Discrimination of Anemonefish Species by PCR-RFLP Analysis of Mitochondrial

Gene FragmentsChuta Boonphakdee and Pichan Sawangwong

Graduate School of Environmental Science, Burapha University, Chonburi 20131, Thailand

Presented by:Christopher Reed

Loras College

Abstract A means of discriminating among species of clown anemonefishes, based on

restriction enzyme analysis of partial mitochondrial DNA sequences, was investigated. Mitochondrial 16S rRNA and cytochrome b genes from 6 species (7 strains) of anemonefish (Premnas biculeatus, Amphiprion polymnus, A. sandaracinos, A. perideraion, A. ocellaris, A. ocellaris var. and A. percula) were PCR-amplified. A 623-bp portion of 16S rRNA gene was obtained from different fishes using the same pair of primers. Further investigation of this 16S rRNA fragment, by restriction endonuclease digestion with BfuCI and RsaI, was not able to distinguish all fishes studied, but did yield 3 different digestion patterns. The first was specific to P. biculaetus, the sole member of the genus Premnas, while the remaining two separated the Amphiprion species into 2 groups: 1) A. polymnas, A. sandaracinos and A. perideraion, and 2) A. ocellaris, A. ocellaris var. and A. percula. In contrast to this, restriction endonuclease digestion of a 786-bp fragment of the cytochrome b gene with HinfI and RsaI, was able to differentiate different 7 anemonefishes. This utility marker is valuable for unambiguous species/strain identification of juvenile anemonefishes.

Keywords: anemonefish, species identification, 16S rRNA, cytochrome b, PCR-RFLP

IntroductionClownfish are one of the most attractive marine fish and one

of the most desired.Through the use of (PCR) which amplifies genes , Analysis of

Polymerase Chains Reaction (PCR) amplified DNA fragments, can provide an accurate alternative means of identification of individuals to genus, species or even strain level at early stages of embryonic development.

Often sufficient diagnostic information can be obtained from analysis of PCR amplicons digested with restriction enzymes, generating potentially discriminatory Restriction Fragment Length Polymorphism (PCR-RFLP) markers.

In this study the use of PCR-RFLP analysis of two mitochondrial gene fragments to distinguish among seven species (two genera) of anemone fish were investigated.

16S rRNA & cytochrome b were PCR-amplified separately

Why use MtDNA instead of the nuclear genome?

MtDNA sequences are almost exclusively maternally inherited and the rate of evolution of the mtDNA genome is considered to be approximately ten times greater than that of the nuclear genome.

Schematic of a Mitochondrial DNA

Amphiprion perideraion

Premnas biculeatus

Amphiprion polymnus

Amphiprion sandaracinos

Amphiprion Ocellaris

Amphiprion percula

Amphiprion Ocellaris var.

Materials 7 types of clownfish (represented by a least 3 fish) A small fin clip was obtained from each fish and

preserved in 100% ethanol, which was stored at 4 °C until further analysis.

Primers: PCR of the 16S rRNA gene utilized universal primers,

16Sar-L (5'-CGCCTGTTTATCAAAAACAT) and 16Sar-H (5’-CCGGTCTGAACTCAGATCACGT),

These primers previously reported to generate a 16S rRNA gene fragment in various fish species

Specific cytochrome b gene primers, Apocyt_L2 (5’- GACCATAAACGATGCCGACT) and Apocyt_R2 (5’- GACCATAAACGATGCCGACT) were designed from a published sequence for saddleback clownfish (A. polymnus)

These two primer pairs were used separately in PCRs with template genomic DNA from all fish species.

You did what to Nemo’s fin?!?!

TechniquesDNA ExtractionPCR primers and amplificationRFLP pattern analysis

ProcedureMitochondrial DNA was extracted using PCR-ready

genomic DNA isolation and then Restriction Digestion of the PCR products of the

16S rRNA and cytochrome b genes were carried out individually in a 20-μl reaction mixture containing 1x enzyme buffer 8μl of unpurified PCR product and 5 units of each enzyme.

The reaction was then incubated and then the entire reaction was separated with 2.0% SeaKem® LE Agarose

(For exact steps and procedures refer to the literature)

Figure 1. PCR amplified products of mitochondrial 16S rRNA(a) and Cytochrome b (b) gene fragment from different anemonefish species. Lanes 1-7 are Premnas biaculeatus, Amphiprion polymnus, A. sandaracinos, A. perideraion, A. ocellaris, A. ocellaris var. and A. percula, respectively. Lanes C and M are negative (no-DNA) PCR-amplified control and 100bp DNA marker, respectively.

Analysis of the full length amplicons provided no discriminatory power.

b)

bp

1,000- 500-

100-

M 1 2 3 4 5 6 7 C

bp

1,000-

500-

M 1 2 3 4 5 6 7 C

a) 16S rRNA

Results and Discussion

Cytochrome b

Fail……now what?PCR-RFLP patterns of a mitochondrial 16S

rRNA gene fragments and double digested with BfuCI+RsaI

BfuCI and RsaI is used with restriction endonuclease digestion

Figure 2. PCR-RFLP patterns of a mitochondrial 16S rRNA gene fragment double digested with BfuCI+RsaI from different anemonefish species (a) and illustrated in the diagram Lanes 1- 7 are Premnas biaculeatus, Amphiprion polymnus, A. sandaracinos, A. perideraion, A. ocellaris, A. ocellaris var. and A. percula, respectively. Lanes 8 and M are undigested 16S rRNA amplified products and 100bp DNA marker, respectively.

Separation between the genus Premnas and Amphiprion fishes in 3 different digestion patterns.

M 1 2 3 4 5 6 7 8 M

700- 500- 400-

300-

200-

100-

a) 16S rRNA

Amphiprion perideraion

Premnas biculeatus

Amphiprion polymnus

Amphiprion sandaracinos

Amphiprion Ocellaris

Amphiprion percula

Amphiprion Ocellaris var.

Cytochrome bdouble digested it with HinfI+RsaI from the

different anemone fish.The results were…………………

Figure 3. PCR-RFLP patterns of a mitochondrial cytochrome b gene fragment double digested with HinfI+RsaI from different anemonefish species (a) and illustrated in a diagram Lanes 1- 7 are Premnas biaculeatus, Amphiprion polymnus, A. sandaracinos, A. perideraion, A. ocellaris, A. ocellaris var. And A. percula, respectively. Lane 8 is undigested cytochrome b amplified products. Lanes m and M are Low molecular weight and 100bp DNA markers, respectively.

Individual Fish species were able to be discriminated!

M 1 2 3 4 5 6 7 8 M

786-500-

300- 200-

100- 75-

50-

25-

Success!!!!

ConclusionRestriction endonuclease digestion of a 786-

bp fragment of the cytochrome b gene with HinfI and RsaI, was able to differentiate 7 different anemone fish.

This utility marker is valuable for unambiguous species/strain identification of juvenile anemone fish.

Future Studies Determine if there is a correlation between

the clown fish and the Anemone that they prefer to host.

Taking DNA fragments from both Anemone and Clownfish.

Sourceshttp://www.tshe.org/ea/pdf/vol1%20no1%20p

51-54.pdfhttps://shop.lonza.com/shop/prd/seakem-le-ag

arose/lonza_b2b/7.0-7_2_86_69_76_10_13/2/DF369A914A525FF18852001A4B525E10/;jsessionid=(chvsap10_P13_00)ID0126373251DB11072990056482661641End;saplb_*=(chvsap10_P13_00)7609850

Questions?

The End