Download - Germination and persistence of Bacillus anthracis and Bacillus thuringiensis in soil microcosms
ORIGINAL ARTICLE
Germination and persistence of Bacillus anthracis andBacillus thuringiensis in soil microcosmsA.H. Bishop
Detection Department, Defence Science and Technology Laboratory, Salisbury, Wiltshire, UK
Keywords
Bacillus anthracis, Bacillus thuringiensis,
germination, PlcR, vegetative persistence.
Correspondence
Alistair H. Bishop, Detection Department,
Defence Science and Technology Laboratory,
Porton Down, Salisbury, Wiltshire SP4 0JQ,
UK.
E-mail: [email protected]
2014/1373: received 6 July 2014, revised 2
August 2014 and accepted 4 August 2014
doi:10.1111/jam.12620
Abstract
Aims: Decontaminating large, outdoor spaces of Bacillus anthracis spores
presents significant problems, particularly in soil. Proof was sought that the
addition of germinant chemicals could cause spores of B. anthracis and Bacillus
thuringiensis, a commonly used simulant of the threat agent, to convert to the
less resistant vegetative form in a microcosm.
Methods and Results: Nonsterile plant/soil microcosms were inoculated with
spores of B. thuringiensis and two nonpathogenic strains of B. anthracis. A
combination of L-alanine (100 mmol l�1) and inosine (10 mmol l�1) resulted
in a 6 log decrease in spore numbers in both strains of B. anthracis over
2 weeks at 22°C; a 3 log decrease in B. anthracis Sterne spore numbers was
observed after incubation for 2 weeks at 10°C. Negligible germination nor a
decrease in viable count occurred in either strain when the concentration of
L-alanine was decreased to 5 mmol l�1. Germinated spores of B. thuringiensis
were able to persist in vegetative form in the microcosms, whereas those of
B. anthracis rapidly disappeared. The pleiotropic regulator PlcR, which
B. anthracis lacks, does not contribute to the persistence of B. thuringiensis in
vegetative form in soil.
Conclusions: The principle of adding germinants to soil to trigger the
conversion of spores to vegetative form has been demonstrated. Bacillus
anthracis failed to persist in vegetative form or resporulate in the microcosms
after it had been induced to germinate.
Significance and Impact of the Study: The large scale, outdoor
decontamination of B. anthracis spores may be facilitated by the application of
simple, defined combinations of germinants.
Introduction
Bacillus anthracis is regarded by many as the most impor-
tant biological agent of concern (Schwartz 2009). This is
largely because it is able to form highly resistant endosp-
ores (Driks 2009). In this inert form, the bacterium can
persist in some environments for many decades. It is also
impervious to desiccation and has a much higher resil-
ience to heat, ultraviolet radiation and antibacterial
chemicals (Nicholson et al. 2000; Setlow 2006) than other
threat agents. Sporulation normally occurs when the rep-
licative, vegetative form experiences nutrient deprivation.
This process can be reversed by a number of triggers such
as the presence of certain chemical germinants (Moir
2006). There is a very limited number of chemicals
known to cause the spore to dismantle its protective
structures and adaptations and enter vegetative growth
again (Ireland and Hanna 2002).
Once a commitment to germination has occurred, it is
irreversible. During this process and while in the vegeta-
tive form, B. anthracis has a similar susceptibility to inac-
tivation by biocides, heat, radiation and other destructive
measures as other bacterial agents of concern. For this
reason, many strategies to remove spores (Gould et al.
1968; Schuch et al. 2002; Nerandzic and Donskey 2010;
Bourguet et al. 2012; Fulmer and Wynne 2012; Mehta
© 2014 Crown Copyright. Journal of Applied Microbiology 117, 1274--1282 © 2014 Society for Applied Microbiology
This article is published with the permission of the Controller of HMSO and the Queen’s Printer for Scotland.1274
Journal of Applied Microbiology ISSN 1364-5072
et al. 2013; Omotade et al. 2013) include, as an initial
step, the use of chemical germinants. While chemical
germinants are effective under monoseptic conditions
in vitro (Luu et al. 2011), there is little information about
how they perform in the outdoor environment. In this
respect, the most difficult environment would be soil, as
it contains high levels and varied species of resident
micro-organisms. The most active germinants can be
readily metabolized, and it was feared that the soil micro-
flora would rapidly scavenge these nutrients and use
them for their own growth and survival before they could
trigger spore germination. Using a high throughput
sequencing technique, the plant/soil microcosms have
been demonstrated to replicate the highly competitive
environment that is thought to pertain in natural soils
(Bishop and Rachwal 2014; Bishop et al. 2014). They
therefore represent an amenable method to assess the
effect of germinants in soil.
Bacillus thuringiensis is very closely related to B.
anthracis (Helgason et al. 2000; Rasko et al. 2005) and is
gaining acceptance as the most accurate outdoor simulant
for this threat agent (Greenberg et al. 2010; Buhr et al.
2012; Tufts et al. 2014; Bishop and Robinson 2014). A
nonpathogenic, spore-forming simulant such as B. thurin-
giensis will, by necessity, be used to evaluate different
approaches to the decontamination of B. anthracis spores.
It is therefore important to understand how the simulant
responds to methodologies designed for B. anthracis and
the reasons for divergences in the responses of the two
species. One of the few, obvious, genetic differences
between B. anthracis and B. thuringiensis is the lack in
the former organism of the gene encoding the pleiotropic
regulator, PlcR (Gohar et al. 2008). These authors have
suggested that among the functions that PlcR is involved
in are mechanisms sensing the external environment, the
activation of exoenzyme synthesis and functions related
to external survival.
Proof of principle was sought that spores of B. thurin-
giensis and attenuated strains of B. anthracis could be ger-
minated in nonsterile, plant/soil microcosms. The
involvement of PlcR in the persistence of vegetative cells
in the soil was also investigated.
Materials and methods
Bacterial strains and growth conditions
Two nonpathogenic strains of B. anthracis, UM23CL2
and Sterne, were obtained from Defence Science and
Technology Laboratory (Dstl) stocks. The noninsecticidal
derivative of B. thuringiensis HD-1 cry� (Bishop and
Robinson 2014) was also from Dstl stocks. Bacillus thur-
ingiensis strain 158-S-2 was isolated from the phylloplane
of clover (Bizzarri et al. 2008). Bacillus thuringiensis strain
407 and its PlcR-deficient derivative (407PlcR–) were kind
gifts from Professor. Didier Lereclus (INRA, France).
To facilitate the recovery of B. thuringiensis HD-1cry�
and B. anthracis UM23CL2 from soil, they were chromo-
somally tagged with the transposon in pAW068, as
described by Bishop et al. (2014). Bacillus anthracis
Sterne was chromosomally tagged with the transposon in
pUTE618, using the method of McGillivray et al. (2009).
Pools of the transformed strains were recovered from
plant/soil microcosms after incubation for 2 weeks to
ensure that any mutants in which the transposon had
inserted into a vital survival gene were excluded (Bishop
et al. 2014). Transposon pAW068 confers resistance to
spectinomycin (100 lg ml�1); B. anthracis Sterne trans-
formed with transposon pUTE618 was resistant to kana-
mycin (50 lg ml�1). Bacillus thuringiensis 407 PlcR� is
resistant to erythromycin (5 lg ml�1). The plcR� mutant
of B. thuringiensis is resistant to chloramphenicol
(10 lg ml�1).
Spores of all species were produced using nutrient
broth with yeast extract and supplements (NBYS) and the
method of Lecadet et al. (1980). Tryptone soy broth
(TSB) and tryptone soy agar (TSA) were used for general
growth and plate counts, supplemented with the appro-
priate antibiotic. Wild-type strains of B. thuringiensis
were enumerated on TSA supplemented with penicillin
(80 lg ml�1) and polymyxin B (20 lg ml�1). An indica-
tion of the levels of the resident microflora in the micro-
cosms was gained by enumeration on TSA without
antibiotics. Spore counts were determined by heat shock
at 65°C for 30 min followed by plating on the appropri-
ate growth medium. All media components were pur-
chased from Oxoid and the chemicals from Sigma
Aldrich (Gillingham, Dorset, UK).
DNA vectors and manipulation techniques
A PlcR-deficient mutant of B. thuringiensis strain 158-S-2
(158-PlcR�) was produced by homologous recombina-
tion. The plcR gene was amplified using the primers and
conditions of Agaisse et al. (1999) to produce an ampli-
con of 1�6 Kb. The chloramphenicol resistance gene from
pBBRMCS1 (obtained from Dr Cristian Vidal, University
of Cardiff, U.K.) was amplified using the primers (for-
ward ACTCATATGGCTGCATTAATGAATCGGCCA and
reverse ACTCATATGGAATAAATACCTGTGACGGAAG
ATCACTTC), which incorporate NdeI sites at both ends,
and the same thermal cycling profile as for plcR. The
900 bp amplicon was cloned into the TOPO-TA plasmid
(Invitrogen, Paisley, Renfrewshire, UK).The chloramphenicol
resistance gene was excised by digestion with NdeI and
ligated into the NdeI site in the middle of the plcR gene
© 2014 Crown Copyright. Journal of Applied Microbiology 117, 1274--1282 © 2014 Society for Applied Microbiology 1275
A.H. Bishop Germination of spores in soil
fragment cloned into TOPO-TA. The resulting construct
was transformed into competent cells of Escherichia coli
(TOP 10, Invitrogen) and selected on Luria–Bertani(Sambrook et al. 1987) agar containing chloramphenicol
(10 lg ml�1). The resulting clones were selected on the
basis of producing the correct-sized fragments following
amplification with combinations of the plcR and chl-
oramphenicol resistance gene primers. The plcR gene in
TOPO-TA, disrupted with the chloramphenicol resistance
gene, was inserted into the BamHI cloning site of
pRN5101, a temperature-sensitive shuttle vector obtained
from Dr Neil Crickmore, University of Sussex. This con-
struct was then electroporated into B. thuringiensis strain
158-S-2 using the method of Bishop et al. (2014) and
transformed colonies selected on Luria–Bertani agar
(Sambrook et al. 1987) containing chloramphenicol
(10 lg ml�1) and tetracycline (5 lg ml�1). Electrotrans-
formants were then grown overnight in TSB containing
chloramphenicol (10 lg ml�1) at the nonpermissive rep-
lication temperature for pRN5101 (37°C). Surviving cells
could only maintain the required chloramphenicol resis-
tance gene by homologous recombination between the
functional, chromosomal copy of the plcR gene and the
disrupted, plasmid-borne fragment. It was verified that
amplification of DNA from 158-PlcR� with the plcR
primers produced only a 2�5 kB product, indicative of
the disrupted gene. This was verified by DNA sequencing.
The phospholipase-deficient phenotype of 158-S-2 PlcR�
was demonstrated using Bacillus cereus selective medium
(Oxoid, Basingstoke, Hampshire, UK).
Plant/soil microcosms
Plant/soil microcosms were prepared as described by
Bishop et al. (2014). The soil was classified as a loam
with a density of 1�3 kg l�1 (Forestry Commission, Farn-
ham, Surrey, UK). The major chemical constituents were
total nitrogen, 0�22%; total organic carbon, 3�17%; total
inorganic carbon, 5�17%; calcium, 3�36 g kg�1; potas-
sium, 262 mg kg�1; magnesium, 74 mg kg�1; and
sodium, 9�3 mg kg�1. The microcosms were incubated,
unless otherwise stated, at 22°C, with 80% relative
humidity and 12 : 12 photoperiod in an environmental
cabinet (Weiss) for 4 weeks to allow the grasses (Bishop
et al. 2014) to grow and the microbial community to
equilibrate. Nonsterile tap water which had been dechlo-
rinated with activated carbon filters (Hagen, Castleford,
Yorkshire, UK) was applied to maintain the soil in a
moist but not saturated state. Less than 100 ll of waterwere added per g of soil per week.
For germination experiments, spores were added at a
density of approx. 1 9 107 colony forming units
(CFU) g�1 dry weight of soil. These were inoculated as
ten aliquots of 10 ll over the surface of the soil to
approximate to an aerosol deposition. No subsequent
mixing of the plant/soil microcosm took place. Solutions
of germinants from 10-fold stocks were added evenly
over the top of the soil the following day to produce a
final concentration in the soil of each well as follows: ala-
nine (100 mmol l�1) plus inosine (10 mmol l�1) (Sigma
Aldrich); yeast extract (0�2%) or brain–heart infusion
broth (0�2%) (Oxoid). Approximately 120 ll of the ger-
minant solutions was added per g of soil. The stated final
concentrations assumed that the germinants would be
evenly distributed within the soil. The experiments were
repeated twice with fresh materials. Eight replicates of
each treatment were made.
Wild type and plcR� mutants of B. thuringiensis strains
407 and 158-S-2 were inoculated separately into plant/soil
microcosms, in vegetative form, as described in Bishop
et al. (2014). The experiment was carried out three times
with fresh components, and eight replicates of the micro-
cosms, which were processed separately, were made for
each strain. The level of inoculation in all cases was
6 9 105 CFU g�1 dry weight of soil.
Bacteria were extracted from soil of all of the micro-
cosms as previously described (Bishop et al. 2014). A heat
shock, as described above, was used to differentiate
between vegetative and spore forms. Colony counts were
made within 24 h of incubation at 25°C.
Results
Germination of Bacillus thuringiensis
Serial dilutions of the extracted suspensions of the micro-
cosms were spread on TSA without antibiotic selection,
with and without heat shock. This was to gauge the
response of the natural microflora to the addition of the
germinants (and the inoculated spores). No medium can
support the growth of more than a small proportion of
the micro-organisms that exist in soil (Davis et al. 2005),
and so, these were termed ‘total’ counts to indicate that
the selective nature of what was being represented was
recognized.
Even in the absence of added germinants, there was an
increase in the background microflora (‘total’ counts) by
the second week (Fig. 1). There was a decrease in the
B. thuringiensis count of about one log over the same
time. Whether these two phenomena are related, that is
the natural microflora were multiplying at the expense of
the survival of B. thuringiensis is unknown.
When alanine and inosine were added (Fig. 2), there
was a dramatic decrease in the population of B. thuringi-
ensis remaining: by the second week the total count had
decreased by three logs. Significantly, the number of
© 2014 Crown Copyright. Journal of Applied Microbiology 117, 1274--1282 © 2014 Society for Applied Microbiology1276
Germination of spores in soil A.H. Bishop
spores had dropped by five logs. In other words, only
0�35% of the total population at that time was present in
the spore form. Assuming that the less resilient, vegetative
cells could be killed by a decontaminant, a five and a half
log decrease in the B. thuringiensis population would
result. It is of interest that, during this process, there was
an increase in the number of heat-sensitive microflora by
week one which declined somewhat by week two. Their
effect on the germination and persistence of the inocu-
lated bacteria was not investigated further.
Yeast extract produced similar results (Fig. 3) to alanine
plus inosine (Fig. 2): by the second week the total B. thur-
ingiensis count had decreased by nearly four logs. The vast
majority of the population was in the vegetative form with
spores representing 2% of the total numbers. The concom-
itant increase in general microflora previously seen (Fig. 2)
was not seen in this instance. One possible explanation
could be that a group of organisms such as fungi, which
would not appear under the plate counting conditions
used, was multiplying at the expense of the germinants or
B. thuringiensis. Brain–heart infusion broth, another unde-
fined growth medium for bacteria, was also tested (Fig. 4).
This produced a three log decrease in total B. thuringiensis
count after 14 days. It is of interest that the total popula-
tion remaining was almost all in the spore form, and the
large presence of vegetative cells seen previously in Figs 2
and 3 was not replicated here.
0·00
1·00
2·00
3·00
4·00
5·00
6·00
7·00
8·00
9·00
10·00
Log
CF
U g
–1 s
oil
0 1 2
Time (weeks)
Figure 1 Spore germination in control microcosms: no germinant
added. Total viable counts of Bacillus thuringiensis (spores and vege-
tative cells) ; B. thuringiensis spore count ; ‘total’ viable bacterial
count and ‘total’ viable spore count . Error bars represent
standard error around the mean.
0·001·002·003·004·005·006·007·008·009·00
10·00
0 1 2
Log
CF
U g
–1 s
oil
Time (weeks)
Figure 2 Spore germination in the presence of alanine
(100 mmol l�1) plus inosine (10 mmol l�1). Total viable counts of
Bacillus thuringiensis (spores and vegetative cells) ; spore count ;
‘total’ viable bacterial count and ‘total’ viable spore count .
Error bars represent standard error around the mean.
0·00
1·00
2·00
3·00
4·00
5·00
6·00
7·00
8·00
9·00
0 1 2
Log
CF
U g
–1 s
oil
Time (weeks)
Figure 3 Spore germination with yeast extract (0�2%). Total viable
counts of Bacillus thuringiensis (spores and vegetative cells) ;
B. thuringiensis spore count ; ‘total’ viable bacterial count and
‘total’ viable spore count . Error bars represent standard error
around the mean.
0·001·002·003·004·005·006·007·008·009·00
10·00
0 1 2
Log
CF
U g
–1 s
oil
Time (weeks)
Figure 4 Spore germination with brain–heart infusion (0�2%). Total
viable counts of Bacillus thuringiensis (spores and vegetative cells) ;
B. thuringiensis spore count ; ‘total’ viable bacterial count and
‘total’ viable spore count . Error bars represent standard error
around the mean.
© 2014 Crown Copyright. Journal of Applied Microbiology 117, 1274--1282 © 2014 Society for Applied Microbiology 1277
A.H. Bishop Germination of spores in soil
Germination of Bacillus anthracis UM23CL2
The response of spores of B. anthracis UM23CL2 to the
three types of germinant used is shown in Fig. 5. The
spontaneous level of germination in the absence of any
added germinants seen with B. thuringiensis (Fig. 1) was
not repeated with B. anthracis UM23CL2: the spore inoc-
ulum remained static throughout the 2-week period, both
in terms of overall numbers and the fact that no vegeta-
tive cells were present. Yeast extract and brain–heart infu-sion broth were ineffective in eliciting germination in
B. anthracis UM23CL2, under the conditions used. This
is in marked contrast to the high levels of germination
seen with B. thuringiensis (Figs 3 and 4, respectively).
Alanine and inosine were even more successful at trigger-
ing germination than they were with the simulant species
(Fig. 2). A greater than four log decrease in spore num-
bers occurred within 1 week. By the second week, the
level of B. anthracis had fallen below the limit of detec-
tion (Fig. 5). Although the spore load decreased, there
was no residual population of vegetative cells, as was seen
with B. thuringiensis (Fig. 2). The implication is that,
unlike the latter organism, vegetative cells of B. anthracis
could not survive under the microcosm conditions, nor
could they resporulate.
It has been shown in vitro that the response of spores
to germinants is highly influenced by concentration
(Omotade et al. 2013). Fresh experiments were set up to
investigate this in microcosms using lower levels of ala-
nine (5 mmol l�1) while retaining the inosine concentra-
tion at 10 mmol l�1. Under these conditions, there was a
negligible decrease in the total level of B. anthracis strains
UM23CL2 and Sterne and no germination occurred.
Germination of Bacillus anthracis Sterne
As with B. anthracis UM23CL2, there was no decrease in
the total count, nor any germination in B. anthracis
Sterne in the control wells over the 2-week period
(Fig. 6). Unlike B. anthracis UM23CL2, yeast extract did
have a germinating effect, resulting in over a three log
(i.e. over 99�9%) decrease in the total count after 14 days.
The combination of L-alanine and inosine was as effective
at triggering germination in B. anthracis Sterne (Fig. 6)
as it was in the other attenuated strain (Fig. 5): at least
a six log decrease in total count occurred. As with
B. anthracis UM23CL2, the germinated spores did not
persist in the vegetative form (Fig. 6). This is in marked con-
trast to germinated spores in B. thuringiensis (Figs 2 and 3).
All of the microcosms in the previous experiments had
been maintained at 22°C. When the temperature was
decreased to 10°C (Fig. 7), yeast extract elicited about a
two and half log decrease in the total count of B. anthra-
cis Sterne while about a four log decrease occurred in the
presence of L-alanine and inosine.
Role of PlcR on soil colonization
The PlcR� mutants of both strains of B. thuringiensis
were significantly better colonizers (ANOVA, P < 0�05)of the microcosms than their respective wild-type strains,
407 and 158-S-2 (Fig. 8). At every stage of sampling, the
density of the mutants was higher than that of the wild
types. The bacteria were inoculated in vegetative form,
and the trend during the sampling period for both of the
0
1
2
3
4
5
6
7
8
9
210
Log
CF
U g
–1 s
oil
Time (weeks)
Figure 5 Composite graph of the response of Bacillus anthracis
UM23CL2 to a variety of germinants. The microcosms were main-
tained at 22°C. Alanine (100 mmol l�1) plus inosine (10 mmol l�1),
total and spore count; yeast extract (0�2%) total and
spore count and brain–heart infusion (0�2%), total � and spore
count. Control total and spore count. Error bars repre-
sent standard error around the mean.
0
1
2
3
4
5
6
7
8
210
B. a
nthr
acis
CF
U g
–1 s
oil
Time (weeks)
Figure 6 Germination of spores of Bacillus anthracis Sterne in multi-
well microcosms at 22°C. The microcosms were maintained at 22°C.
Alanine (100 mmol l�1) plus inosine (10 mmol l�1), total and
spore count; yeast extract (0�2%) total and spore count.
Control total and X spore count. Error bars represent standard
error around the mean.
© 2014 Crown Copyright. Journal of Applied Microbiology 117, 1274--1282 © 2014 Society for Applied Microbiology1278
Germination of spores in soil A.H. Bishop
wild types and their plcR� mutants was equally towards
an existence almost exclusively in spore form by week 4.
Discussion
Germination studies on spores of B. anthracis have
almost exclusively been carried out under monoseptic,
in vitro conditions (Gould et al. 1968; Ireland and Hanna
2002). This has been very useful in allowing potential
germinants to be screened and interactions between them
to be investigated (Luu et al. 2011; Omotade et al. 2013).
The inactivation of spores of B. anthracis from outdoor
areas that have been contaminated is an important goal
through which this information can be exploited. There
is little information, however, on how well germinants
would perform under nonsterile, ‘field’ conditions. Soil is
possibly a harder matrix to decontaminate by chemical
means (Manchee et al. 1994; Anon. 2013) than the solid
surfaces normally investigated (Calfee et al. 2011). Germi-
nating spores prior to decontamination is therefore an
attractive approach. The uptake of added germinants by
the large and diverse microbiota in soil was, however, a
significant concern. Here, the use of plant/soil micro-
cosms has indicated that very high levels of germination
can result from the addition of germinants. L-alanine
(100 mmol l�1) plus inosine (10 mmol l�1) was the most
effective germination approach used for spores of both
B. thuringiensis and B. anthracis (Figs 2 and 5–7). In both
of the attenuated strains of the latter organism, a greater
than six log reduction in total count was produced fol-
lowing incubation at 22°C for 2 weeks. This response was
dependent upon concentration: when the concentration
of L-alanine was decreased to 5 mmol l�1, there was neg-
ligible germination and no decrease in total count. The
incubation temperature of most of the experiments was
22°C. In many parts of the world, especially at night, this
would be a high value even at the soil surface. When the
incubation temperature was decreased to 10°C, however,L-alanine (100 mmol l�1) plus inosine (10 mmol l�1)
still caused a reduction of 99�99% of the B. anthracis
Sterne inoculum after 2 weeks (Fig. 7).
The use of readily available materials that might act
as germinants and which are also relatively cheap and
0
1
2
3
4
5
6
7
8
9
210
B. a
nthr
acis
Log
CF
U g
–1 s
oil
Time (weeks)
Figure 7 Germination of spores of Bacillus anthracis Sterne in multi-
well microcosms at 10°C. Alanine (100 mmol l�1) plus inosine
(10 mmol l�1), total and spore count; yeast extract (0�2%),
total and spore count. Control total and spore
count. Error bars represent standard error around the mean.
0
1
2
3
4
5
6
7
8
9
0 1 2 3 4
Log
CF
U g
–1 m
icro
cosm
Time (weeks)
Figure 8 Colonization of plant-soil microcosms by Bacillus thuringiensis strain 407 wild type □ and PlcR� mutant and B. thuringiensis strain
158-S-2 wild type and PlcR� mutant . The total count (spores and vegetative forms) is represented here. The error bars represent 95%
confidence limits of the means of data from three experiments.
© 2014 Crown Copyright. Journal of Applied Microbiology 117, 1274--1282 © 2014 Society for Applied Microbiology 1279
A.H. Bishop Germination of spores in soil
available in bulk quantities is an attractive option. While
yeast extract was effective in B. thuringiensis (Fig. 3) and
B. anthracis Sterne (Fig. 6), it had no germinating effect
on B. anthracis UM23CL2 (Fig. 5). Similarly, brain–heartinfusion broth resulted in some germination of B. thurin-
giensis spores (Fig. 4) but had none on those of
B. anthracis UM23CL2. In all of the microcosms, it is
assumed that the germinants had a direct effect in the
demise of the inoculated B. anthracis spores: it could be
that activation of the resident micro-organisms played a
greater or lesser role in removing the spores. The fact
that brain–heart infusion or yeast extract, which would
be expected to be readily used nutrients for a variety of
micro-organisms, had no effect on the levels of B. anthra-
cis UM23CL2 spores argues that a direct germinating
effect was the predominant mechanism for spore
removal. Similarly, yeast extract might be regarded as a
better general nutrient than L-alanine and inosine, but
this reproducibly produced a weaker effect in diminishing
the numbers of B. anthracis Sterne (Figs. 6 and 7).
Although there are many facets of B. thuringiensis that
make it an attractive simulant for B. anthracis (Greenberg
et al. 2010; Bishop and Robinson 2014; Tufts et al. 2014),
it has been shown to behave somewhat differently in soil
in the presence of germinants compared to B. anthracis.
In the presence of L-alanine and inosine, for example, a
large proportion of the inoculated spores of B. thuringi-
ensis germinated (Fig 2). Even 2 weeks after the addition
of the germinants, 99�65% of the total population existed
in the vegetative, heat-sensitive form. While even more
dramatic decreases were seen in the levels of inoculated
spores of both strains of B. anthracis (Figs 5–7), no vege-
tative cells were found at either sampling period. It is
assumed that B. anthracis was incapable of persisting in
the vegetative form under the conditions prevailing in the
microcosms, while B. thuringiensis could do so. Bacillus
anthracis does have a vegetative existence in soils (Saile
and Koehler 2006; Schuch et al. 2010) but, presumably,
only under specific conditions.
In spite of the remarkable conservation and synteny of
genes in the genome of the two species (Keim et al.
2009), one striking difference between B. anthracis and
B. thuringiensis is their geographical distribution. The for-
mer is found only in very specific geographical locations
(Hugh-Jones and Blackburn 2010), while the latter is
ubiquitous in soil (Martin and Travers 1989). One defin-
ing difference in the genomes of the two species is that
B. anthracis lacks a functional gene for PlcR. This is a
vital regulator of virulence during insect pathogenesis by
B. thuringiensis (Salamitou et al. 2000). PlcR controls at
least 45 genes (Gohar et al. 2008) and has been proposed
to control interactions with the external environment
through sensing mechanisms (Gohar et al. 2008) and the
release of exoenzymes etc. (Ivanova et al. 2003; Gohar
et al. 2008). In the microcosm experiments reported here,
B. thuringiensis was much more able to persist in vegeta-
tive form (Fig. 2) than B. anthracis (Figs 5 and 6), which
rapidly disappeared once germinated. Whether this
enhanced ability of the former organism to survive was
attributable to a function controlled by PlcR was further
examined. Vegetative cells rather than spores were inocu-
lated to represent the pressure that germinated spores
would be under to survive. This approach removed any
interpretational difficulties arising from adding germi-
nants to wild type and plcR– spores in the microcosms.
The plcR� mutants of B. thuringiensis strain 407 was
found here to be better able to colonize the plant/soil
microcosms than the wild-type strain. To corroborate this
phenomenon, a plcR� mutant was constructed from a
strain, 158-S-2, maintained as an environmental isolate.
Both of the plcR� mutants colonized the microcosm bet-
ter than their respective wild-type strains (Fig. 8). It has
been shown previously (Hsueh et al. 2006) that PlcR
represses biofilm production by decreasing the produc-
tion of a biosurfactant. A plcR� mutant was thus able to
swarm in a way that the wild type was not (Hsueh et al.
2007). Such a method of translocation is important even
for motile members of the B. cereus sensu lato group
(Vilain et al. 2006). This may be part of the reason for
the poorer colonization abilities of the wild-type strain.
Further evidence for the lack of involvement of genes
controlled by PlcR in soil survival was shown by Bishop
et al. (2014). They showed that a reporter gene under the
control of PlcR was not activated in the soil, whereas the
same reporter under the control of a sporulation gene
was strongly expressed. The detrimental effect that
expression of plcR appears to have on soil survival for
B. thuringiensis must be offset by its involvement in path-
ogenicity (Salamitou et al. 2000; Ivanova et al. 2003;
Jensen et al. 2003; Raymond et al. 2010). The reason for
the highly localized global occurrence of B. anthracis
compared to B. thuringiensis and the inability of the for-
mer organism to persist as vegetative cells in the micro-
cosms used here are, as yet, unexplained.
The major implication from this work is that, assum-
ing that active germinants can be applied effectively to
soils, they can have a dramatic effect at removing spores
of B. anthracis. The outdoor conditions experienced
would not be as stable as those used here with, for exam-
ple, diurnal fluctuations of temperature and humidity.
Also, only one soil type was used. Nevertheless, assuming
that some approximation of the ideal conditions experi-
enced in the microcosms were experienced, a significant
reduction in spore load might be expected. If the inability
of germinated spores to retain viability seen here
(Figs 5–7) is replicated outdoors, then the need for
© 2014 Crown Copyright. Journal of Applied Microbiology 117, 1274--1282 © 2014 Society for Applied Microbiology1280
Germination of spores in soil A.H. Bishop
subsequent steps such as enzymes (Schuch et al. 2002;
Mehta et al. 2013), bacteriophages (Schuch et al. 2010)
or chemical treatments (Calfee et al. 2011) might be
decreased, although they might have an additive effect.
Work is currently ongoing to study the application of
germinants to solid outdoor surfaces such as roads and
buildings to ascertain whether conditions conducive to
germination can be maintained. This work also reinforces
the need when developing decontamination capabilities
to compare the response of simulant organisms to the
agent of concern under the most representative condi-
tions possible.
Acknowledgements
This work was funded by the Defense Threat Reduction
Agency, U.S.A. and the Ministry of Defence, U.K.
Conflicts of Interest
There are no conflicts of interest.
References
Agaisse, H., Gominet, M., Økstad, O.A., Kolstø, A.B. and
Lereclus, D. (1999) PlcR is a pleiotropic regulator of
extracellular virulence factor gene expression in Bacillus
thuringiensis. Mol Microbiol 32, 1043–1053.
Anon. (2013) Decontamination of soil contaminated with
Bacillus anthracis spores. EPA Technical Evaluation report
EPA/600/R-13/110.
Bishop, A.H. and Rachwal, P.A. (2014) Identification of genes
required for soil survival in Burkholderia thailandensis by
transposon-directed insertion site sequencing. Curr
Microbiol 68, 693–701.
Bishop, A.H. and Robinson, C.V. (2014) Bacillus thuringiensis
HD-1 Cry�: development of a safe, non-insecticidal
simulant for Bacillus anthracis. J Appl Microbiol 117,
654–662.
Bishop, A.H., Rachwal, P.A. and Vaid, A. (2014) Identification
of genes required for soil survival in Bacillus thuringiensis
by transposon-directed insertion site sequencing. Curr
Microbiol 68, 477–485.
Bizzarri, M.F., Prabhakar, A. and Bishop, A.H. (2008)
Multiple-locus sequence typing analysis of Bacillus
thuringiensis recovered from the phylloplane of clover
(Trifolium hybridum) in vegetative form. Microb Ecol 55,
619–625.
Bourguet, F.A., Souza, B.E., Hinz, A.K., Coleman, M.A. and
Jackson, P.J. (2012) Characterization of a novel lytic
protein encoded by the Bacillus cereus E33L gene ampd as
a Bacillus anthracis antimicrobial protein. Appl Environ
Microbiol 78, 3025–3027.
Buhr, T.L., Young, A.A., Minter, Z.A., Wells, C.M.,
McPherson, D.C., Hooban, C.L., Johnson, C.A., Prokop,
E.J. et al. (2012) Test method development to evaluate
hot, humid air decontamination of materials
contaminated with Bacillus anthracis Delta Sterne and
B. thuringiensis Al Hakam spores. J Appl Microbiol 113,
1037–1051.
Calfee, M.W., Choi, Y., Rogers, J., Kelly, T., Willenberg, Z.
and Riggs, K. (2011) Lab-scale assessment to support
remediation of outdoor surfaces contaminated with
Bacillus anthracis spores. J Bioterror Biodef 2, 110.
Davis, K.E.R., Joseph, S.J. and Janssen, P.H. (2005) Effects of
growth medium, inoculum size, and incubation time on
culturability and isolation of soil bacteria. Appl Environ
Microbiol 71, 826–834.
Driks, A. (2009) The Bacillus anthracis spore. Mol Aspects Med
30, 368–373.
Fulmer, P.A. and Wynne, J.H. (2012) Coatings capable of
germinating and neutralizing Bacillus anthracis
endospores. Appl Mater Interfaces 4, 738–743.
Gohar, M., Faegri, K., Perchat, S., Ravnum, S., Økstad, O.E.,
Gominet, M., Kolstø, A.B. and Lereclus, D. (2008) The
PlcR regulon of Bacillus cereus. PLoS One 3, e2793.
Gould, G.W., Jones, A. and Wrighton, C. (1968) Limitations
of the initiation of germination of bacterial spores as a
spore control procedure. J Appl Bacteriol 31, 357–366.
Greenberg, D.L., Busch, J.D., Keim, P. and Wagner, D.W.
(2010) Identifying experimental surrogates for Bacillus
anthracis spores: a review. Investig Genet 1, 4–16.
Helgason, E., Økstad, O.A., Caugant, D.A., Johansen, H.A.,
Fouet, A., Mock, M., Hegna, I. and Kolstø, A.-B. (2000)
Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis
– one species on the basis of genetic evidence. Appl
Environ Microbiol 66, 2627–2630.
Hsueh, Y.-H., Somers, E.B., Lereclus, D. and Lee Wong, A.C.
(2006) Biofilm formation by Bacillus cereus is influenced
by PlcR, a pleiotropic regulator. Appl Environ Microbiol
72, 5089–5092.
Hsueh, Y.-H., Somers, E.B., Lereclus, D., Ghelardi, E. and Lee
Wong, A.C. (2007) Biosurfactant production and surface
translocation are regulated by PlcR in Bacillus cereus
ATCC14579 under low-nutrient conditions. Appl Environ
Microbiol 73, 7225–7231.
Hugh-Jones, M. and Blackburn, J. (2010) The ecology of
Bacillus anthracis. Mol Aspects Med 30, 356–367.
Ireland, J. and Hanna, P.C. (2002) Amino acid- and purine
ribonucleoside-induced germination of Bacillus
anthracis DeltaSterne endospores: gerS mediates
responses to aromatic ring structures. J Bacteriol 184,
1293–1303.
Ivanova, N., Sorokin, A., Anderson, I., Galleron, N., Candelon,
B., Kapatral, V., Bhattacharyya, A., Rezni, G. et al.
(2003) Genome sequence of Bacillus cereus and
comparative analysis with Bacillus anthracis. Nature 423,
87–91.
© 2014 Crown Copyright. Journal of Applied Microbiology 117, 1274--1282 © 2014 Society for Applied Microbiology 1281
A.H. Bishop Germination of spores in soil
Jensen, G.B., Hansen, B.M., Eilenberg, J. and Mahillon, J.
(2003) The hidden lifestyles of Bacillus cereus and relatives.
Environ Microbiol 5, 631–640.
Keim, P., Gruendike, J.M., Klevytska, A.M., Schupp, J.M.,
Challacombe, J. and Okinaka, R. (2009) The genome and
variation of Bacillus cereus. Mol Aspects Med 30, 397–405.
Lecadet, M.-M., Blondel, M.O. and Ribier, J. (1980) A semi-
defined medium for growth and sporulation in B.
thuringiensis berliner and many other strains. J Gen
Microbiol 121, 203–212.
Luu, H., Akoachere, M., Patra, M. and Abel-Santos, E. (2011)
Cooperativity and interference of germination pathways in
Bacillus anthracis spores. J Bacteriol 193, 4192–4198.
Manchee, R.J., Broster, M.G., Stagg, A.J. and Hibbs, S.E.
(1994) Formaldehyde solution effectively inactivates spores
of Bacillus anthracis on the Scottish Island of Gruinard.
Appl Environ Microbiol 60, 4167–4171.
Martin, P.A.W. and Travers, R.S. (1989) Worldwide
abundance and distribution of Bacillus thuringiensis
isolates. Appl Environ Microbiol 55, 2437–2442.
McGillivray, S.M., Ebrahimi, C.M., Fisher, N., Sabet, M.,
Zhang, D.X., Chen, Y., Haste, N.M., Aroian, R.V. et al.
(2009) ClpX Contributes to innate defense peptide
resistance and virulence phenotypes of Bacillus anthracis.
J Innate Immun 1, 494–506.
Mehta, K.K., Paskaleva, E.E., Azizi-Ghannad, S., Ley, D.J.,
Page, M.A., Dordick, J.S. and Kane, R.S. (2013)
Characterization of AmiBA2446, a novel bacteriolytic
enzyme active against Bacillus species. Appl Environ
Microbiol 79, 5899–5906.
Moir, A. (2006) How do spores germinate? J Appl Microbiol
101, 526–530.
Nerandzic, M.M. and Donskey, C.J. (2010) Triggering
germination represents a novel strategy to enhance killing
of Clostridium difficile spores. PLoS One 5, e12285.
Nicholson, W.L., Munakata, N., Horneck, G., Melosh, H.J.
and Setlow, P. (2000) Resistance of Bacillus endospores to
extreme terrestrial and extraterrestrial environments.
Microbiol Mol Biol Rev 64, 548–572.
Omotade, T.O., Heffron, J.D., Klimko, C.P., Marchand, C.L.,
Miller, L.L., Halasahoris, S.A., Bozue, J.A., Welkos, S.L.
et al. (2013) D-cycloserine or similar physiochemical
compounds may be uniquely suited for use in Bacillus
anthracis spore decontamination strategies. J Appl
Microbiol 115, 1343–1356.
Rasko, D.A., Altherr, M.R., Han, C.S. and Ravel, J. (2005)
Genomics of the Bacillus cereus group of organisms. FEMS
Microbiol Rev 29, 303–329.
Raymond, B., Johnston, P.R., Nielsen-LeRoux, C., Lereclus, D.
and Crickmore, N. (2010) Bacillus thuringiensis: an
impotent pathogen? Trends Microbiol 18, 189–194.
Saile, E. and Koehler, T.M. (2006) Bacillus anthracis
multiplication, persistence, and genetic exchange in the
rhizosphere of grass plants. Appl Environ Microbiol 72,
3168–3174.
Salamitou, S., Ramisse, F., Breh�elin, M., Bourguet, D., Gilois,
N., Gominet, M., Hernandez, E. and Lereclus, D.
(2000) The plcR regulon is involved in the
opportunistic properties of the Bacillus thuringiensis and
Bacillus cereus in mice and insects. Microbiology 146,
2825–2832.
Sambrook, J., Fritsch, E.F. and Maniatis, T. (1987) Molecular
Cloning: A Laboratory Manual, 2nd edn. Cold Spring
Harbor, NY, USA: Cold Spring Harbor Laboratory.
Schuch, R., Nelson, D. and Fischetti, V.A. (2002) A
bacteriolytic agent that detects and kills Bacillus anthracis.
Nature 418, 884–889.
Schuch, R., Pelzek, A.J., Kan, S. and Fischetti, V.A. (2010)
Prevalence of Bacillus anthracis-like organisms and
bacteriophages in the intestinal tract of the earthworm
Eisenia fetida. Appl Environ Microbiol 76, 2286–2294.
Schwartz, M. (2009) Dr. Jekyll and Mr. Hyde: a short history
of anthrax. Mol Aspects Med 30, 347–355.
Setlow, P. (2006) Spores of Bacillus subtilis: their resistance to
radiation, heat and chemicals. J Appl Microbiol 101, 514–
525.
Tufts, J.A.M., Calfee, M.W. and Lee, S.D. (2014) Bacillus
thuringiensis as a surrogate for Bacillus anthracis in aerosol
research. World J Microbiol Biotechnol 30, 1453–1461.
Vilain, S., Luo, Y., Hildreth, M.B. and Brozel, S.V. (2006)
Analysis of the life cycle of the soil saprophyte Bacillus
cereus in liquid soil extract and in the soil. Appl Environ
Microbiol 72, 4970–4977.
© 2014 Crown Copyright. Journal of Applied Microbiology 117, 1274--1282 © 2014 Society for Applied Microbiology1282
Germination of spores in soil A.H. Bishop