Vol. 31, No. 11JOURNAL OF CLINICAL MICROBIOLOGY, Nov. 1993, p. 2918-29260095-1137/93/112918-09$02.00/0Copyright © 1993, American Society for Microbiology

Genetic Heterogeneity of Oncogenic Human PapillomavirusType 5 (HPV5) and Phylogeny of HPV5 Variants Associated

with Epidermodysplasia VerruciformisMARIE-CHRISTINE DEAU,1 MICHEL FAVRE,1 STEFANIA JABLONSKA,2

LUIS-ALFREDO RUEDA,3 ADGDERARD ORTHl*Unite des Papillomavirus, Unite de l'Institut National de la Sante et de la Recherche Medicale 190,

Institut Pasteur, 25, rue du Docteur Roux, 75724 Paris Cedex 15, France';Department ofDermatology, Warsaw School ofMedicine, Warsaw, Poland2;

and Centro Dermatologico F. Lleras A., Bogota, Colombia3

Received 8 March 1993/Returned for modification 27 April 1993/Accepted 3 August 1993

Variants of oncogenic human papiliomavirus type 5 (HPV5), specifically associated with epidermodysplasiaverruciformis, were recognized on the basis of the genetic heterogeneity of the E6 open reading frame (ORF).To further evaluate the genetic heterogeneity of HPV5, we sequenced the long control region (LCR), the E7ORF, and the terminal parts of the E2 ORF of five previously characterized HPV5 variants and compared thedata with the published HPV5al and HPV5b sequences. Alignment of the variants showed 140 (7.6%) variablenucleotides of 1,854 sequenced. Nucleotide substitution rates varied from 3.6% in the E7 ORF to 11% in theE6 ORF. By sequencing the variable region encompassing the LCR 3' part and the E6 ORF of isolates fromsix additional epidermodysplasia verruciformis patients, we identified three new variants and three alreadyknown variants, indicating the stability of HPV5 variants. This stability was further demonstrated by theidentity of isolates obtained years later from benign and malignant lesions of three patients. Phylogeneticanalysis of the 10 HPV5 variants distributed them into three groups, tentatively defining subtypes a, b, and c.The phylogenetic grouping shows no geographical dependence, a fact that may be related to the host restrictionthat characterizes HPV5 infections. No differences in the enhancer potential of the LCR or in thetransactivating properties of the E2 protein assayed in vitro were observed among HPV5 variants. WhetherHPV5 variants possess distinct biological properties in vivo remains to be determined.

Human papillomaviruses (HPVs) constitute a large groupof DNA viruses that are associated with benign and malig-nant proliferations of squamous epithelia. At least 66 typeshave been identified so far (38) on the basis of less than 50%cross-hybridization under most stringent hybridization con-ditions (5), while subtypes share greater than 50% cross-hybridization (5, 18). In addition to this great multiplicity oftypes and subtypes, the existence of stable DNA sequencevariants has been disclosed for oncogenic HPV type 16(HPV16) (3, 9, 15), the most frequently encountered HPV inanogenital cancers (46), and for the HPVS and HPV8 (7, 44),associated with skin cancers of epidermodysplasia verruci-formis (EV), a rare disease characterized by a geneticallydetermined, abnormal susceptibility to these viruses (27).The sequences of a 364-bp fragment of the long controlregion (LCR) of 118 HPV16 isolates revealed 38 molecularvariants with 11.5% variable nucleotide positions and a 5%maximal divergence (3). Phylogenetic trees disclosed Eur-asian and African evolutionary lineages (3). The completenucleotide sequences of prototypical HPV5a1 (45) and avariant designated HPV5b (44) revealed a nucleotide diver-gence of 5% in the LCR and amino acid changes of 1.8 to 6%in the viral proteins (44). A comparison of four HPVSvariants obtained from three EV patients (7) with prototyp-ical HPVS (45) disclosed 10.4% variable nucleotide positionsin the E6 open reading frame (ORF), corresponding to 10.4%amino acid substitutions in the E6 putative oncoprotein, and

* Corresponding author.

a maximal sequence divergence of 8.7%. In the E6 gene ofthree HPV8 variants, 3.2% variable nucleotide positions,corresponding to 4.5% amino acid changes, have beenidentified (7, 11). Furthermore, the same HPV5 or HPV8 E6sequences were determined for isolates from benign ormalignant lesions of patients (7). In view of the small numberof HPVS and HPV8 isolates characterized so far, because ofthe rarity of EV patients, it is striking that the variabilityobserved for oncogenic EV HPVs is as extensive as thatdescribed for the widespread HPV16 variants. Because EVis a rare experiment of nature (27), the potentially oncogenicEV HPVs should be a useful model for understanding thevariability and evolution of HPVs.Our first aim was to further analyze five HPVS variants

cloned by our group (7, 19) by sequencing genomic regionsother than the E6 ORF, namely, the LCR, the E7 ORF,encoding a putative oncoprotein, and the 5' and 3' domainsof the E2 ORF, encoding the functional domains of atransregulating protein. In an attempt to further define thegenetic variability of HPVS, we characterized isolates fromsix additional patients of different geographical origins bysequencing the variable region encompassing the 3' end ofthe LCR and the E6 ORF. We addressed the question of thestability of HPVS variants by comparing isolates taken frombenign and malignant lesions of four patients at variousintervals of time (up to 12 years). We established a phylo-genetic classification of the 10 HPVS variants identified sofar, as related to their geographical origin, to obtain someinsight into the evolution of HPVS. Finally, to determinewhether the genetic variability of HPVS affects its biologicalproperties, we assayed in vitro the enhancer activity of the

2918

on October 8, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

PHYLOGENY OF HPV5 VARIANTS 2919

TABLE 1. Origin and classification of HPV5 isolates

ClassificationPatient Nationality Lesions Sequenced regionsb

Chronologica Phylogenetic

1 Polish Benign 5a2 5a2 LCR, E6, E7, E2Malignant 5a2 5a2 3' LCR, E6

2 Dutch Benign 5a2 5a2 3' LCR, E6

3 Algerian Benign 5a3 5b3 LCR, E6, E7, E2Metastatic 5a3 5b3 LCR, E6, E7, E2

4 Colombian Benign 5a4 5b2 LCR, E6, E7, E2Malignant 5a4 5b2 LCR, E6, E7, E2

5c Colombian Benign 5a4 5b2 LCR, E6, E7, E2

6 French Benign 5a5 5a3 LCR, E6, E7, E2Malignant 5a6 5cl LCR, E6, E7, E2

7 Polish Benign 5a7 5a4 3' LCR, E6Malignant 5a7 5a4 3' LCR, E6

8 Polish Benign 5a8 Sa5 3' LCR, E6

9 Algerian Benign 5a9 5b4 3' LCR, E6

l0d Polish Benign 5b 5bl 3' LCR, E6

a By comparison with prototypical HPV5al and HPV5b, both cloned from Japanese patients (44, 45).b Only the 5'- and 3-terminal 300 nt of the E2 ORF were determined.c Sister of patient 4.d Sister of patient 8.

LCR and the transactivating properties of the E2 proteins ofdifferent HPVS variants.

MATERIALS AND METHODS

Tissue specimens. Scrapings were taken from skin flatwarts and macules of 10 EV patients originating from Eu-rope, North Africa, and South America (Table 1). Biopsieswere obtained from cancers of five of these patients (patients1, 3, 4, 5, and 7), i.e., an in situ squamous cell carcinoma ofthe forehead (patient 5), invasive squamous cell carcinomaslocated on the forehead (patients 1 and 4) or in the retroau-ricular region (patient 7), and a cervical lymph node meta-static tumor of an invasive carcinoma of the forehead(patient 3) (Table 1). Samples from benign lesions andcancers were obtained on the same day (patients 4 and 5) orat time intervals of 2 years (patient 7), 3 years (patient 3), and12 years (patient 1). Case reports have been describedelsewhere for patients 1 and 8 (19), patients 2, 4, and 7(patients 5, 6, and 1, respectively, in reference 18), patients3 and 9 (patients 2 and 1, respectively, in reference 23),patient 6 (patient 3 in reference 21), and patient 10 (28).Patients 3, 4, and 6 corresponded to patients A, B, and Crespectively, in reference 7.HPV5 isolates. The molecular cloning of HPV5a2,

HPV5a3, HPV5a4, HPV5a5, and HPV5a6 variants frombenign or malignant lesions of four HPV5-infected EVpatients has been reported elsewhere (7, 19). PrototypicalHPV5al (45) was kindly provided by R. Ostrow (Universityof Minnesota, Minneapolis). The fragments containing the 3'part of the LCR and the E6 ORF (nucleotides [nt] 7716 to690) of isolates from patients 1 and 2 (5a2), patient 5 (5a4),patient 7 (5a7), patient 8 (5a8), patient 9 (5a9), and patient 10(Sb) were amplified by the polymerase chain reaction (PCR)technique (33) with primers located between nt 7716 to 7735and nt 690 to 674. PCR reaction mixtures contained 50 to 100

ng of DNA, 50 mM KCl, 10 mM Tris HCl (pH 8.3), 100 ,uMeach deoxynucleoside triphosphate, 1.5 mM MgCl2, 25 pmolof each primer, and 2 U of thermostable Thernus aquaticus(Taq) DNA polymerase (Perkin-Elmer Cetus Instruments,Emeryville, Calif.). Mixtures were incubated for 5 min at94°C for DNA denaturation. Subsequently, 30 cycles ofamplification were performed with a PCR processor (Hy-baid, Ltd). Each cycle included a denaturation step at 92°Cfor 30 s, an annealing step at 55°C for 1 min, and a chainelongation step at 72°C for 2 min. The final elongation stepwas prolonged for another 7 min. After end filling with theKlenow fragment of DNA polymerase I (34), the fragmentswere inserted by blunt ligation at the unique SmaI site of apBluescript plasmid (Stratagene).DNA sequencing. The nucleotide sequences of the LCR,

the E7 ORF, and the 5' and 3' parts of the E2 ORF ofHPV5a2 to HPV5a6 variants were determined with theoligonucleotide primers described in Table 2. The nucleotidesequence of the E6 ORF of HPV5a2 was determined aspreviously described (7). The nucleotide sequences of frag-ments corresponding to the 3' part of the LCR and the E6ORF were determined with M13 oligonucleotide primerscomplementary to sequences flanking the insert and aninternal E6 primer (nt 438 to 454) in both orientations.Sequencing was performed on both strands of recombinantplasmids by the dideoxy chain termination method (35).

Phylogenetic trees. Multiple alignments of the nucleotidesequences were performed by use of the fast method ofWilbur and Lipman (43), which compares pairs of sequencesand provides a similarity score for each comparison. Thesimilarity scores were used to construct a phylogenetic treeby unweighted pair-group maximum-average (UPGMA)analysis (37), which yields clusters of similar sequences. TheUPGMA method was executed with the CLUSTAL Voption (14). The results of the multiple sequence alignmentswere also used to construct phylogenetic trees by the max-

VOL. 31, 1993

on October 8, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

2920 DEAU ET AL.

C-)

._

co0)

0.

0c

0

4-

Cr.

0)

0)

r.

0L)0

0)

c . 0)...

.~ .c

CT0)

Cl

COm0

COw

o. COo

4o m

0 >to

00)00-

O'a

0

C) =

=..

ro.2.0

z

._

4.

la

V)

"It

NC4

CO

c0

4-

0.

J. CLIN. MICROBIOL.

00

_ e~

004 eq 00-4 00tC Cl

Cen ~~ 00

en 00 N

tl r)

o

C r)e-

Cr)rt

N

00 v 00

ON '-4N

-C7 -

OC r-C) tr

, n en

Kt. m t

N

W) en en;k

N. C. 1 C- 'IC

\C

Q1. "0Q

00

0

e0-cd

0

.4 0

00

0)

.. Z

0

40

0

C

co

co ci

0t

E o

CCts

CO

.0o0)._

r CO C

~C ooC

>8.;nCO: £

0e C.

E

0.m3CO 0L00F o

o

CO.~Q. .

= QQt

imum parsimony method (DNAPARS) with the PHYLIP 3.4programs (Phylogeny Inference Package) (10). To root thetrees, the HPV47 sequence (17) was used as an outgroup.Bootstrapping was used to estimate the confidence limits oftree groupings (10), which were significant at the 95% level.CAT assays. Fragments containing the LCR of HPV5al,

HPV5a3, HPV5a4, and HPV5a6 (nt 7427 to 454) (45) or theE2 gene of HPV5al, HPV5a3, HPV5a5, and HPV5a6 (nt2716 to 4283) were amplified by the PCR technique (33). TheLCR PCR products were inserted in a chloramphenicolacetyltransferase (CAT) reporter plasmid (pTKM vector) 5'to the enhancerless promoter of the herpes simplex virusthymidine kinase gene (39). The E2 PCR products wereinserted in the pRSV vector downstream of the Rous sar-coma virus long terminal repeat (12). The nucleotide se-quences of the cloned LCR and E2 genes were verified.Constructs were transfected in human SW13 cells (20) aspreviously described (39), with the pRSVcat vector (12) andthe pTKM vector as positive and negative controls, respec-tively. Transfection was performed by a calcium phosphateDNA precipitation technique (4). Two days after transfection,CAT assays were performed as described previously (32).

Nucleotide sequence accession numbers. The nucleotidesequence data reported here have been deposited in EMBLdata bases under accession numbers X7 4618 (HPV5a2,LCR-E6-E7), X7 4619 (HPV5a4, LCR-E6-E7), X7 4620(HPV5a3, LCR-E6-E7), X7 4621 (HPV5a5, LCR-E6-E7), X74622 (HPV5a6, LCR-E6-E7), X7 4641 (HPV5a7, LCR-E6),X7 4642 (HPV5a8, LCR-E6), X7 4643 (HPV5a9, LCR-E6),X7 4644 (HPV5a2, 5' E2), X7 4645 (HPV5a2, 3' E2), X7 4646(HPV5a3, 5' E2), X7 4647 (HPV5a3, 3' E2), X7 4648 (HPV5a4, 5' E2), X7 4649 (HPV5a4, 3' E2), X7 4650 (HPV5a5, 5'E2), X7 4651 (HPV5a5, 3' E2), X7 4652 (HPV5a6, 5' E2),and X7 4653 (HPV5a6, 3' E2).

RESULTS

Sequence variation in different genomic regions of knownHPV5 variants. We previously cloned seven HPV5 isolatesfrom benign and malignant lesions of four EV patients (pa-tients 1, 3, 4, and 6) and showed that they corresponded tofive variants (HPV5a2 to HPV5a6) on the basis of theirrestriction maps (7, 19) and the nucleotide sequence of the E6gene for HPV5a3 to HPV5a6 (7) (Table 1). We have nowdetermined the nucleotide sequence of the HPV5a2 E6 gene,which shows six nucleotide changes in comparison with themost closely related E6 gene sequence, that of HPV5a5 (Fig.1). Our aim was to determine to which extent this geneticheterogeneity affected other genomic regions of the HPV5variants. We determined the nucleotide sequences of theLCR, of the E7 gene, which likely encodes an oncoprotein(24, 25), and of the 5'- and 3'-terminal 300 nt of the E2 gene,which encodes a transregulating protein (13). As a control, wesequenced the same regions of prototypical HPV5al, pro-vided by R. Ostrow (29, 45), and found differences at fivenucleotide positions in comparison with published data (45)(Fig. 2). We shall refer thereafter to this sequence as thecorrected sequence. We compared the nucleotide and de-duced amino acid sequences of our isolates with the se-quences of HPV5al and HPVSb (44). The nucleotide substi-tution rates ranged from 3.6% for the E7 ORF to 11% for theE6 ORF (Table 2). Altogether, including the E6 ORF, 140(7.6%) nt of the 1,854 nt sequenced were found variable in theHPV5 sequence (Table 2), with a maximal divergence of 3%between variants.A comparison of the LCRs of the seven HPV5 variants

on October 8, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

VOL. 31, 1993 PHYLOGENY OF HPV5 VARIANTS 2921

773? 1Sal ?AAAGACCGTTAACGGTAAGTTGCAATTTCCTT0TACCAG4 TGCGGTATTOGGATTTCACAATTATAA TOGTTGTTGCCAACTACCATAGGCATATTCAAGTTTTTGCCTGTATC

a7 ...-...A.--- - - - -AA.-------. T-.0a8 -- c -- - - - - ---------------- - - - - - -------- - - Ga-------------------------------------- ------------

b - -G--G-----------s----A---- G -[= =ss ----------******--- ------ TG ----- G -----------------------s-----C---- e---------------a4 - *-G ----------------- A--- G.........................AA ----- T̂aG..........-- --- G--------------- C v-- -- -- ----

a6 - -G-G--------- -------A--T----T------------*------c --------------a-G ----- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -

105 E6Sal GTTTTCGTATCCTGd'.;-' .B: ^ ,T-:'"-W-,*,-.:--- A.Ti*,,:,,T,#.T.*.T"'i'''''"F:.GGTTCGATAGCEEGTAGACGA

a8...C.A.0....b-.-G.A~~~...............%.-........... TO .0.C.

a2 -------------- T---C-------- -------- T--T------- -------------- -------- G--------------------------- -- ---------------

aS - -- -- -- -- -- --- T---C-----------------T--------w------------------------ G-*- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- ----

a7 - -- -- -- -- - - --- T- --C-----------------T----------------------- -------- a- ..-.-.-.-.--.-- -- -- -..- -- -- -- -- -- -- -- -- -- -- -- ----

as - -- -- -- -- -- - -- T---C------T-------*---T----*----------------------------G-- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- ---- -

b *- -- *-- -- ----- T. ---C----------aG - ----- T -------------------------.-----------------A----------------------- ----------

a4 ---A----------T --C-----------------T------------------------A--C---------------A----------------------.-----------a3 -----------GA----0 -T----------------------------..--TOA,,,,,,,,-.0...---------------..........a9 ----- A- -------------T0-------------------------------------..-TAO.0.C.............................

a6 -------------- T-- C----A------------TT.C .0.--------------. ---- ------ GC--A------T--------- ---------- A-------

219Sal ACCAACAGAAACTGACAG^AvAAAAGTAAGGCAGAATTACCTTTAAGTATTAGAGACTTAGCTGAAGCCTTAGGCATCCCTGTGATTGATTGTTTAATACCTTGCAATTTCTGTGGa2 - -- --- CA-----------************-*--.-*-.*-.-*--.-.- T----C.------------G-- -------A----*----------C------------------------ ----------

aS - -- - -- cA ----------------------------------C------.------G----^----- aT*------------C----- ----------------------------

a7 .-..-----CA --------------.---....- -----------..........--c-C-- -- ...-------G---------A-T------------C------- ---------------------------

a8 - -- - -- CA -- -T--------------- -- ---- --------C------------ aG-- -- -- - -- A-TT------------C ---------------- ------------ -----

a4 - .--- ----- -- -- -- -- -- -- - C-c-C -c-- -- -- ----- -G------A -------------- C-T --------- A ----- ---------T- T---

a3 - .--- - --c--c-- - - - - .------------- --C- C -A----------- ---C-T-- A --------- - -C T. .A -------------- -T-----

a9 -.------ -- --- --- -- --- -- -- .- -c-c-.-.--. ---- G- - - -A-------------- C-T --------- A- ----- ------ --- T-----

a6 ---------------------------..........------..--c- .c-C ------A--G----- ----------------------T--------------------------T-----

334 t t i- It ItSal CIAACTTTCTAAATTATTTGGAAGCTTGTGAATTCGACTACAAAAGGCTTAGTCTAATTTGGAAAGATTATTGTGTGTTTGCGTGCTGTCGCGTATGCTGTGGCGCCACTGCAACTa2 - --A------------------- C---------C ----- AA------------A----------------------------- -------------------- ----- -----

aS ***.A-----------------------C -------- ------- AA -------------------------- ------------------------------ ------- ---

as - --A------ -- --**-**- -- -*--- ---c-C - -- -- -- -- -- -----AA ------------------------------------******-*----c-CT------------------------ --- -

b T--A---T-------- --------------.--------- AA-----C-------.------.-------------------T------------------------------Aa4 T--A--- T-- ----.---.------C------------------- AA -----C--.------------------------------T-----------------------------Aa3 T--A---T------------ ----C-- ------T------ ---- AA-----C----- ---------------------------T------------- ----------------

a9 T. -A---T----------------C--------T----------AA-----C----------------- ---------------T---------------- -------------

a6 T---- -T---- ------------- --------T ---------- -A-----C----------G-GA------- --- A --A-A-T- - ---- ----- --- ----T-----------A

449Sal TATGAATTTAACCAATTTTATGAGCAGACAGTGTTAGGAAGAGATATTGAATTAGCTTCAGGACTTTCAATATTTGATATTGATATCAGGTGTCAAACTTGCTTAGCATTTCTTGa2 ---- -- -- -- -- -- -- ---*****- -- -- ------ T----- -C--e--------G----- ------------G-TT------- -----------------------------------

aS - -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- --cC - -- -- -----G--- -----------G--G--T--------------------------------------------a7 - .- - - - - - C --- -c- -- --- G - --G----- ------G--G--T -------------------------------- -----------

as --------------- ------------------------C--- -------G---------------- G--T------------------------------- ------ --- -

b --C--------T------ --------------------------------G-------------- C- G--T----------------------------------- --------

a4 --C--------T------------- -------------------------G--------------C--G- T -------------------------------------------

a3 --C-------- T-- ---..------.-------------------------G---.-----.-.--.-C--G--T------------------- ------------------------

a9 --C--------T--------------------------------------G------------ --C--G--T-------------------------------------------

a6 --C --****----- T-----..---.----G------- ---.-------------G---- -------T.-C--T.-T--------------------------G----------------

564 t ltSal ACATTATAGAAAAGTTAGATTGCTTTGGCAGAGGCCTTCCCTTTCATAAGGTGAGGAACGCCTGGAAGGGAATCTGTAGGCAGTGTAAGCATTTTTATCATGATTGG

aS . . T- --C----...-------------- -TA.-----------------------------------------------------------------.--T.0.a7 ----- -.-. -..- - --- --- - - - - -.T.A .-.- . - - - - - - - - - - - - - -...........

a8 -T--------------------C . T.. TA.-----------..------------------------------------------------------------

a4..T-. c........A.--------- -

a6 -.-G--------------C T -A-----.-----------C------------------------- --- T--------------------A-----------

FIG. 1. Comparison of the nucleotide sequences of the 3' part of the LCR and the E6 ORF of 10 HPV5 variants. The nucleotide sequenceof HPVSal (45) is given from nt 7736 to 673. Only substitutions observed in the variants are indicated. The initiation codon and the stop codonof the E6 gene are boxed. The E2-responsive elements and the M29 motif are indicated by thin lines and a thick line, respectively. TheA/T-rich region, which contains TATA boxes, is shaded. The direct duplication of nt 18 to 24, present in the published sequence of HPVSb(44) (hatched box), was not found in our HPVSb isolate. Nucleotide changes leading to amino acid changes in the E6 amino acid sequencededuced from the nucleotide sequence are shown by arrowheads. The three pairs of overlined arrowheads correspond to a single codon.

on October 8, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

2922 DEAU ET AL.

5a1

A T

A

A

AAT

Tr

AT140 - >C

A

C

A ~--

G4058->TT4 0 507.->C\A4056->CA4055->1

5a;GTA

_m _I

_W XeE;S

A

T

FIG. 2. Genetic heterogeneity of HPV5. Conrected HPV5al and HPV5a3 nucleotide sequences

sequences of HPV5al and HPVSa3 in the LCR (A)of E2 (B) were determined as described in MateriaHPV5al nucleotides differing from the publishedsame clone (45) are shown on the left. The nucleotia letter and a three- or four-digit number corresporsequence of Zachow et al. (45). The homologousotides are given on the right as an example of se

among HPV5 variants. The additional T between p119 (asterisk) and the changes from T to C at positi(C to T at position 140 (plus), common to HPV5a2HPV5b, are indicated.

disclosed 41 variable nucleotide positions ofand 3), with a maximal divergence of 5.2% betA T insertion at position 119 was found incomparison with prototypical HPVSa1 (Fig.more, the HPVSb LCR shows a short direct18 to 24) (44). The genetic heterogeneity is mi

the 3' part of the LCR, between nt 7736 aisubstitution rate of 11.9%, close to that (11%)E6 gene (Fig. 1). The modifications affect ne

tive regulatory elements, such as AP1 and Pbinding sites, E2-responsive elements, anTATA boxes (8), nor the two motifs, ofconserved among the LCRs of HPV5-relatedThe HPVS E7 gene is 309 nt long and enco'

103 amino acids. Eleven nucleotide positioivariable in the HPVS E7 ORF, resulting in fsubstitutions in the predicted amino acid sequthree nonconservative changes (Asn-45--Ileand Asn-60--.His) (31) (Tables 2 and 3). Pai:sons revealed none (5a3 versus 5a4) to sev5a6) nucleotide changes and none (Sal versus

5a4 versus Sb) to four (SaS versus 5a6) amin(The Cys-X-X-Cys motifs, postulated to media(1), the Leu-X-Cys-X-Glu consensus bindiplOSRb protein (24), and the amino acids coi

all the papillomavirus E7 proteins (6) were foThe E2 ORF encodes a multidomain prote

amino-terminal transactivation domain, a proline-rich "hinge"region, and a carboxy-terminal domain required for sequence-

T specific DNA binding and dimer formation (13). In the 5' end,WW T of E2, 14 of 300 nt positions were found variable (Table 2),

TG and 4 of them resulted in amino acid changes. In the 3' end_ T* of E2, 22 of 300 nt positions were found variable, leading to

A six amino acid changes (Table 2). Only the Asp-13--3Glu andc+ Thr-487-*Ser substitutions correspond to conservative-WA ..changes (31).\T . .....Search for new HPV5 variants. To further define the

genetic heterogeneity of HPV5 and/or to evaluate the stabil-ity of the known variants, we sequenced the most variablegenomic region, encompassing the 3' part of the LCR and

tT.... the E6 ORF (nt 7736 to 673), of HPV5 isolates obtained fromA six additional EV patients of different geographical originsA (patients 2, 5, 7, 8, 9, and 10) (Table 1). A comparison of theC nucleotide sequences (Fig. 1) showed that three isolatesA......corresponded to new variants, referred to as 5a7, 5a8, and

5a9 (Table 1). In contrast, the other three isolates corre-/T c sponded to variants already described, 5a2 (patient 2), 5a4C (patient 5), and Sb (patient 10) (Table 1 and Fig. 2), demon-A strating further the stability of the HPV5 variants. It shouldA. be stressed that the short direct duplication reported for theAA .....HPVSb LCR (44) was not found in our HPV5b isolate (Fig.T 1). As for the three new variants, five additional variable

nparison of cor- positions (three in the 3' part of the LCR and two in the E6. The nucleotide ORF) were found in the 684-nt variable fragment. On theand in the 3' end whole, when the 10 variants were compared, 28 (13.3%) andils and Methods. 54 (11.4%) variable positions were identified in the 3' part ofsequence of the the LCR (211 nt, including the T insertion found in allides indicated by variants but 5al) and in the E6 gene (473 nt), respectively,nd to the original with a maximal divergence of 8.8% between variants (5a6quencevariation versus 5a7 or 5a8). A comparison of the amino acid se-) ositions118 and quences of the E6 proteins, deduced from the nucleotideon 121 (plus) and sequences, revealed 20 amino acid substitutions located atto HPV5a6 and 19 (12.1%) positions of 157. Eleven changes were noncon-

servative: Gly-4-+Glu, Gln-9--Pro, Leu-19--Phe, Leu-21--Ser, Asp-25-+Gly, Asn-46--Lys, Asp-67--+Gly, Cys-73--Arg, Gln-92--+Arg, Leu-134--Tyr, and His-1SS-*Asn

1 482 (Tables 2 (31). Pairwise comparisons of the E6 amino acid sequences,tween variants. deduced from the nucleotide sequences, showed that theall variants, in putative E6 proteins differed by 1 (Sa5 versus 5a8) to 16 (5a62A). Further- versus 5a8) amino acids. Identical E6 amino acid sequencesduplication (nt were found for the 5a3, 5a4, 5a9, and Sb variants and for theainly located in SaS and 5a7 variants. These results thus allowed us tond 199, with a distinguish six alleles of the HPVS E6 gene.of the adjacent Stability of HPV5 variants in individual patients. To further-ither the puta- analyze the stability of the variants, we compared HPV5!XF1 consensus isolates obtained from benign and malignant lesions of fourId CAAT and patients, each infected with a different variant, 5a2, 5a3, 5a4, or33 and 29 nt, 5a7 (Table 1). Samples were taken at the same time (5a4) or[types (30). after 2 years (5a7), 3 years (5a3), and 12 years (5a2). Ades a protein of comparison of the LCR, E6, E7, and E2 sequences (1,854 nt) ofns were found two 5a3 and 5a4 isolates and of the sequences of the 3' part ofour amino acid the LCR and the E6 ORF (684 nt) of two 5a2 and 5a7 isolatesence, including showed no differences between isolates of the same variant.Ser-49--Phe, Phylogenetic analysis of HPV5 variants. A phylogenetic

rwise compari- tree was generated from the alignment of the nucleotideen (5a5 versus sequences of the 3' part of the LCR and the E6 ORF of the5a2 and 5a3 or 10 HPV5 variants by use of a distance matrix approachvacid changes. (UPGMA). The variants were clustered into three groups:ite zinc binding Sal, 5a2, 5a5, 5a7, and 5a8; 5a3, 5a4, 5a9, and Sb; and 5a6ing site of the (Fig. 3A). The same grouping was obtained by use ofnserved among maximum parsimony analysis. For seven variants (5al, 5a2,und invariable. 5a3, 5a4, 5aS, 5a6, and 5b), a similar grouping was obtained-in with a large from the alignment of the LCR, the E6, the E7, or the E2

J. CLIN. MICROBIOL.

on October 8, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

PHYLOGENY OF HPV5 VARIANTS 2923

TABLE 3. Nucleotide and amino acid substitutions among HPV5 variantsaSubstitution in: Amino acidRegion Nucleotide

al a2 a5 a3 a4 b a6 change

LCR 7470 T

E7

5' E2

7492752775527587760576137640765876607669767076807695772177257739111416171938404147485483118*12212713314016917317617718018418774577079680480883984090991793593827612800283028842929293529382951297129742980298429873018

TTCAAAGAAGGGTGTATATTCTGGCAAT

TTACGAATGCCTGAGCGACACTTGATTACCGATGCT

C

T

AA

G

Tc

T

G

c

G

T

- C C C -

_ ~~~G_ A

G G G_ ~~~G

G G G_ ~~~~A

GG

AA

T T T T

-_ - A-

G G G G- A A A A_ ~~~~~~~~T

G G G

- - A--A -_

- T T T -- G G G -- G G. G G- - C C-

T T T T TC C C C C

T T T T T

G _

A - -A_ AA

- T T T T

- C C C C- T T T -

- T T T -

A

G

G-C

-C

AG G G

~~C~~CGT

_- T-_- A

C C C

- A-88--SG H-89-)D

C C C I-99- T

Continued on following page

F-28-*Y

N-45--)

S-49--F

N-60--+H

VOL. 31, 1993

nl-1 s,I

on October 8, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

2924 DEAU ET AL.

TABLE 3-Continued

Substitution in: Amino acidRegion Nucleotide changeal a2 a5 a3 a4 b a6 change

3' E2c 3979 A T -3980 C A4024 C - A4048 A - T4051 G A A A A -4056 G - A C-445-*Y4080 A C K-453-*T4086 T A C C C - M-455-(Kor T4108 T C4111 T - A4146 G T - R-473--*L4183 C A A -4188 C - - G G T-487->S4192 A G G4195 G - A A A4213 G - A A A4216 G A A C4225 C T - A4228 A G4241 G - C A-505->R4242 C G4255 G T

a Sequence data for HPV5al were from Zachow et al. (45) and corrected in this study; those for HPV5b were from Yabe et al. (44).-, identity.b The additional T present in all sequences except in HPV5al is designated 118* to avoid changing the numbering of the prototypical HPV5al sequence (45).c nt 4055 to 4058 in E2 were found to be different in the HPV5al sequence determined in this work and in the published sequence of the same clone (45). Asn-445

(AAT) predicted from the published sequence is changed to a Cys (TGC).

nucleotide sequences (data not shown) or from that of thewhole 1,854 nt sequenced (Fig. 3B). The 10 HPV5 variantswere isolated from 12 patients born and living in different areas(Europe, North Africa, South America, and Asia) (7, 18, 19,21, 23, 28, 29, 44). Strikingly, the phylogenetic grouping did notdisclose any geographical dependence (Fig. 3A).LCR enhancer and E2 transactivating activities of HPV5

variants. The LCR of papillomaviruses contains promotersand tissue-specific or inducible enhancers regulating the tran-scription of the viral genes (30). The viral E2 gene product isa major transactivating protein (39). Our aim was to checkwhether the genomic variability observed in the LCR and E2region could lead to variable levels of expression of the earlygenes. To address this question, the LCR of the 5al, 5a3, 5a4,or 5a6 variant was inserted into the pTKM reporter plasmid(40), 5' to the CAT gene, and the E2 gene of the Sal, 5a3, orSaS variant was cloned in the pRSV expression vector.Attempts to clone the 5a6 E2 gene were unsuccessful. In vitrotransfection assays were performed with SW13 cells, derivedfrom a human adrenocortical carcinoma (20), previouslyshown to be a reliable tool for analyzing papillomavirusenhancer activities (40). The constitutive enhancer activity ofthe LCR of HPV5 is low (1 to 3% CAT conversion), regard-less of the variant. Cotransfection of HPV5 E2 expressionvectors yielded only 3- to 6-fold transactivation, comparedwith 21- to 48-fold transactivation by the bovine papillomavi-rus type 1 (BPV1) E2 protein, used as a positive control(Table 4). No obvious differences were observed for differentcombinations of HPV5 LCR and E2 plasmids (Table 4).

DISCUSSION

Variants of oncogenic HPV5 have been recognized on thebasis of the genetic heterogeneity of the E6 ORF (7, 44, 45).We demonstrated in this study that the genetic heterogeneity

A

B

5al/al5a2/a25a5/a35a7 / a45a8/a5

5b/bl5a4/b2Sa3/b35a9/bb4

(Japan)(Poland, Netherlands)(France)(Poland)(Poland)

(Japan, Poland)(Colombia,Colombia)(Algeria)(Algeria)

5a6/cl (France)

S5al/al Asia,5a2/a2 a Europe5aS/a3

5b/bl Asia, Europe,5a3/b3 b North Africa,5a4/b2 South America

Sa6/cl c Europe

92 94 96 98 100Identity ('i)

FIG. 3. Phylogenetic tree of HPV5 variants. (A) The phyloge-netic tree was generated from the alignment of the nucleotidesequences of the 3' part of the LCR and the E6 ORF of 10 variantsby use of the UPGMA distance matrix method (14). A proposedclassification (italic characters) and the geographical origin of iso-lates are indicated. The HPV47 nucleotide sequence (17) was usedas an outgroup (data not shown). (B) The phylogenetic tree wasobtained from the alignment of the 1,854 nt corresponding to thesequences of the LCR, the E6 ORF, the E7 ORF, and the 5' and 3'parts of the E2 ORF of 7 of the 10 HPV5 variants.

J. CLIN. MICROBIOL.

on October 8, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

PHYLOGENY OF HPV5 VARIANTS 2925

TABLE 4. Transactivation of HPV5 LCR CAT plasmids byHPV5 variant E2 proteins

LCR CAT Transactivation by the following E2 protein":plasmid HPV5al HPV5a3 HPV5a5 BPV1

Sal 6.5 4.3 3.5 385a3 4.5 3.0 2.5 485a4 5.2 5.6 5.8 245a6 2.3 4.3 3.1 21

a Transactivation corresponds to the ratio of the CAT conversion observedin the presence of a given E2 protein to that (1 to 3%) observed in the absenceof an E2 protein (pBluescript control). The BPV1 E2 expression vector (40)was used as a positive control. The values correspond to the mean of twoduplicate transfection experiments. Cotransfections were done as described inMaterials and Methods.

found in the E6 gene also affects other regions of the genomeby comparing the nucleotide sequences of the LCR and theE7 and E2 genes of five previously characterized HPV5variants (HPV5a2 to HPV5a6) and of prototypical HPV5al(45) and HPV5b (44). On the whole, 7.6% of the 1,854 ntsequenced were found variable when the seven HPVS vari-ants were compared. The frequency of nucleotide substitu-tions varied from 3.6% (E7) to 11% (E6). The apparentgenetic stability of the HPV5 E7 gene as compared with theE6 gene is intriguing and could reflect some specific func-tional constraints. To analyze further the genetic heteroge-neity of HPVS, we sequenced the most variable region,encompassing the 3' part of the LCR and the E6 gene, forisolates obtained from six additional EV patients. We iden-tified three new variants, together with the three alreadyknown 5a2, 5a4 and 5b variants. The same variants werefound in two sisters (5a4), in two patients from Europeancountries (5a2), and in two patients from Europe and Japan(Sb) (Table 1), emphasizing that variants constitute stableentities. This result was further demonstrated by the identityof the sequenced genomic regions of isolates obtained atvarious intervals of time (up to 12 years) from either benignor malignant lesions of four patients infected with differentvariants. Point mutations in the viral genome are thusunlikely to be involved in tumor progression.

Phylogenetic trees constructed from alignments of thenucleotide sequences of the 3' part of the LCR and the E6gene, available for 10 variants, or of the LCR, the E6 and E7ORFs, and the 5' and 3' parts of the E2 ORF, available for 7variants, clustered HPVS variants into three groups (Fig. 3).This result allows discussion of the nomenclature of HPVsand provides some clues as to the mechanisms of evolutionof HPVS. According to a recent definition of HPV geno-types, two types share less than 90% identical nucleotides intheir Li, E6, and E7 nucleotide sequences (iSa). However,the distinction between subtypes and variants remains to bedefined, and phylogenetic trees could provide a basis forsuch a classification (42). The three HPVS phylogeneticgroups differ by 3.2 to 4.7% of nucleotides in their LCR, E6,E7, and E2 sequences (1,854 nt) and could correspond tosubtypes designated a, b, and c (Fig. 3B). Isolates withineach of the phylogenetic groups show less than 2% nucle-otide divergence and could constitute variants (Fig. 3B).Interestingly, the four HPVSb variants encode the same E6protein (Fig. 1), and at least three of them encode the sameE7 protein (Table 3). Similarly, two variants of subtype a(5a3 and 5a4) encode the same E6 protein, and two others(Sal and 5a2) encode the same E7 protein.A phylogenetic study of HPV16 identified Eurasian and

African lineages (3). In contrast, the phylogenetic analysis ofHPVS isolates originating from different areas did not revealany clear relationship between the grouping and the geo-graphical origin (Fig. 3). Variants belonging to differentgroups (SaS and 5bl) were found in two sisters (Table 1), andtwo highly divergent variants (Sa5 and 5a6) were isolatedfrom the same patient (7) (Table 1). Variants belonging togroup b were found on four continents.

It must be stressed that, while HPV16-associated diseaseis prevalent in the general population (36), only patients witha rare genetic predisposition are susceptible to lifelong EVdisease and produce high levels of HPV5 virions (27). HPV5has been found only seldomly in immunosuppressed trans-plant recipients (2, 22, 26, 41), and the existence of latent andsubclinical HPV5 infections in the general population, al-though conceivable, has not been proven yet (16). Thepersistent infection, usually disseminated to the whole body,and the high level of viral replication observed in EV (27)should favor the occurrence of point mutations. However, itis likely that the cellular "EV gene(s)" somehow exerts sucha strong selection pressure on the emergence of new infec-tious HPV5 variants that the same variants arise indepen-dently of the geographical origin of the patients.As for the functional significance of the genetic heteroge-

neity of HPVS, it does not affect the enhancer activity of theLCR or the transactivating properties of the E2 protein, asanalyzed in a transient expression system. In contrast to theHPV18 LCR (40), the HPV5 LCR showed no constitutiveenhancer activity in SW13 cells. It is likely that such anactivity might require keratinocytes from EV patients (30).

In conclusion, the comparison of 17 HPVS isolates from 12EV patients demonstrates both the genetic heterogeneity ofthis HPV type and the stability of HPVS variants. Whetherthis genetic variability affects the oncogenic potential ofHPVS through distinct biological activities or specific anti-genic properties remains to be elucidated.

ACKNOWLEDGMENTS

We acknowledge the contributions of M.-F. Avril, C. Blanchet-Bardon, M. Lutzner, and P. C. Van Voorst Vader, who providedsome patient specimens. We thank F. Thierry for the gift of SW13cells, the pTKM vector, and the BPV1 E2 expression vector, F.Tekaia for helpful advice in phylogenetic studies, and F. Breitburdfor critical reading of the manuscript.

REFERENCES1. Barbosa, M. S., D. R. Lowy, and J. T. Schiller. 1989. Papillo-

mavirus polypeptides E6 and E7 are zinc-binding proteins. J.Virol. 63:1404-1407.

2. Barr, B. B. B., E. C. Benton, K. McLaren, M. H. Bunney, I. W.Smith, and K. Blessing. 1989. Human papillomavirus infectionand skin cancer in renal allograft recipients. Lancet i:124-129.

3. Chan, S. Y., L. Ho, C. K. Ong, V. Chow, B. Drescher, M. Durst,J. ter Meulen, L. VBia, J. Luande, H. N. Mgaya, and H. U.Bernard. 1992. Molecular variants of human papillomavirus type16 from four continents suggest ancient pandemic spread of thevirus and its coevolution with humankind. J. Virol. 66:2057-2066.

4. Chen, C., and H. Okayama. 1987. High-efficiency transforma-tion of mammalian cells by plasmid DNA. Mol. Cell. Biol.7:2745-2752.

5. Coggin, J. R., and H. zur Hausen. 1979. Workshop on papillo-maviruses and cancer. Cancer Res. 39:545-546.

6. Cole, S. T., and 0. Danos. 1987. Nucleotide sequence andcomparative analysis of the human papillomavirus type 18genome: phylogeny of papillomaviruses and repeated structureof the E6 and E7 gene products. J. Mol. Biol. 193:599-608.

7. Deau, M.-C., M. Favre, and G. Orth. 1991. Genetic heteroge-neity among human papillomaviruses (HPV) associated with

VOL. 31, 1993

on October 8, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

2926 DEAU ET AL.

epidermodysplasia verruciformis: evidence for multiple allelicforms of HPV5 and HPV8 E6 genes. Virology 184:492-503.

8. Ensser, A., and H. Pfister. 1990. Epidermodysplasia verruci-formis associated human papillomaviruses present a subgenusorganization of the regulatory genome region. Nucleic AcidsRes. 18:3919-3922.

9. Eschle, D., M. Durst, J. ter Meulen, J. Luande, H. C. Eberhardt,M. Pawlita, and L. Gissmann. 1992. Geographical dependenceof sequence variation in the E7 gene of human papillomavirustype 16. J. Gen. Virol. 73:1829-1832.

10. Felsenstein, J. 1988. Phylogenies from molecular sequences:inference and reliability. Annu. Rev. Genet. 22:521-565.

11. Fuchs, P. G., T. Iftner, J. Weniger, and H. Pfister. 1986. Epider-modysplasia verruciformis-associated human papillomavirus 8:genomic sequence and comparative analysis. J. Virol. 58:626-634.

12. Gorman, C. M., G. T. Merlino, M. C. Willingham, I. Pastan,and B. H. Howard. 1982. The Rous sarcoma long terminal repeatis a strong promoter when introduced into a variety of eukary-otic cells by DNA-mediated transfection. Proc. Natl. Acad. Sci.USA 79:6777-6781.

13. Ham, J., N. Dostatni, J.-M. Gauthier, and M. Yaniv. 1991. Thepapillomavirus E2 protein: a factor with many talents. TrendsBiochem. Sci. 16:440-444.

14. Higgins, D. G., A. J. Bleasby, and R. Fuchs. 1992. Clustal V:improved software for multiple sequence alignment. CABIOS8:189-191.

15. Icenogle, J. P., P. Sathya, D. L. Miller, R. A. Tucker, and W. E.Rawls. 1991. Nucleotide and amino acid sequence variation inthe Li and E7 open reading frames of human papillomavirustype 6 and type 16. Virology 184:101-107.

15a.International Committee for Nomenclature of Papillomaviruses.Unpublished data.

16. Kawashima, M., M. Favre, S. Obalek, S. Jablonska, and G.Orth. 1990. Premalignant lesions and cancers of the skin in thegeneral population: evaluation of the role of human papilloma-viruses. J. Invest. Dermatol. 95:537-542.

17. Kiyono, T., A. Adachi, and M. Ishibashi. 1990. Genome organi-zation and taxonomic position of human papillomavirus type 47inferred from its DNA sequence. Virology 177:401-405.

18. Kremsdorf, D., M. Favre, S. Jablonska, S. Obalek, L. A. Rueda,M. A. Lutzner, C. Blanchet-Bardon, P. C. Van Voorst Vader,and G. Orth. 1984. Molecular cloning and characterization ofthe genomes of nine newly recognized human papillomavirustypes associated with epidermodysplasia verruciformis. J. Vi-rol. 52:1013-1018.

19. Kremsdorf, D., S. Jablonska, M. Favre, and G. Orth. 1982.Biochemical characterization of two types of human papilloma-viruses associated with epidermodysplasia verruciformis. J.Virol. 43:436-447.

20. Leibovitz, A., W. B. McCombs, D. Johnston, C. E. McCoy, andJ. C. Stinson. 1973. New human cancer cell culture lines: SW13small cell carcinoma of the adrenal cortex. J. Natl. Cancer Inst.51:691-697.

21. Lutzner, M., C. Blanchet-Bardon, and G. Orth. 1984. Clinicalobservations, virologic studies, and treatment trials in patientswith epidermodysplasia verruciformis, a disease induced by spe-cific human papillomaviruses. J. Invest. Dermatol. 83:18s-25s.

22. Lutzner, M. A., G. Orth, V. Dutronquay, M.-F. Ducasse, H.Kreis, and J. Crosnier. 1983. Detection of human papillomavirustype 5 DNA in skin cancers of an immunosuppressed renalallograft recipient. Lancet ii:422-424.

23. Mathieu, A., M. F. Avril, C. Duvilard, C. Blanchet-Bardon, G.Orth, C. Bananger, C. Bognel, P. Charpentier, M. Girinsky, M.Prade, and B. Luboinski. 1985. Epidermodysplasieverruciforme etpapillomavirus: deux observations. Presence d'HPV5 dans unemdtastase ganglionnaire. Ann. Dermatol. Ven6reol. 112:741-742.

24. Munger, K., M. Scheffner, J. M. Huibregtse, and P. M. Howley.1992. Interactions ofHPV E6 and E7 oncoproteins with tumoursuppressor gene products. Cancer Surv. 12:197-217.

25. Nishikawa, T., T. Yamashita, T. Yamada, H. Kobayashi, A.Ohkawara, and K. Fujinaga. 1991. Tumorigenic transformationof primary rat embryonal fibroblasts by human papillomavirustype 8 E7 gene in collaboration with the activated H-ras gene.

Jpn. J. Cancer Res. 82:1340-1343.26. Obalek, S., M. Favre, J. Szymanczyk, J. Misiewicz, S. Jablon-

ska, and G. Orth. 1992. Human papillomavirus (HPV) typesspecific of epidermodysplasia verruciformis detected in wartsinduced by HPV3 or HPV3-related types in immunosuppressedpatients. J. Invest. Dermatol. 98:936-941.

27. Orth, G. 1987. Epidermodysplasia verruciformis, p. 199-243. InP. M. Howley and N. P. Salzman (ed.), The papovaviridae. II.The papillomaviruses. Plenum Publishing Corp., New York.

28. Orth, G., S. Jablonska, M. Jarzabek-Chorzelska, G. Rzesa, S.Obalek, M. Favre, and 0. Croissant. 1979. Characteristics of thelesions and risk of malignant conversion as related to the type ofthe human papillomavirus involved in epidermodysplasia verru-ciformis. Cancer Res. 39:1074-1082.

29. Ostrow, R. S., M. Bender, M. Niimura, T. Seki, M. Kawashima,F. Pass, and A. J. Faras. 1982. Human papillomavirus DNA incutaneous primary and metastasized squamous cell carcinomasfrom patients with epidermodysplasia verruciformis. Proc. Natl.Acad. Sci. USA 79:1634-1638.

30. Reh, H., and H. Pfister. 1990. Human papillomavirus type 8contains cis-active positive and negative transcriptional controlsequences. J. Gen. Virol. 71:2457-2462.

31. Risler, J. L., M. 0. Delorme, H. Delacroix, and A. Henaut. 1988.Amino acid substitutions in structurally related proteins: apattern recognition approach. Determination of a new andefficient scoring matrix. J. Mol. Biol. 204:1019-1029.

32. Rogel-Gaillard, C., F. Breitburd, and G. Orth. 1992. Humanpapillomavirus type 1 E4 proteins differing by their N-terminalends have distinct cellular localizations when transiently ex-pressed in vitro. J. Virol. 66:816-823.

33. Saiki, R. K., S. Scharf, F. Faloona, K. B. Muillis, G. T. Horn,H. A. Erlich, and N. Arnheim. 1985. Enzymatic amplification ofbeta-globin sequences and restriction site analysis for diagnosisof sickle cell anemia. Science 230:1350-1354.

34. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecularcloning: a laboratory manual. Cold Spring Harbor Laboratory,Cold Spring Harbor, N.Y.

35. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequenc-ing with chain-terminating inhibitors. Proc. Natl. Acad. Sci.USA 74:5463-5467.

36. Schiffman, M. H. 1992. Recent progress in defining the epide-miology of human papillomavirus infection and cervical neopla-sia. J. Natl. Cancer Inst. 84:394-398.

37. Sneath, P. H. A., and R. R. Sokal. 1973. Numerical taxonomy.W. H. Freeman & Co., San Francisco.

38. Tawheed, A. R., S. Beaudenon, M. Favre, and G. Orth. 1991.Characterization of human papillomavirus type 66 from an inva-sive carcinoma of uterine cervix. J. Clin. Microbiol. 29:2656-2660.

39. Thierry, F., N. Dostatni, F. Amos, and M. Yaniv. 1990. Coopera-tive activation of transcription by bovine papillomavirus type 1 E2can occur over a large distance. Mol. Cell. Biol. 10:4431-4437.

40. Thierry, F., and M. Yaniv. 1987. The BPV1-E2 trans-actingprotein can be either an activator or a repressor of the HPV18regulatory region. EMBO J. 6:3391-3397.

41. Van der Leest, R J., K. R. Zachow, R. S. Ostrow, M. Bender, F.Pass, and A. J. Faras. 1987. Human papillomavirus heterogeneityin 36 renal transplant recipients. Arch. Dermatol. 122:354-357.

42. van Ranst, M., J. B. Kaplan, and R. D. Burke 1992. Phylogeneticclassification of human papillomaviruses: correlation with clin-ical manifestations. J. Gen. Virol. 73:2653-2660.

43. Wilbur, W. J., and D. J. Lipman. 1983. Rapid similaritysearches of nucleic acid and protein data banks. Proc. Natl.Acad. Sci. USA 80:726-730.

44. Yabe, Y., A. Sakai, T. Hitsumoto, H. Kato, and H. Ogura. 1991.A subtype of human papillomavirus S (HPV-5b) and its subge-nomic segment amplified in a carcinoma: nucleotide sequencesand genomic organizations. Virology 183:793-798.

45. Zachow, K. R., R. S. Ostrow, and A. J. Faras. 1987. Nucleotidesequence and genome organization of human papillomavirustype 5. Virology 158:251-254.

46. zur Hausen, H. 1989. Papillomavirus in anogenital cancer as amodel to understand the role of viruses in human cancers.Cancer Res. 49:4677-4681.

J. CLIN. MICROBIOL.

on October 8, 2020 by guest

http://jcm.asm

.org/D

ownloaded from