germination and persistence of bacillus anthracis and ...

ORIGINAL ARTICLE

Germination and persistence of Bacillus anthracis andBacillus thuringiensis in soil microcosmsA.H. Bishop

Detection Department, Defence Science and Technology Laboratory, Salisbury, Wiltshire, UK

Keywords

Bacillus anthracis, Bacillus thuringiensis,

germination, PlcR, vegetative persistence.

Correspondence

Alistair H. Bishop, Detection Department,

Defence Science and Technology Laboratory,

Porton Down, Salisbury, Wiltshire SP4 0JQ,

UK.

E-mail: [email protected]

2014/1373: received 6 July 2014, revised 2

August 2014 and accepted 4 August 2014

doi:10.1111/jam.12620

Abstract

Aims: Decontaminating large, outdoor spaces of Bacillus anthracis spores

presents significant problems, particularly in soil. Proof was sought that the

addition of germinant chemicals could cause spores of B. anthracis and Bacillus

thuringiensis, a commonly used simulant of the threat agent, to convert to the

less resistant vegetative form in a microcosm.

Methods and Results: Nonsterile plant/soil microcosms were inoculated with

spores of B. thuringiensis and two nonpathogenic strains of B. anthracis. A

combination of L-alanine (100 mmol l�1) and inosine (10 mmol l�1) resulted

in a 6 log decrease in spore numbers in both strains of B. anthracis over

2 weeks at 22°C; a 3 log decrease in B. anthracis Sterne spore numbers was

observed after incubation for 2 weeks at 10°C. Negligible germination nor a

decrease in viable count occurred in either strain when the concentration of

L-alanine was decreased to 5 mmol l�1. Germinated spores of B. thuringiensis

were able to persist in vegetative form in the microcosms, whereas those of

B. anthracis rapidly disappeared. The pleiotropic regulator PlcR, which

B. anthracis lacks, does not contribute to the persistence of B. thuringiensis in

vegetative form in soil.

Conclusions: The principle of adding germinants to soil to trigger the

conversion of spores to vegetative form has been demonstrated. Bacillus

anthracis failed to persist in vegetative form or resporulate in the microcosms

after it had been induced to germinate.

Significance and Impact of the Study: The large scale, outdoor

decontamination of B. anthracis spores may be facilitated by the application of

simple, defined combinations of germinants.

Introduction

Bacillus anthracis is regarded by many as the most impor-

tant biological agent of concern (Schwartz 2009). This is

largely because it is able to form highly resistant endosp-

ores (Driks 2009). In this inert form, the bacterium can

persist in some environments for many decades. It is also

impervious to desiccation and has a much higher resil-

ience to heat, ultraviolet radiation and antibacterial

chemicals (Nicholson et al. 2000; Setlow 2006) than other

threat agents. Sporulation normally occurs when the rep-

licative, vegetative form experiences nutrient deprivation.

This process can be reversed by a number of triggers such

as the presence of certain chemical germinants (Moir

2006). There is a very limited number of chemicals

known to cause the spore to dismantle its protective

structures and adaptations and enter vegetative growth

again (Ireland and Hanna 2002).

Once a commitment to germination has occurred, it is

irreversible. During this process and while in the vegeta-

tive form, B. anthracis has a similar susceptibility to inac-

tivation by biocides, heat, radiation and other destructive

measures as other bacterial agents of concern. For this

reason, many strategies to remove spores (Gould et al.

1968; Schuch et al. 2002; Nerandzic and Donskey 2010;

Bourguet et al. 2012; Fulmer and Wynne 2012; Mehta

© 2014 Crown Copyright. Journal of Applied Microbiology 117, 1274--1282 © 2014 Society for Applied Microbiology

This article is published with the permission of the Controller of HMSO and the Queen’s Printer for Scotland.1274

Journal of Applied Microbiology ISSN 1364-5072

et al. 2013; Omotade et al. 2013) include, as an initial

step, the use of chemical germinants. While chemical

germinants are effective under monoseptic conditions

in vitro (Luu et al. 2011), there is little information about

how they perform in the outdoor environment. In this

respect, the most difficult environment would be soil, as

it contains high levels and varied species of resident

micro-organisms. The most active germinants can be

readily metabolized, and it was feared that the soil micro-

flora would rapidly scavenge these nutrients and use

them for their own growth and survival before they could

trigger spore germination. Using a high throughput

sequencing technique, the plant/soil microcosms have

been demonstrated to replicate the highly competitive

environment that is thought to pertain in natural soils

(Bishop and Rachwal 2014; Bishop et al. 2014). They

therefore represent an amenable method to assess the

effect of germinants in soil.

Bacillus thuringiensis is very closely related to B.

anthracis (Helgason et al. 2000; Rasko et al. 2005) and is

gaining acceptance as the most accurate outdoor simulant

for this threat agent (Greenberg et al. 2010; Buhr et al.

2012; Tufts et al. 2014; Bishop and Robinson 2014). A

nonpathogenic, spore-forming simulant such as B. thurin-

giensis will, by necessity, be used to evaluate different

approaches to the decontamination of B. anthracis spores.

It is therefore important to understand how the simulant

responds to methodologies designed for B. anthracis and

the reasons for divergences in the responses of the two

species. One of the few, obvious, genetic differences

between B. anthracis and B. thuringiensis is the lack in

the former organism of the gene encoding the pleiotropic

regulator, PlcR (Gohar et al. 2008). These authors have

suggested that among the functions that PlcR is involved

in are mechanisms sensing the external environment, the

activation of exoenzyme synthesis and functions related

to external survival.

Proof of principle was sought that spores of B. thurin-

giensis and attenuated strains of B. anthracis could be ger-

minated in nonsterile, plant/soil microcosms. The

involvement of PlcR in the persistence of vegetative cells

in the soil was also investigated.

Materials and methods

Bacterial strains and growth conditions

Two nonpathogenic strains of B. anthracis, UM23CL2

and Sterne, were obtained from Defence Science and

Technology Laboratory (Dstl) stocks. The noninsecticidal

derivative of B. thuringiensis HD-1 cry� (Bishop and

Robinson 2014) was also from Dstl stocks. Bacillus thur-

ingiensis strain 158-S-2 was isolated from the phylloplane

of clover (Bizzarri et al. 2008). Bacillus thuringiensis strain

407 and its PlcR-deficient derivative (407PlcR–) were kind

gifts from Professor. Didier Lereclus (INRA, France).

To facilitate the recovery of B. thuringiensis HD-1cry�

and B. anthracis UM23CL2 from soil, they were chromo-

somally tagged with the transposon in pAW068, as

described by Bishop et al. (2014). Bacillus anthracis

Sterne was chromosomally tagged with the transposon in

pUTE618, using the method of McGillivray et al. (2009).

Pools of the transformed strains were recovered from

plant/soil microcosms after incubation for 2 weeks to

ensure that any mutants in which the transposon had

inserted into a vital survival gene were excluded (Bishop

et al. 2014). Transposon pAW068 confers resistance to

spectinomycin (100 lg ml�1); B. anthracis Sterne trans-

formed with transposon pUTE618 was resistant to kana-

mycin (50 lg ml�1). Bacillus thuringiensis 407 PlcR� is

resistant to erythromycin (5 lg ml�1). The plcR� mutant

of B. thuringiensis is resistant to chloramphenicol

(10 lg ml�1).

Spores of all species were produced using nutrient

broth with yeast extract and supplements (NBYS) and the

method of Lecadet et al. (1980). Tryptone soy broth

(TSB) and tryptone soy agar (TSA) were used for general

growth and plate counts, supplemented with the appro-

priate antibiotic. Wild-type strains of B. thuringiensis

were enumerated on TSA supplemented with penicillin

(80 lg ml�1) and polymyxin B (20 lg ml�1). An indica-

tion of the levels of the resident microflora in the micro-

cosms was gained by enumeration on TSA without

antibiotics. Spore counts were determined by heat shock

at 65°C for 30 min followed by plating on the appropri-

ate growth medium. All media components were pur-

chased from Oxoid and the chemicals from Sigma

Aldrich (Gillingham, Dorset, UK).

DNA vectors and manipulation techniques

A PlcR-deficient mutant of B. thuringiensis strain 158-S-2

(158-PlcR�) was produced by homologous recombina-

tion. The plcR gene was amplified using the primers and

conditions of Agaisse et al. (1999) to produce an ampli-

con of 1�6 Kb. The chloramphenicol resistance gene from

pBBRMCS1 (obtained from Dr Cristian Vidal, University

of Cardiff, U.K.) was amplified using the primers (for-

ward ACTCATATGGCTGCATTAATGAATCGGCCA and

reverse ACTCATATGGAATAAATACCTGTGACGGAAG

ATCACTTC), which incorporate NdeI sites at both ends,

and the same thermal cycling profile as for plcR. The

900 bp amplicon was cloned into the TOPO-TA plasmid

(Invitrogen, Paisley, Renfrewshire, UK).The chloramphenicol

resistance gene was excised by digestion with NdeI and

ligated into the NdeI site in the middle of the plcR gene

© 2014 Crown Copyright. Journal of Applied Microbiology 117, 1274--1282 © 2014 Society for Applied Microbiology 1275

A.H. Bishop Germination of spores in soil

fragment cloned into TOPO-TA. The resulting construct

was transformed into competent cells of Escherichia coli

(TOP 10, Invitrogen) and selected on Luria–Bertani(Sambrook et al. 1987) agar containing chloramphenicol

(10 lg ml�1). The resulting clones were selected on the

basis of producing the correct-sized fragments following

amplification with combinations of the plcR and chl-

oramphenicol resistance gene primers. The plcR gene in

TOPO-TA, disrupted with the chloramphenicol resistance

gene, was inserted into the BamHI cloning site of

pRN5101, a temperature-sensitive shuttle vector obtained

from Dr Neil Crickmore, University of Sussex. This con-

struct was then electroporated into B. thuringiensis strain

158-S-2 using the method of Bishop et al. (2014) and

transformed colonies selected on Luria–Bertani agar

(Sambrook et al. 1987) containing chloramphenicol

(10 lg ml�1) and tetracycline (5 lg ml�1). Electrotrans-

formants were then grown overnight in TSB containing

chloramphenicol (10 lg ml�1) at the nonpermissive rep-

lication temperature for pRN5101 (37°C). Surviving cells

could only maintain the required chloramphenicol resis-

tance gene by homologous recombination between the

functional, chromosomal copy of the plcR gene and the

disrupted, plasmid-borne fragment. It was verified that

amplification of DNA from 158-PlcR� with the plcR

primers produced only a 2�5 kB product, indicative of

the disrupted gene. This was verified by DNA sequencing.

The phospholipase-deficient phenotype of 158-S-2 PlcR�

was demonstrated using Bacillus cereus selective medium

(Oxoid, Basingstoke, Hampshire, UK).

Plant/soil microcosms

Plant/soil microcosms were prepared as described by

Bishop et al. (2014). The soil was classified as a loam

with a density of 1�3 kg l�1 (Forestry Commission, Farn-

ham, Surrey, UK). The major chemical constituents were

total nitrogen, 0�22%; total organic carbon, 3�17%; total

inorganic carbon, 5�17%; calcium, 3�36 g kg�1; potas-

sium, 262 mg kg�1; magnesium, 74 mg kg�1; and

sodium, 9�3 mg kg�1. The microcosms were incubated,

unless otherwise stated, at 22°C, with 80% relative

humidity and 12 : 12 photoperiod in an environmental

cabinet (Weiss) for 4 weeks to allow the grasses (Bishop

et al. 2014) to grow and the microbial community to

equilibrate. Nonsterile tap water which had been dechlo-

rinated with activated carbon filters (Hagen, Castleford,

Yorkshire, UK) was applied to maintain the soil in a

moist but not saturated state. Less than 100 ll of waterwere added per g of soil per week.

For germination experiments, spores were added at a

density of approx. 1 9 107 colony forming units

(CFU) g�1 dry weight of soil. These were inoculated as

ten aliquots of 10 ll over the surface of the soil to

approximate to an aerosol deposition. No subsequent

mixing of the plant/soil microcosm took place. Solutions

of germinants from 10-fold stocks were added evenly

over the top of the soil the following day to produce a

final concentration in the soil of each well as follows: ala-

nine (100 mmol l�1) plus inosine (10 mmol l�1) (Sigma

Aldrich); yeast extract (0�2%) or brain–heart infusion

broth (0�2%) (Oxoid). Approximately 120 ll of the ger-

minant solutions was added per g of soil. The stated final

concentrations assumed that the germinants would be

evenly distributed within the soil. The experiments were

repeated twice with fresh materials. Eight replicates of

each treatment were made.

Wild type and plcR� mutants of B. thuringiensis strains

407 and 158-S-2 were inoculated separately into plant/soil

microcosms, in vegetative form, as described in Bishop

et al. (2014). The experiment was carried out three times

with fresh components, and eight replicates of the micro-

cosms, which were processed separately, were made for

each strain. The level of inoculation in all cases was

6 9 105 CFU g�1 dry weight of soil.

Bacteria were extracted from soil of all of the micro-

cosms as previously described (Bishop et al. 2014). A heat

shock, as described above, was used to differentiate

between vegetative and spore forms. Colony counts were

made within 24 h of incubation at 25°C.

Results

Germination of Bacillus thuringiensis

Serial dilutions of the extracted suspensions of the micro-

cosms were spread on TSA without antibiotic selection,

with and without heat shock. This was to gauge the

response of the natural microflora to the addition of the

germinants (and the inoculated spores). No medium can

support the growth of more than a small proportion of

the micro-organisms that exist in soil (Davis et al. 2005),

and so, these were termed ‘total’ counts to indicate that

the selective nature of what was being represented was

recognized.

Even in the absence of added germinants, there was an

increase in the background microflora (‘total’ counts) by

the second week (Fig. 1). There was a decrease in the

B. thuringiensis count of about one log over the same

time. Whether these two phenomena are related, that is

the natural microflora were multiplying at the expense of

the survival of B. thuringiensis is unknown.

When alanine and inosine were added (Fig. 2), there

was a dramatic decrease in the population of B. thuringi-

ensis remaining: by the second week the total count had

decreased by three logs. Significantly, the number of

© 2014 Crown Copyright. Journal of Applied Microbiology 117, 1274--1282 © 2014 Society for Applied Microbiology1276

Germination of spores in soil A.H. Bishop

spores had dropped by five logs. In other words, only

0�35% of the total population at that time was present in

the spore form. Assuming that the less resilient, vegetative

cells could be killed by a decontaminant, a five and a half

log decrease in the B. thuringiensis population would

result. It is of interest that, during this process, there was

an increase in the number of heat-sensitive microflora by

week one which declined somewhat by week two. Their

effect on the germination and persistence of the inocu-

lated bacteria was not investigated further.

Yeast extract produced similar results (Fig. 3) to alanine

plus inosine (Fig. 2): by the second week the total B. thur-

ingiensis count had decreased by nearly four logs. The vast

majority of the population was in the vegetative form with

spores representing 2% of the total numbers. The concom-

itant increase in general microflora previously seen (Fig. 2)

was not seen in this instance. One possible explanation

could be that a group of organisms such as fungi, which

would not appear under the plate counting conditions

used, was multiplying at the expense of the germinants or

B. thuringiensis. Brain–heart infusion broth, another unde-

fined growth medium for bacteria, was also tested (Fig. 4).

This produced a three log decrease in total B. thuringiensis

count after 14 days. It is of interest that the total popula-

tion remaining was almost all in the spore form, and the

large presence of vegetative cells seen previously in Figs 2

and 3 was not replicated here.

0·00

1·00

2·00

3·00

4·00

5·00

6·00

7·00

8·00

9·00

10·00

Log

CF

U g

–1 s

oil

0 1 2

Time (weeks)

Figure 1 Spore germination in control microcosms: no germinant

added. Total viable counts of Bacillus thuringiensis (spores and vege-

tative cells) ; B. thuringiensis spore count ; ‘total’ viable bacterial

count and ‘total’ viable spore count . Error bars represent

standard error around the mean.

0·001·002·003·004·005·006·007·008·009·00

10·00

0 1 2

Log

CF

U g

–1 s

oil

Time (weeks)

Figure 2 Spore germination in the presence of alanine

(100 mmol l�1) plus inosine (10 mmol l�1). Total viable counts of

Bacillus thuringiensis (spores and vegetative cells) ; spore count ;

‘total’ viable bacterial count and ‘total’ viable spore count .

Error bars represent standard error around the mean.

0·00

1·00

2·00

3·00

4·00

5·00

6·00

7·00

8·00

9·00

0 1 2

Log

CF

U g

–1 s

oil

Time (weeks)

Figure 3 Spore germination with yeast extract (0�2%). Total viable

counts of Bacillus thuringiensis (spores and vegetative cells) ;

B. thuringiensis spore count ; ‘total’ viable bacterial count and

‘total’ viable spore count . Error bars represent standard error

around the mean.

0·001·002·003·004·005·006·007·008·009·00

10·00

0 1 2

Log

CF

U g

–1 s

oil

Time (weeks)

Figure 4 Spore germination with brain–heart infusion (0�2%). Total

viable counts of Bacillus thuringiensis (spores and vegetative cells) ;

B. thuringiensis spore count ; ‘total’ viable bacterial count and

‘total’ viable spore count . Error bars represent standard error

around the mean.



Germination of Bacillus anthracis UM23CL2

The response of spores of B. anthracis UM23CL2 to the

three types of germinant used is shown in Fig. 5. The

spontaneous level of germination in the absence of any

added germinants seen with B. thuringiensis (Fig. 1) was

not repeated with B. anthracis UM23CL2: the spore inoc-

ulum remained static throughout the 2-week period, both

in terms of overall numbers and the fact that no vegeta-

tive cells were present. Yeast extract and brain–heart infu-sion broth were ineffective in eliciting germination in

B. anthracis UM23CL2, under the conditions used. This

is in marked contrast to the high levels of germination

seen with B. thuringiensis (Figs 3 and 4, respectively).

Alanine and inosine were even more successful at trigger-

ing germination than they were with the simulant species

(Fig. 2). A greater than four log decrease in spore num-

bers occurred within 1 week. By the second week, the

level of B. anthracis had fallen below the limit of detec-

tion (Fig. 5). Although the spore load decreased, there

was no residual population of vegetative cells, as was seen

with B. thuringiensis (Fig. 2). The implication is that,

unlike the latter organism, vegetative cells of B. anthracis

could not survive under the microcosm conditions, nor

could they resporulate.

It has been shown in vitro that the response of spores

to germinants is highly influenced by concentration

(Omotade et al. 2013). Fresh experiments were set up to

investigate this in microcosms using lower levels of ala-

nine (5 mmol l�1) while retaining the inosine concentra-

tion at 10 mmol l�1. Under these conditions, there was a

negligible decrease in the total level of B. anthracis strains

UM23CL2 and Sterne and no germination occurred.

Germination of Bacillus anthracis Sterne

As with B. anthracis UM23CL2, there was no decrease in

the total count, nor any germination in B. anthracis

Sterne in the control wells over the 2-week period

(Fig. 6). Unlike B. anthracis UM23CL2, yeast extract did

have a germinating effect, resulting in over a three log

(i.e. over 99�9%) decrease in the total count after 14 days.

The combination of L-alanine and inosine was as effective

at triggering germination in B. anthracis Sterne (Fig. 6)

as it was in the other attenuated strain (Fig. 5): at least

a six log decrease in total count occurred. As with

B. anthracis UM23CL2, the germinated spores did not

persist in the vegetative form (Fig. 6). This is in marked con-

trast to germinated spores in B. thuringiensis (Figs 2 and 3).

All of the microcosms in the previous experiments had

been maintained at 22°C. When the temperature was

decreased to 10°C (Fig. 7), yeast extract elicited about a

two and half log decrease in the total count of B. anthra-

cis Sterne while about a four log decrease occurred in the

presence of L-alanine and inosine.

Role of PlcR on soil colonization

The PlcR� mutants of both strains of B. thuringiensis

were significantly better colonizers (ANOVA, P < 0�05)of the microcosms than their respective wild-type strains,

407 and 158-S-2 (Fig. 8). At every stage of sampling, the

density of the mutants was higher than that of the wild

types. The bacteria were inoculated in vegetative form,

and the trend during the sampling period for both of the

0

1

2

3

4

5

6

7

8

9

210

Log

CF

U g

–1 s

oil

Time (weeks)

Figure 5 Composite graph of the response of Bacillus anthracis

UM23CL2 to a variety of germinants. The microcosms were main-

tained at 22°C. Alanine (100 mmol l�1) plus inosine (10 mmol l�1),

total and spore count; yeast extract (0�2%) total and

spore count and brain–heart infusion (0�2%), total � and spore

count. Control total and spore count. Error bars repre-

sent standard error around the mean.

0

1

2

3

4

5

6

7

8

210

B. a

nthr

acis

CF

U g

–1 s

oil

Time (weeks)

Figure 6 Germination of spores of Bacillus anthracis Sterne in multi-

well microcosms at 22°C. The microcosms were maintained at 22°C.

Alanine (100 mmol l�1) plus inosine (10 mmol l�1), total and

spore count; yeast extract (0�2%) total and spore count.

Control total and X spore count. Error bars represent standard

error around the mean.



wild types and their plcR� mutants was equally towards

an existence almost exclusively in spore form by week 4.

Discussion

Germination studies on spores of B. anthracis have

almost exclusively been carried out under monoseptic,

in vitro conditions (Gould et al. 1968; Ireland and Hanna

2002). This has been very useful in allowing potential

germinants to be screened and interactions between them

to be investigated (Luu et al. 2011; Omotade et al. 2013).

The inactivation of spores of B. anthracis from outdoor

areas that have been contaminated is an important goal

through which this information can be exploited. There

is little information, however, on how well germinants

would perform under nonsterile, ‘field’ conditions. Soil is

possibly a harder matrix to decontaminate by chemical

means (Manchee et al. 1994; Anon. 2013) than the solid

surfaces normally investigated (Calfee et al. 2011). Germi-

nating spores prior to decontamination is therefore an

attractive approach. The uptake of added germinants by

the large and diverse microbiota in soil was, however, a

significant concern. Here, the use of plant/soil micro-

cosms has indicated that very high levels of germination

can result from the addition of germinants. L-alanine

(100 mmol l�1) plus inosine (10 mmol l�1) was the most

effective germination approach used for spores of both

B. thuringiensis and B. anthracis (Figs 2 and 5–7). In both

of the attenuated strains of the latter organism, a greater

than six log reduction in total count was produced fol-

lowing incubation at 22°C for 2 weeks. This response was

dependent upon concentration: when the concentration

of L-alanine was decreased to 5 mmol l�1, there was neg-

ligible germination and no decrease in total count. The

incubation temperature of most of the experiments was

22°C. In many parts of the world, especially at night, this

would be a high value even at the soil surface. When the

incubation temperature was decreased to 10°C, however,L-alanine (100 mmol l�1) plus inosine (10 mmol l�1)

still caused a reduction of 99�99% of the B. anthracis

Sterne inoculum after 2 weeks (Fig. 7).

The use of readily available materials that might act

as germinants and which are also relatively cheap and

0

1

2

3

4

5

6

7

8

9

210

B. a

nthr

acis

Log

CF

U g

–1 s

oil

Time (weeks)

Figure 7 Germination of spores of Bacillus anthracis Sterne in multi-

well microcosms at 10°C. Alanine (100 mmol l�1) plus inosine

(10 mmol l�1), total and spore count; yeast extract (0�2%),

total and spore count. Control total and spore

count. Error bars represent standard error around the mean.

0

1

2

3

4

5

6

7

8

9

0 1 2 3 4

Log

CF

U g

–1 m

icro

cosm

Time (weeks)

Figure 8 Colonization of plant-soil microcosms by Bacillus thuringiensis strain 407 wild type □ and PlcR� mutant and B. thuringiensis strain

158-S-2 wild type and PlcR� mutant . The total count (spores and vegetative forms) is represented here. The error bars represent 95%

confidence limits of the means of data from three experiments.



available in bulk quantities is an attractive option. While

yeast extract was effective in B. thuringiensis (Fig. 3) and

B. anthracis Sterne (Fig. 6), it had no germinating effect

on B. anthracis UM23CL2 (Fig. 5). Similarly, brain–heartinfusion broth resulted in some germination of B. thurin-

giensis spores (Fig. 4) but had none on those of

B. anthracis UM23CL2. In all of the microcosms, it is

assumed that the germinants had a direct effect in the

demise of the inoculated B. anthracis spores: it could be

that activation of the resident micro-organisms played a

greater or lesser role in removing the spores. The fact

that brain–heart infusion or yeast extract, which would

be expected to be readily used nutrients for a variety of

micro-organisms, had no effect on the levels of B. anthra-

cis UM23CL2 spores argues that a direct germinating

effect was the predominant mechanism for spore

removal. Similarly, yeast extract might be regarded as a

better general nutrient than L-alanine and inosine, but

this reproducibly produced a weaker effect in diminishing

the numbers of B. anthracis Sterne (Figs. 6 and 7).

Although there are many facets of B. thuringiensis that

make it an attractive simulant for B. anthracis (Greenberg

et al. 2010; Bishop and Robinson 2014; Tufts et al. 2014),

it has been shown to behave somewhat differently in soil

in the presence of germinants compared to B. anthracis.

In the presence of L-alanine and inosine, for example, a

large proportion of the inoculated spores of B. thuringi-

ensis germinated (Fig 2). Even 2 weeks after the addition

of the germinants, 99�65% of the total population existed

in the vegetative, heat-sensitive form. While even more

dramatic decreases were seen in the levels of inoculated

spores of both strains of B. anthracis (Figs 5–7), no vege-

tative cells were found at either sampling period. It is

assumed that B. anthracis was incapable of persisting in

the vegetative form under the conditions prevailing in the

microcosms, while B. thuringiensis could do so. Bacillus

anthracis does have a vegetative existence in soils (Saile

and Koehler 2006; Schuch et al. 2010) but, presumably,

only under specific conditions.

In spite of the remarkable conservation and synteny of

genes in the genome of the two species (Keim et al.

2009), one striking difference between B. anthracis and

B. thuringiensis is their geographical distribution. The for-

mer is found only in very specific geographical locations

(Hugh-Jones and Blackburn 2010), while the latter is

ubiquitous in soil (Martin and Travers 1989). One defin-

ing difference in the genomes of the two species is that

B. anthracis lacks a functional gene for PlcR. This is a

vital regulator of virulence during insect pathogenesis by

B. thuringiensis (Salamitou et al. 2000). PlcR controls at

least 45 genes (Gohar et al. 2008) and has been proposed

to control interactions with the external environment

through sensing mechanisms (Gohar et al. 2008) and the

release of exoenzymes etc. (Ivanova et al. 2003; Gohar

et al. 2008). In the microcosm experiments reported here,

B. thuringiensis was much more able to persist in vegeta-

tive form (Fig. 2) than B. anthracis (Figs 5 and 6), which

rapidly disappeared once germinated. Whether this

enhanced ability of the former organism to survive was

attributable to a function controlled by PlcR was further

examined. Vegetative cells rather than spores were inocu-

lated to represent the pressure that germinated spores

would be under to survive. This approach removed any

interpretational difficulties arising from adding germi-

nants to wild type and plcR– spores in the microcosms.

The plcR� mutants of B. thuringiensis strain 407 was

found here to be better able to colonize the plant/soil

microcosms than the wild-type strain. To corroborate this

phenomenon, a plcR� mutant was constructed from a

strain, 158-S-2, maintained as an environmental isolate.

Both of the plcR� mutants colonized the microcosm bet-

ter than their respective wild-type strains (Fig. 8). It has

been shown previously (Hsueh et al. 2006) that PlcR

represses biofilm production by decreasing the produc-

tion of a biosurfactant. A plcR� mutant was thus able to

swarm in a way that the wild type was not (Hsueh et al.

2007). Such a method of translocation is important even

for motile members of the B. cereus sensu lato group

(Vilain et al. 2006). This may be part of the reason for

the poorer colonization abilities of the wild-type strain.

Further evidence for the lack of involvement of genes

controlled by PlcR in soil survival was shown by Bishop

et al. (2014). They showed that a reporter gene under the

control of PlcR was not activated in the soil, whereas the

same reporter under the control of a sporulation gene

was strongly expressed. The detrimental effect that

expression of plcR appears to have on soil survival for

B. thuringiensis must be offset by its involvement in path-

ogenicity (Salamitou et al. 2000; Ivanova et al. 2003;

Jensen et al. 2003; Raymond et al. 2010). The reason for

the highly localized global occurrence of B. anthracis

compared to B. thuringiensis and the inability of the for-

mer organism to persist as vegetative cells in the micro-

cosms used here are, as yet, unexplained.

The major implication from this work is that, assum-

ing that active germinants can be applied effectively to

soils, they can have a dramatic effect at removing spores

of B. anthracis. The outdoor conditions experienced

would not be as stable as those used here with, for exam-

ple, diurnal fluctuations of temperature and humidity.

Also, only one soil type was used. Nevertheless, assuming

that some approximation of the ideal conditions experi-

enced in the microcosms were experienced, a significant

reduction in spore load might be expected. If the inability

of germinated spores to retain viability seen here

(Figs 5–7) is replicated outdoors, then the need for



subsequent steps such as enzymes (Schuch et al. 2002;

Mehta et al. 2013), bacteriophages (Schuch et al. 2010)

or chemical treatments (Calfee et al. 2011) might be

decreased, although they might have an additive effect.

Work is currently ongoing to study the application of

germinants to solid outdoor surfaces such as roads and

buildings to ascertain whether conditions conducive to

germination can be maintained. This work also reinforces

the need when developing decontamination capabilities

to compare the response of simulant organisms to the

agent of concern under the most representative condi-

tions possible.

Acknowledgements

This work was funded by the Defense Threat Reduction

Agency, U.S.A. and the Ministry of Defence, U.K.

Conflicts of Interest

There are no conflicts of interest.

References

Agaisse, H., Gominet, M., Økstad, O.A., Kolstø, A.B. and

Lereclus, D. (1999) PlcR is a pleiotropic regulator of

extracellular virulence factor gene expression in Bacillus

thuringiensis. Mol Microbiol 32, 1043–1053.

Anon. (2013) Decontamination of soil contaminated with

Bacillus anthracis spores. EPA Technical Evaluation report

EPA/600/R-13/110.

Bishop, A.H. and Rachwal, P.A. (2014) Identification of genes

required for soil survival in Burkholderia thailandensis by

transposon-directed insertion site sequencing. Curr

Microbiol 68, 693–701.

Bishop, A.H. and Robinson, C.V. (2014) Bacillus thuringiensis

HD-1 Cry�: development of a safe, non-insecticidal

simulant for Bacillus anthracis. J Appl Microbiol 117,

654–662.

Bishop, A.H., Rachwal, P.A. and Vaid, A. (2014) Identification

of genes required for soil survival in Bacillus thuringiensis

by transposon-directed insertion site sequencing. Curr


Bizzarri, M.F., Prabhakar, A. and Bishop, A.H. (2008)

Multiple-locus sequence typing analysis of Bacillus

thuringiensis recovered from the phylloplane of clover

(Trifolium hybridum) in vegetative form. Microb Ecol 55,

619–625.

Bourguet, F.A., Souza, B.E., Hinz, A.K., Coleman, M.A. and

Jackson, P.J. (2012) Characterization of a novel lytic

protein encoded by the Bacillus cereus E33L gene ampd as

a Bacillus anthracis antimicrobial protein. Appl Environ

Microbiol 78, 3025–3027.

Buhr, T.L., Young, A.A., Minter, Z.A., Wells, C.M.,

McPherson, D.C., Hooban, C.L., Johnson, C.A., Prokop,

E.J. et al. (2012) Test method development to evaluate

hot, humid air decontamination of materials

contaminated with Bacillus anthracis Delta Sterne and

B. thuringiensis Al Hakam spores. J Appl Microbiol 113,

1037–1051.

Calfee, M.W., Choi, Y., Rogers, J., Kelly, T., Willenberg, Z.

and Riggs, K. (2011) Lab-scale assessment to support

remediation of outdoor surfaces contaminated with

Bacillus anthracis spores. J Bioterror Biodef 2, 110.

Davis, K.E.R., Joseph, S.J. and Janssen, P.H. (2005) Effects of

growth medium, inoculum size, and incubation time on

culturability and isolation of soil bacteria. Appl Environ


Driks, A. (2009) The Bacillus anthracis spore. Mol Aspects Med

30, 368–373.

Fulmer, P.A. and Wynne, J.H. (2012) Coatings capable of

germinating and neutralizing Bacillus anthracis

endospores. Appl Mater Interfaces 4, 738–743.

Gohar, M., Faegri, K., Perchat, S., Ravnum, S., Økstad, O.E.,

Gominet, M., Kolstø, A.B. and Lereclus, D. (2008) The

PlcR regulon of Bacillus cereus. PLoS One 3, e2793.

Gould, G.W., Jones, A. and Wrighton, C. (1968) Limitations

of the initiation of germination of bacterial spores as a

spore control procedure. J Appl Bacteriol 31, 357–366.

Greenberg, D.L., Busch, J.D., Keim, P. and Wagner, D.W.

(2010) Identifying experimental surrogates for Bacillus

anthracis spores: a review. Investig Genet 1, 4–16.

Helgason, E., Økstad, O.A., Caugant, D.A., Johansen, H.A.,

Fouet, A., Mock, M., Hegna, I. and Kolstø, A.-B. (2000)

Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis

– one species on the basis of genetic evidence. Appl

Environ Microbiol 66, 2627–2630.

Hsueh, Y.-H., Somers, E.B., Lereclus, D. and Lee Wong, A.C.

(2006) Biofilm formation by Bacillus cereus is influenced

by PlcR, a pleiotropic regulator. Appl Environ Microbiol

72, 5089–5092.

Hsueh, Y.-H., Somers, E.B., Lereclus, D., Ghelardi, E. and Lee

Wong, A.C. (2007) Biosurfactant production and surface

translocation are regulated by PlcR in Bacillus cereus

ATCC14579 under low-nutrient conditions. Appl Environ

Microbiol 73, 7225–7231.

Hugh-Jones, M. and Blackburn, J. (2010) The ecology of

Bacillus anthracis. Mol Aspects Med 30, 356–367.

Ireland, J. and Hanna, P.C. (2002) Amino acid- and purine

ribonucleoside-induced germination of Bacillus

anthracis DeltaSterne endospores: gerS mediates

responses to aromatic ring structures. J Bacteriol 184,

1293–1303.

Ivanova, N., Sorokin, A., Anderson, I., Galleron, N., Candelon,

B., Kapatral, V., Bhattacharyya, A., Rezni, G. et al.

(2003) Genome sequence of Bacillus cereus and

comparative analysis with Bacillus anthracis. Nature 423,

87–91.



Jensen, G.B., Hansen, B.M., Eilenberg, J. and Mahillon, J.

(2003) The hidden lifestyles of Bacillus cereus and relatives.

Environ Microbiol 5, 631–640.

Keim, P., Gruendike, J.M., Klevytska, A.M., Schupp, J.M.,

Challacombe, J. and Okinaka, R. (2009) The genome and

variation of Bacillus cereus. Mol Aspects Med 30, 397–405.

Lecadet, M.-M., Blondel, M.O. and Ribier, J. (1980) A semi-

defined medium for growth and sporulation in B.

thuringiensis berliner and many other strains. J Gen

Microbiol 121, 203–212.

Luu, H., Akoachere, M., Patra, M. and Abel-Santos, E. (2011)

Cooperativity and interference of germination pathways in

Bacillus anthracis spores. J Bacteriol 193, 4192–4198.

Manchee, R.J., Broster, M.G., Stagg, A.J. and Hibbs, S.E.

(1994) Formaldehyde solution effectively inactivates spores

of Bacillus anthracis on the Scottish Island of Gruinard.

Appl Environ Microbiol 60, 4167–4171.

Martin, P.A.W. and Travers, R.S. (1989) Worldwide

abundance and distribution of Bacillus thuringiensis

isolates. Appl Environ Microbiol 55, 2437–2442.

McGillivray, S.M., Ebrahimi, C.M., Fisher, N., Sabet, M.,

Zhang, D.X., Chen, Y., Haste, N.M., Aroian, R.V. et al.

(2009) ClpX Contributes to innate defense peptide

resistance and virulence phenotypes of Bacillus anthracis.

J Innate Immun 1, 494–506.

Mehta, K.K., Paskaleva, E.E., Azizi-Ghannad, S., Ley, D.J.,

Page, M.A., Dordick, J.S. and Kane, R.S. (2013)

Characterization of AmiBA2446, a novel bacteriolytic

enzyme active against Bacillus species. Appl Environ

Microbiol 79, 5899–5906.

Moir, A. (2006) How do spores germinate? J Appl Microbiol

101, 526–530.

Nerandzic, M.M. and Donskey, C.J. (2010) Triggering

germination represents a novel strategy to enhance killing

of Clostridium difficile spores. PLoS One 5, e12285.

Nicholson, W.L., Munakata, N., Horneck, G., Melosh, H.J.

and Setlow, P. (2000) Resistance of Bacillus endospores to

extreme terrestrial and extraterrestrial environments.

Microbiol Mol Biol Rev 64, 548–572.

Omotade, T.O., Heffron, J.D., Klimko, C.P., Marchand, C.L.,

Miller, L.L., Halasahoris, S.A., Bozue, J.A., Welkos, S.L.

et al. (2013) D-cycloserine or similar physiochemical

compounds may be uniquely suited for use in Bacillus

anthracis spore decontamination strategies. J Appl

Microbiol 115, 1343–1356.

Rasko, D.A., Altherr, M.R., Han, C.S. and Ravel, J. (2005)

Genomics of the Bacillus cereus group of organisms. FEMS

Microbiol Rev 29, 303–329.

Raymond, B., Johnston, P.R., Nielsen-LeRoux, C., Lereclus, D.

and Crickmore, N. (2010) Bacillus thuringiensis: an

impotent pathogen? Trends Microbiol 18, 189–194.

Saile, E. and Koehler, T.M. (2006) Bacillus anthracis

multiplication, persistence, and genetic exchange in the

rhizosphere of grass plants. Appl Environ Microbiol 72,

3168–3174.

Salamitou, S., Ramisse, F., Breh�elin, M., Bourguet, D., Gilois,

N., Gominet, M., Hernandez, E. and Lereclus, D.

(2000) The plcR regulon is involved in the

opportunistic properties of the Bacillus thuringiensis and

Bacillus cereus in mice and insects. Microbiology 146,

2825–2832.

Sambrook, J., Fritsch, E.F. and Maniatis, T. (1987) Molecular

Cloning: A Laboratory Manual, 2nd edn. Cold Spring

Harbor, NY, USA: Cold Spring Harbor Laboratory.

Schuch, R., Nelson, D. and Fischetti, V.A. (2002) A

bacteriolytic agent that detects and kills Bacillus anthracis.

Nature 418, 884–889.

Schuch, R., Pelzek, A.J., Kan, S. and Fischetti, V.A. (2010)

Prevalence of Bacillus anthracis-like organisms and

bacteriophages in the intestinal tract of the earthworm

Eisenia fetida. Appl Environ Microbiol 76, 2286–2294.

Schwartz, M. (2009) Dr. Jekyll and Mr. Hyde: a short history

of anthrax. Mol Aspects Med 30, 347–355.

Setlow, P. (2006) Spores of Bacillus subtilis: their resistance to

radiation, heat and chemicals. J Appl Microbiol 101, 514–

525.

Tufts, J.A.M., Calfee, M.W. and Lee, S.D. (2014) Bacillus

thuringiensis as a surrogate for Bacillus anthracis in aerosol

research. World J Microbiol Biotechnol 30, 1453–1461.

Vilain, S., Luo, Y., Hildreth, M.B. and Brozel, S.V. (2006)

Analysis of the life cycle of the soil saprophyte Bacillus

cereus in liquid soil extract and in the soil. Appl Environ

Microbiol 72, 4970–4977.



germination and persistence of bacillus anthracis and ...

Documents