar apparatus against the longitudi-nal axis of the cell body. In both 18S rDNA and thecombined data set trees, BAKg15 was resolved in theVolvox clade and was distant from the Asymmetrica cladeand the Tetracystis clade, to which Heterotetracystis akine-tos and Tetracystis aeria belong, respectively.

Based on the morphological observations andmolecular analyses, we propose a new taxon Hemi-flagellochloris kazakhstanica gen. et sp. nov. for BAKg15.

Hemiflagellochloris S. Watanabe, S. Tsujimura,T. Misono, S. Nakamura et H. Inoue, gen. nov.

Cellulae singulares, ellipsoideae, sphaericae, un-inucleatae, membranis laevibus. Chloroplastus pariet-alis cum pyrenoidibus. Propagatio asexualis peraplanosporis atque zoosporis parietibus, 2 flagellislongitudinum inaequalium. Flagellum unicum dimidiobrevius est quam altera. Corpora basalia zoosporarumhelicte disposita.

Type species: Hemiflagellochloris kazakhstanica S.Watanabe, S. Tsujimura, T. Misono, S. Nakamura etH. Inoue.

Cells solitary, ellipsoidal, spherical, uninucleate,with a smooth cell wall. Chloroplast parietal with pyre-noids. Reproduction occurs by formation of aplano-spores and zoospores. Zoospores walled, with twoflagella of unequal length; one flagellum is half thelength of the other. Basal bodies of zoospores are dis-placed in CW orientation.

Hemiflagellochloris kazakhstanica S. Watanabe,S. Tsujimura, T. Misono, S. Nakamura et H. Inoue,sp. nov. (Figs. 1 and 2)

Cellulae juvenes, obovatae, ellipsoideae, sphaericae,et cellulae maturae, sphaericae, frequnter protuberan-tes, 20mm diametro, membranis laevibus. Propagatioasexualis per 2–8 aplanosporis atque 8–16 zoosporis.Zoosporae parietibus, ellipsoidae, cylindricae, 3–4mm �(8–) 11–14mm amplitudine. Stigma carens. Flagellumlongius 17–19mm longitudine, et flagellum brevius9–10mm longitudine.

Young cells obovate, ellipsoidal, spherical andmature cells spherical or often with a protrusion,20mm in diameter, with smooth cell wall. Reproduc-tion by formation of 2–8 aplanospores, and 8–16zoospores. Zoospores walled, ellipsoidal, cylindrical,3–4mm � (8–) 11–14mm in size. Stigma absent. Long-er flagellum 17–19 mm in length and shorter flagellum9–10mm in length.

Holotype: Embedded material (#13112) deposited atCONN.


Isotype: Embedded material deposited (#13113) atCONN.

Phylogenetic relationships of organisms possessing flag-ella of unequal lengths: In this study, we constructedtwo phylogenetic trees based on the 18S DNA data,and the 18S and 28S rDNA combined data. The 18SDNA tree includes the following organisms possess-ing flagella of unequal lengths, Microspora, Sperm-atozopsis, Heterochlamydomonas, Fasciculochloris, Hetero-

tetracystis, Hemiflagellochloris, Dictyochloris, and Bractea-coccus, while the combined data tree includes organ-isms other than the first two genera. The 18S rDNAtree and the combined data tree resolved the CarteriaI and Chloromonas clades in different positions; how-ever, the composition of clades in these trees is es-sentially similar. Using the combined data, Buchheimet al. (2002) constructed MP and ML trees for 40species of the CW group, in which nine clades were

FIG. 4. The Bayesian tree constructed on the GTRþ IþG model for 18S and 28S rDNA combined data. These data include theorganisms whose flagella are unequal in length and/or whose flagellar apparatus is subapical, namely, Hemiflagellochloris, Het-erochlamydomonas, Fasciculochloris, Heterotetracystis, Bracteacoccus, and Dictyochloris. This tree is representative of the maximum likelihood(ML) tree constructed on the TrN þ IþG model. The species typed in bold letters have two flagella of unequal lengths, and thesequence of the species marked with an asterisk was determined in this study. Two numbers at the nodes indicate the posterior prob-ability (�100) in the Bayesian analysis (Bpp) and bootstrap values of ML analysis (ML). GTR, general time-reversible.


found. Although the present combined data treeshowed a different topology from that proposed byBuchheim et al. (2002), most of the clades resolved inboth the trees were generally identical. Thus, it isjustifiable to regard the present two data set trees tobe compatible with the previous study.

In the 18S rDNA tree, Microspora sp. was phyloge-netically placed in the Sphaeropleales with Bractea-coccus and Dictyochloris, while M. stagnorum was placedseparately in the root region of the Chlorophyceae.Lokhorst and Star (1999) observed that in Microsporaquadrata, the flagella were slightly unequal in length,and the two basal bodies emerged in an orientationthat was parallel to each other, and that the flagellarapparatus architecture closely resembled those of thetraditional Chlorococcales. The present phylogeneticanalysis partially agreed with the inference drawn byLokhorst and Star (1999) because Microspora sp. wasresolved in the Sphaeropleales clade with Bracteacoccusand Dictyochloris, both of which were formerly classifiedin the Chlorococcales (Bold and Wynne 1985), whileM. stagnorum was placed in the root region of theChlorophyceae.

Based on the topologies of the two data set trees, itcan be determined that except for M. stagnorum, theinequality in flagellar lengths distributes in three re-gions: (1) the root region of the CW group (Sperm-atozopsis); (2) among the clades of Heterochlamydomonas,Asymmetrica, and Volvox; and (3) the Sphaeropleales. Itis interesting to examine whether the inequality offlagella has any relationship with the occurrence ofparallel basal bodies, and with the subapical position offlagellar apparatus, because these features have beenspecifically found in the organisms with flagella of un-equal lengths (Table 3). The parallel type basal bodiesoccur in the CW group (Heterochlamydomonas) and inthe Sphaeropleales (Bracteacoccus, Dictyochloris, andMicrosopora sp.). On the other hand, the V-shaped-type basal bodies with flagella of unequal lengths arefound only in the CW group but are separately placed.The subapical position of the basal bodies is one of theprominent features of the zoospore of H. kazakhstanica.This feature has been found in Desmotetra stigmatica

(Deason and Floyd 1987, Watanabe et al. 2006) and M.quadrata (Lokhorst and Star 1999) (Table 3). Althoughthese species resemble each other in terms of the pres-ence of subapical flagellar apparatus, their zoosporesexhibit different features. Zoospores of H. kazakhstanicahave flagella of considerably unequal lengths and V-shaped basal bodies; those of D. stigmatica have flagellaof equal length and V-shaped basal bodies; and M.quadrata zoospores have flagella of slightly unequallengths and parallel basal bodies. The 18S rDNA treeresolved these species in the distantly related clades,which apparently corresponds to their morphologicaldifferences. Based on the distribution of the three fea-tures in the phylogenetic tree, it is suggested that theyhave not been concomitantly developed but have oc-curred sporadically through the evolutionary processof coccoid green algae.

We are indebted to Saori Shirae for her laboratory work. Thisresearch was supported by a Grant-in-Aid from the Ministry ofEducation, Science and Culture of Japan (#13640694 and#17570074) to S. W.

Arnon, D. I. 1949. Copper enzymes in isolated chloroplast: poly-phenoloxidase in Beta vulgaris. Plant Physiol. 24:1–15.

Bold, H. C. & Wynne, M. J. 1985. Introduction to the Algae. 2nd ed.Prentice-Hall Inc, Englewood Cliffs, NJ, 720 pp.

Buchheim, M. A., Michalopulos, E. A. & Buchheim, J. A. 2001.Phylogeny of the Chlorophyceae with special reference to theSphaeropleales: a study of 18S and 26S rDNA data. J. Phycol.37:819–35.

Buchheim, M. A., Buchheim, J. A., Carlson, T. & Kugrens, P. 2002.Phylogeny of Lobocharacium (Chlorophyceae) and allies: astudy of 18S and 26S rDNA data. J. Phycol. 38:376–83.

Cox, E. R. & Deason, T. R. 1968. Axilosphaera and Heterotetracystis,new Chlorosphaeracean genera from Tennessee soil. J. Phycol.4:240–9.

Cox, E. R. & Deason, T. R. 1969. Heterochlamydomonas, a new algafrom Tennessee. J. Tenn. Acad. Sci. 44:105–7.

Deason, T. R. & Bold, H. C. 1960. Phycological Studies. I. ExploratoryStudies of Texas Soil Algae. The University of Texas PublicationNo. 6022, pp. 72.

Deason, T. R. & Floyd, G. L. 1987. Comparative ultrastructure ofthree species of (Chlorosarcinaceae, Chlorophyta). J. Phycol.23:187–95.

Floyd, G. L., Wilcox, L. W. & Watanabe, S. 1990. Structure andflagellar beat in Heterochlamydomonas inaequalis, a motile, uni-

TABLE 3. Occurrence of the features, including the equality or inequality of flagellar lengths, the type of basal body exsertionand the position of flagellar apparatus (FA), in the genera having the common features with Hemiflagellochloris (BAKg15).

Flagellarlength

Basal bodyexsertion

Position ofapparatus

Current Phylogeneticposition

References onmorphological features

Hemiflagellochloris Considerably unequal V-shaped Subapical CW group Present studySpermatozopsis Slightly unequal V-shaped Apical CW group Melkonian & Preisig (1984)Heterochlamydomonas Slightly unequal Parallel Apical CW group Floyd et al. (1990)Fasciculochloris Slightly unequal V-shaped Apical CW group Floyd & Watanabe (1992)Heterotetracystis Slightly unequal V-shaped Apical CW group Floyd & Watanabe (1992)Desmotetra Equal V-shaped Subapical CW group Deason & Floyd (1987)Bracteacoccus Slightly unequal Parallel Apical Sphaeropleales Watanabe & Floyd (1992)Dictyochloris Slightly unequal Parallel Apical Sphaeropleales Watanabe & Floyd (1992)Microspora Slightly unequal Parallel Subapical Sphaeroplealesa Lokhorst & Star (1999)

aMicrospora sp. was resolved in the Sphaeropleales, which agrees with the finding that Microspora quadrata resembles Bracteacoccusand Dictyochloris with regard to the flagellar apparatus architecture. On the other hand, M. stagnorum was placed in the root region ofChlorophyceae.


cellular, green alga with unequal flagella and parallel basalbodies. Crypt. Bot. 1:332–9.

Floyd, G. L. & Watanabe, S. 1992. Ultrastructure of the flagellarapparatus of zoospores with unequal flagella from the greenalgae Heterotetracystis and Fasciculochloris (Chlorophyta). Crypt.Bot. 2:333–6.

Hamby, R. K., Sims, L., Issel, K. & Zimmer, E. A. 1998. Directribosomal RNA sequencing: optimization of extraction andsequencing methods for work with higher plants. Plant Mol.Biol. Rep. 6:175–92.

Hillis, D. M., Mable, B. K., Larson, A., Davis, S. K. & Zimmer, E. A.1996. Nucleic acids. IV. Sequencing and cloning. In Hillis, D.M., Moritz, C. & Mable, B. K. [Eds.] Molecular Systematics. 2nded. Sinauer Associates, Sunderland, MA, pp. 321–81.

Huelsenbeck, J. P. & Ronquist, F. 2001. MRBAYES: Bayesian in-ference of phylogeny. Bioinformatics 17:754–5.

Ichimura, T. 1971. Sexual cell division and conjugation-papillaformation in sexual reproduction of Closterium strigosum. Proc.Int. Seaweed Symp. 7:208–14.

Jeanmougin, F., Thompson, J. D., Gouy, M., Higgins, D. G. & Gib-son, T. J. 1998. Multiple sequence alignment with Clustal X.Trends Biochem. Sci. 23:403–5.

Lewis, L. A. 1997. Diversity and phylogenetic placement of Brac-teacoccus Tereg (Chlorophyceae, Chlorophyta) based on 18Sribosomal RNA gene sequence data. J. Phycol. 33:279–85.

Lokhorst, G. M. & Star, W. 1999. The flagellar apparatus structurein Microspora (Chlorophyceae) confirms a close evolutionaryrelationship with unicellular green algae. Plant Syst. Evol.217:11–30.

McLean, R. J. & Trainor, F. R. 1965. Fasciculochloris, a new chloro-sphaeracean alga from a Connecticut soil. Phycologia 4:145–8.

Melkonian, M. & Preisig, H. R. 1984. An ultrastructural compar-ison between Spermatozopsis and Dunaliella (Chlorophyceae).Plant Syst. Evol. 146:31–46.

Nakayama, T., Watanabe, S., Mitsui, K., Uchida, H. & Inouye, I.1996. The phylogenetic relationship between the Chlamydo-monadales and Chlorococcales inferred from 18SrDNA se-quence data. Phycol. Res. 44:47–55.

Nylander, J. A. A. 2004. MrModeltest v2. Program distributed bythe author. Evolutionary Biology Centre, Uppsala University.

Posada, D. & Crandall, K. A. 1998. Modeltest: testing the model ofDNA substitution. Bioinformatics 14:817–8.

Preisig, H. R. & Melkonian, M. 1984. A light and electron micro-scopical study of the green flagellate Spermatozopsis similis spec.nova. Plant Syst. Evol. 146:57–74.

Shoup, S. & Lewis, L. A. 2003. Polyphyletic origin of parallel basalbodies in swimming cells of chlorophycean green algae(Chlorophyta). J. Phycol. 39:789–96.

Starr, R. C. 1955. A Comparative Study of Chlorococcum meneghini andOther Spherical, Zoospore-Producing Genera of the Chlorococcales.Indiana University Publications, Sci. Ser. No. 20, 111 pp.

Starr, R. C. & Zeikus, J. A. 1993. UTEX—The culture collection ofalgae at the University of Texas at Austin. J. Phycol. 29(Sup-pl):1–106.

Swofford, D. L. 2002. PAUP*: Phylogenetic Analysis Using Parsimony(*and Other Methods) Version 4.0b10. Sinauer Associates, Sun-derland, MA.

Tsujimura, S., Nakahara, H., Kosaki, T., Ishida, N. & Karbozova, E.1998a. Distribution of soil algae in salinized irrigation land inthe arid region of Central Asia. I. A case study of 14-year-oldBereke farm in the flood plain of the River Ili, Kazakstan. SoilSci. Plant Nutr. 44:53–65.

Tsujimura, S., Nakahara, H., Kosaki, T., Ishida, N. & Iskakov, A. R.1998b. Distribution of soil algae in salinized irrigation land inthe arid region of Central Asia. II. A case study of 25-year-oldBakbakty farm in the flood plain of the River Ili, Kazakstan.Soil Sci. Plant Nutr. 44:67–76.

Tsujimura, S. 1998. Ecophysiological Studies on Soil Algae in SalinizedIrrigation Land of the Ili River Basin, Kazakstan. Ph.D. thesis.Kyoto University.

Watanabe, S. & Floyd, G. L. 1989. Variation in the ultrastructureof the biflagellate motile cells of six unicellular genera ofthe Chlamydomonadales and Chlorococcales (Chlorophy-ceae), with emphasis on the flagellar apparatus. Am. J. Bot.76:307–17.

Watanabe, S. & Floyd, G. L. 1992. Comparative ultrastructureof zoospores with parallel basal bodies from the greenalgae Dictyochloris fragrans and Bracteacoccus sp. Am. J. Bot.79:551–5.

Watanabe, S., Mitsui, K., Nakayama, T. & Inouye, I. 2006. Phylo-genetic relationships and taxonomy of sarcinoid green algae:Chlorosarcinopsis, Desmotetra, Sarcinochlamys gen. nov., Neochloro-sarcina and Chlorosphaeropsis (Chlorophyceae, Chlorophyta).J. Phycol. 42: in press. DOI:10.1111/j.1529-8817.2006.00196.x


hemiflagellochloris kazakhstanica gen. et sp. nov.: a new coccoid green alga with flagella of...

Documents