genetic studies of tissue-specific mitochondrial dna

Genetic Studies of Tissue-Specific Mitochondrial DNA Segregation in Mammals

RESEARCH PROGRAMS UNIT MOLECULAR NEUROLOGYFACULTY OF MEDICINEDOCTORAL PROGRAMME IN BIOMEDICINEUNIVERSITY OF HELSINKI

RIIKKA JOKINEN

dissertationes scholae doctoralis ad sanitatem investigandam universitatis helsinkiensis 13/2016

13/2016

Helsinki 2016 ISSN 2342-3161 ISBN 978-951-51-1912-4

RIIK

KA

JOK

INE

N G

enetic S

tud

ies of Tissu

e-Sp

ecific M

itochon

drial D

NA

Segregation

in M

amm

als

Recent Publications in this Series

100/2015 Päivi Ylä-AnttilaPhagophore Membrane Connections and RAB24 in Autophagy101/2015 Kaisa KyöstiläIdentification of Novel Mutations and Molecular Pathways for Canine Neurodegeneration and Chondrodysplasia102/2015 Emmi JoensuuEpigenetic Alterations in Sporadic and Familial Cancers103/2015 Elina ReponenPreoperative Risk-Assessment Methods, Short-Term Outcome, and Patient Satisfaction in Elective Cranial Neurosurgery104/2015 Riina KandolinCardiac Sarcoidosis in Giant Cell Myocarditis in Finland106/2015 Karmen KappPolyphenolic and Essential Oil Composition of Mentha and Their Antimicrobial Effect107/2015 Dina PopovaNeurophysiological mechanisms of Plasticity Induced in Adult Brain1/2016 Pauliina SaurusRegulation of Podocyte Apoptosis in Diabetic Kidney Disease – Role of SHIP2, PDK1 and CDK22/2016 Sanna ToivonenDerivation of Hepatocyte Like Cells from Human Pluripotent Stem Cells3/2016 Marjaana PeltolaAMIGO-Kv2.1 Potassium Channel Complex: Identification and Association with Schizophrenia-Related Phenotypes4/2016 Niko-Petteri NykänenCellular Physiology and Cell-to-Cell Propagation of Tau in Neurodegeneration: The Impact of Late-Onset Alzheimer’s Disease Susceptibility Genes5/2016 Liisa KorkaloHidden Hunger in Adolescent Mozambican Girls: Dietary Assessment, Micronutrient Status, and Associations between Dietary Diversity and Selected Biomarkers6/2016 Teija OjalaLactobacillus crispatus and Propionibacterium freudenreichii: A Genomic and Transcriptomic View7/2016 César AraujoProstatic Acid Phosphatase as a Regulator of Endo/Exocytosis and Lysosomal Degradation8/2016 Jens VerbeerenRegulation of the Minor Spliceosome through Alternative Splicing and Nuclear Retention of the U11/U12-65K mRNA9/2016 Xiang Zhao HMGB1 (Amphoterin) and AMIGO1 in Brain Development10/2016 Tarja Pääkkönen (Jokinen)Benign Familial Juvenile Epilepsy in Lagotto Romagnolo Dogs11/2016 Nora HiivalaPatient Safety Incidents, Their Contributing and Mitigating Factors in Dentistry12/2016 Juho HeinonenIntravenous Lipid Emulsion for Treatment of Local Anaesthetic and Tricyclic Antidepressant Toxicity

Research Programs Unit – Molecular Neurology and

Doctoral Programme in Biomedicine Faculty of Medicine

University of Helsinki Finland

GENETIC STUDIES OF TISSUE-SPECIFIC MITOCHONDRIAL DNA SEGREGATION IN

MAMMALS

Riikka Jokinen

ACADEMIC DISSERTATION

To be presented, with the permission of the Faculty of Medicine of the University of Helsinki, for public examination in lecture hall 2,

Biomedicum-Helsinki, on the 26th of February, at 12 noon.

Finland 2016

Supervised by

Docent Brendan J. Battersby, Ph.D. Research Programs Unit – Molecular Neurology, University of Helsinki, Finland.

Reviewed by

Professor Juha Partanen, Ph.D. Department of Biosciences, Division of Genetics University of Helsinki, Finland

and

Assistant Professor Sjoerd Wanrooij, Ph.D. Department of Medical Biochemistry and Biophysics Umeå University, Sweden

Opponent

Professor Robert W. Taylor, Ph.D. Wellcome Trust Centre for Mitochondrial Research, Institute for Ageing and Health Newcastle University, United Kingdom

ISBN 978-951-51-1912-4 (paperback) ISBN 978-951-51-1913-1 (PDF) ISSN 2342-5423 (print) ISSN 2342-5431 (Online)

Dissertationes Scholae Doctoralis Ad Sanitatem Investigandam Universitatis Helsinkiensis Hansaprint, Helsinki 2016

3

ABSTRACT

Mitochondrial DNA (mtDNA) is a polyploid genome that is present in hundreds or thousands of copies per cell. Due to this polyploidy arising mutations cause heteroplasmy: the co-existence of two or more distinct mtDNA variants in the same cell. Because of these features mtDNA variants can segregate mitotically in the tissues of an individual, leading to time-dependent changes in the percentage of the heteroplasmic mtDNA variants. These time-dependent changes are governed either by neutral genetic drift or selection.

Most human pathogenic mtDNA mutations are heteroplasmic and functionally recessive, meaning that a certain percentage, or threshold, of the mutant mtDNA variant must be exceeded prior to onset of clinical symptoms. Somatic mtDNA segregation of inherited and de novo mutations affects whether the threshold is exceeded, and is an important factor for determining disease onset and clinical severity. Some pathogenic mtDNA mutations exhibit tissue-specific mtDNA segregation patterns. The mechanisms involved in tissue-specific mtDNA segregation are poorly understood. The aim of this thesis was to uncover genetic regulators of tissue-specific mtDNA segregation and study their properties to gain insight on the potential mechanisms involved in this complex process.

We investigated tissue-specific mtDNA segregation in a heteroplasmic mouse model that segregates two non-pathogenic mtDNA variants. These mtDNA variants are transmitted neutrally through the female germ line, and display tissue-specific mtDNA segregation in three tissue types: the liver, kidney and hematopoietic tissues. In these tissues there is selection for one mtDNA variant over the other.

We identified Gimap3 as a candidate gene for modifying mtDNA segregation in the hematopoietic tissues, and showed that transgenic overexpression of an alternative variant of this protein modulates mtDNA segregation in the hematopoietic compartment. Thus we successfully cloned the first mammalian gene to modulate the segregation of mtDNA. In a follow-up study we investigated the role of Gimap3 and the functionally related gene Gimap5 in mtDNA segregation in mice. We uncovered a novel subcellular localization to the endoplasmic reticulum for the Gimap3 protein and demonstrated complex gene expression regulation for this gene. Furthermore, we established Gimap5, which encodes a lysosomal protein, as another modifier of mtDNA segregation in hematopoietic tissues. Taken together these results demonstrated the involvement of other organelles in the segregation of mtDNA.

To study tissue-specific mtDNA segregation from another aspect we investigated the potential role of mitochondrial fission in mtDNA segregation. Mitochondrial fission has been implicated in mtDNA

4

segregation in the unicellular model organism yeast. We utilized a dominant-negative mouse model for Dnm1l, a master regulator of mitochondrial fission. This mutation inhibits fission and causes hyperfusion of the mitochondrial network. We demonstrated that expression of the dominant-negative Dnm1l modulated the mtDNA segregation in the hematopoietic tissues of mice, but had no effect on mtDNA segregation in other tissues or during transmission.

In conclusion, we were able establish three genetic modifiers for tissue-specific mtDNA segregation. Our findings represent the first genes identified that can modulate tissue-specific mtDNA segregation in mammals. These findings can be utilized to guide future research aiming to uncover the molecular mechanisms of tissue-specific mtDNA segregation, which can ultimately elucidate the genetics of pathogenic human mtDNA mutations.

5

CONTENTS

Abstract................................................................................................................... 3

Contents .................................................................................................................. 5

List of original publications ................................................................................... 9

Abbreviations ....................................................................................................... 10

1 Introduction ................................................................................................. 12

2 Review of the literature ............................................................................... 13

2.1 Basic mitochondrial biology ............................................................... 13

2.1.1 Mitochondrial origin and structure ......................................... 13

2.1.2 Cellular functions ..................................................................... 14

2.1.3 Mitochondrial dynamics .......................................................... 15

2.2 Mitochondrial DNA and genetics ....................................................... 21

2.2.1 Mitochondrial DNA ................................................................. 21

2.2.2 Transmission of mtDNA ......................................................... 25

2.2.3 MtDNA segregation ................................................................. 27

2.3 Mitochondrial diseases and heteroplasmy in human health ............ 30

2.3.1 Defects in mitochondrial morphology genes ......................... 30

2.3.2 Pathogenic human mtDNA mutations ................................... 31

2.3.3 Heteroplasmy in the general population ................................ 34

2.4 Experimental research on tissue-specific mtDNA segregation ......... 35

2.4.1 Transmission of mtDNA variants and purifying selection .............................................................................................. 36

2.4.2 MtDNA segregation in somatic tissues of the BALB/NZB heteroplasmic mice ......................................................... 37

2.5 Gimaps (GTPases of the immunity associated protein) ..................... 39

3 Aims of the study ......................................................................................... 42

6

4 Materials and methods ................................................................................43

4.1 Ethical statements ...............................................................................43

4.2 Mouse models animal housing ...........................................................43

4.2.1 Animal housing ........................................................................43

4.2.2 BALB/NZB heteroplasmic mice ..............................................43

4.2.3 Cast Gimap3 transgenics ........................................................43

4.2.4 Gimap5 knock-out.................................................................. 44

4.2.5 Python mouse ......................................................................... 44

4.2.6 Mouse crosses ......................................................................... 44

4.2.7 Genotyping .............................................................................. 45

4.3 DNA analyses ...................................................................................... 45

4.3.1 DNA extraction ........................................................................ 45

4.3.2 Heteroplasmy analysis ........................................................... 46

4.3.3 MtDNA quantity ...................................................................... 47

4.4 RNA analyses ...................................................................................... 47

4.4.1 RNA extraction ........................................................................ 47

4.4.2 Northern blotting ................................................................... 48

4.4.3 Reverse transcriptase PCR (RT-PCR) .................................... 48

4.5 Protein analysis .................................................................................. 48

4.5.1 Immunoblotting and histodenz gradients .............................. 48

4.5.2 Isobaric tags for relative and absolute quantification (iTRAQ) analysis ................................................................................ 50

4.5.3 In vitro translation ................................................................. 50

4.6 Blood analysis .................................................................................... 50

4.7 Cell culture and microscopy ............................................................... 51

4.7.1 Generation of murine embryonic fibroblasts (MEFs) ............. 51

4.7.2 Transient transfection and retroviral transduction ................ 51

7

4.7.3 Cell fixation and antibody staining ......................................... 51

4.7.4 Microscopy .............................................................................. 52

4.8 Statistical analysis ............................................................................... 52

5 Results ......................................................................................................... 53

5.1 Gimap3 is a genetic modifier of tissue-specific mtDNA segregation in mice (I) ................................................................................. 53

5.1.1 Genetic mapping of a candidate gene for tissue-specific mtDNA selection ................................................................................. 53

5.1.2 A splicing defect in the Cast/Ei Gimap3 allele ........................ 54

5.1.3 Generation of Cast Gimap3 transgenic mice .......................... 55

5.1.4 Transgenic expression of Cast Gimap3 modifies mtDNA selection in the spleen ........................................................... 56

5.1.5 Gimap3 does not affect mtDNA copy number ........................ 58

5.2 Molecular studies of Gimap3 reveal complex expression regulation and a novel subcellular localization (I and II) ........................... 58

5.2.1 Cast and Balb Gimap3 are differentially expressed in mice (I and II) ..................................................................................... 58

5.2.2 A potential role for an upstream open reading frame in the regulation Gimap3 translation (II) .............................................. 60

5.2.3 The expression level of Gimap3 associates with the mtDNA selection phenotype (II) ........................................................ 63

5.2.4 Gimap3 is a resident endoplasmic reticulum protein (II) ................................................................................................. 63

5.3 Involvement of Gimap5 in tissue-specific mtDNA segregation (II) ............................................................................................................. 65

5.3.1 Heterozygous loss of Gimap5 modulates mtDNA segregation .......................................................................................... 65

5.3.2 The abundance of Gimap3 and factors involved in actin cytoskeleton biology are dependent on Gimap5 ....................... 66

5.4 A role for mitochondrial fission in tissue-specific mtDNA segregation (III) ...........................................................................................68

5.4.1 A defect in fission does not affect transmission heteroplasmy in the female germ line ................................................ 69

8

5.4.2 The effect of defective fission on somatic mtDNA segregation .......................................................................................... 71

6 Discussion .................................................................................................... 75

6.1 The role of Gimap3 and Gimap5 in mtDNA selection in leukocytes (I,II) ............................................................................................ 75

6.2 The effect of mitochondrial morphology on mtDNA selection and the segregating unit (III) ...................................................................... 77

6.3 New insight into the selective mtDNA segregation in mouse hematopoietic tissues (I-III)........................................................................ 78

6.3.1 Possible mechanisms for mtDNA selection ............................ 79

7 Conclusions and future prospects .............................................................. 83

ACKNOWLEDGEMENTS ................................................................................85

References ........................................................................................................ 87

9

LIST OF ORIGINAL PUBLICATIONS

This thesis is based on the following publications: I Jokinen, R., Marttinen P., Sandell H.K., Manninen T.,

Teerenhovi H., Wai T., Teoli D., Loredo-Osti J.C., Shoubridge E.A., and Battersby, B.J. Gimap3 regulates tissue-specific mitochondrial DNA segregation. in PLoS Genetics (2010) 6(10): e1001161.

II Jokinen, R., Lahtinen T., Marttinen P., Myohanen M.,

Ruotsalainen P., Yeung N., Shvetsova A., Kastaniotis A.J., Hiltunen J.K., Ohman T., Nyman T.A., Weiler H., and Battersby B.J. Quantitative changes in Gimap3 and Gimap5 expression modify mitochondrial DNA segregation in mice. Genetics (2015) 200(1): p. 221-35.

III Jokinen, R., Marttinen P., Stewart J.B., Dear N. and Battersby

B.J. Tissue-specific modulation of mitochondrial DNA segregation from a defect in mitochondrial division. Human Molecular Genetics (2016) doi: 10.1093/hmg/ddv508.

The publications are referred to in the text by their roman numerals.

10

ABBREVIATIONS

18S 18S ribosomal RNA 28S 28S ribosomal RNA ADP Adenosine diphosphate AGE Agarose gel electrophoresis ATP Adenosine triphosphate Atg Autophagy related Balb/c Bagg albino, Mus musculus domesticus Bcl-2 B cell lymphoma 2 C57BL/6 C57 black 6, Mus musculus domesticus Cast/Ei Mus musculus castaneus CARS Coherent Anti-Stokes Raman Scattering CB Conserved box CC Coiled coil CDS Coding sequence cPEO Chronic progressive opthalmoplegia CsCl Cesium chloride C-terminus Carboxy-terminus Dnm1l Dynamin1-like EF hand Calcium binding protein domain with a helix-loop-

helix structure ENU N-ethyl-N-nitrosourea ER Endoplasmic reticulum ERMES ER-mitochondrial encounter structure EtBr Ethidium bromide F1 First filial generation F2 Second filial generation FADH2 Flavin adenine dinucleotide GED GTPase effector domain GFP Green fluorescent protein GTP Guanosine triphosphate Gimap GTPase of the immunity associated protein HET Heterozygote INF2 Inverted formin 2 iTRAQ Isobaric tags for relative and absolute quantification KO Knock-out MAM Mitochondria associated membrane MEFs Murine embryonic fibroblasts Mfn Mitofusin MELAS Mitochondrial encephalopathy, lactic acidosis and

stroke-like episodes MERRF Myoclonic epilepsy and ragged red fibers

11

mRNA Messenger RNA mtDNA Mitochondrial DNA N2 Second backcross generation NADH Nicotinamide adenine dinucleotide nDNA Nuclear DNA NK Natural Killer N-terminus Amino-terminus NZB New Zealand black, Mus musculus domesticus Opa1 Optic atrophy 1 OXPHOS Oxidative phosphorylation PAGE Polyacrylamide gel electrophoresis PCR Polymerase chain reaction PGC Primordial germ cell Pink1 PTEN induced putative kinase 1 PolG Polymerase gamma Py Python mutation in Dnm1l qPCR Quantitative PCR QTL Quantitative trait loci RC Respiratory chain RFP Red fluorescent protein RITOLS RNA incorporation throughout the lagging strand ROS Reactive oxygen species RT-PCR Reverse transcriptase PCR SiRNA Small interfering RNA Smdq Segregation of mitochondrial DNA QTL Tfam Transcription factor A, mitochondrial Tg neg Transgene negative Tg pos Transgene positive tRNA Transfer RNA (u)ORF (Upstream) open reading frame WT Wild type YFP Yellow fluorescent protein

Introduction

12

1 Introduction

Mutations in the human mitochondrial DNA (mtDNA) are an important cause of genetic diseases, and since the first causative mutations were reported in 1988 [1, 2] over 300 mtDNA mutations have been reported in the human mitochondrial DNA database (MITOMAP). MtDNA diseases often have severe clinical phenotypes and multi-organ dysfunction, with tissues such as the central nervous system, heart, skeletal muscles and liver most commonly affected. Efforts to identify treatments for mtDNA diseases have been unsuccessful and at present there are no effective therapies for these patients [3]. During this thesis work, advances in assisted reproductive techniques and changes in the legislation in the United Kingdom have cleared the way towards preventing the transmission of mtDNA mutations to children of known carriers. However, these techniques will not help patients already suffering from mtDNA disease and have stimulated ethical debate in the scientific community as well as in society in general regarding the introduction of heritable genetic modifications in humans.

The characteristics of mtDNA are different to the nuclear genome, and it does not follow the well-known rules of inheritance established by Gregor Mendel. MtDNA is a maternally inherited multi-copy genome present in hundreds or thousands of copies per cell. These copies are not always identical, a state referred to as heteroplasmy. In heteroplasmic situations, mitochondrial DNA variants segregate somatically within an individual and this can lead to changes in the heteroplasmy levels. Most pathogenic mtDNA mutations are heteroplasmic, and whether a tissue is medically affected depends on heteroplasmy level of the mutant mtDNA [4]. MtDNA segregation is an important factor that influences in which tissues the mutation load exceeds this critical threshold, and can therefore affect the disease-onset and outcome. Molecular mechanisms and genes involved in this process have remained elusive, which hampers accurate prognosis and genetic counseling for patients with mtDNA mutations. Ultimately, better understanding of the mechanism of mtDNA segregation could provide potential therapeutic targets to reduce mtDNA mutation load.

In this thesis we investigated the genetic basis of mtDNA segregation in mouse models. We successfully established three genes that modify mtDNA segregation in a tissue-specific manner. These genes represent the first and at the time of completion of this thesis the only genes identified to be involved in mtDNA segregation in mammals.

13

2 Review of the literature

2.1 Basic mitochondrial biology

Mitochondria are essential organelles of eukaryotic cells that are best known for their role in energy production. All eukaryotic organisms contain an organelle of mitochondrial origin. In mammals, mitochondria are present in all nucleated cells.

2.1.1 Mitochondrial origin and structure The evolutionary ancestor of the mitochondrion was a free living α-proteobacterium that was engulfed by a predecessor of a eukaryotic cell. This hypothesis, called the endosymbiotic theory, was advanced by Lynn Margulis in the 1970s and is nowadays widely accepted [5]. There is still debate on the type of cell that phagocytosed the α-proteobacterium: a eukaryotic cell (already containing a nucleus) or a prokaryotic archaebacterium. After this initial endosymbiotic event, the α-proteobacterium evolved into a permanent structure of the host cell, nevertheless maintaining some of it ancestral features, such as the double membrane, its own genetic material and specific translation machinery (reviewed in [6]).

Mitochondria consist of a double membrane, of which the inner membrane forms folds called cristae. The number and shape of the cristae is dynamic and correlates with the metabolic status of the mitochondria [7]. The double membrane lines two distinct compartments: the mitochondrial matrix is encompassed by the inner membrane, whereas the space between the inner and outer mitochondrial membranes is referred to as the intermembrane space (Figure 1). These compartments host a variety of specific mitochondrial functions, but are connected by protein complexes spanning both of the membranes (reviewed in [8]).

Review of the literature

14

Figure 1 Mitochondrial ultrastructure in a transmission electron micrograph of a mouse embryonic fibroblast. Imaging by Paula Marttinen.

2.1.2 Cellular functions Mitochondria are involved in a wide variety of important cellular functions, including citric acid cycle, fatty acid oxidation, heme and steroid biosynthesis, regulation of cellular redox balance, synthesis of iron-sulphur clusters, cellular calcium buffering and regulation of programmed cell death, apoptosis. The best-known and key function of mitochondria, however, is the aerobic production of energy for the cell in the form of ATP, an adenosine triphosphate molecule, by oxidative phosphorylation (OXPHOS).

In mitochondria, derivatives from nutrient catabolism are further broken down by enzymatic reactions in the citric acid cycle, which produces the high-energy electron carriers NADH and FADH2 [9]. These carriers then supply the electrons to the process of oxidative phosphorylation. In oxidative phosphorylation electron flow down the mitochondrial respiratory chain (RC) is tightly coupled to the pumping of protons across the inner mitochondrial membrane to the intermembrane space, which creates an electrochemical gradient over the inner membrane. The electrochemical energy of this gradient drives the ATP production [10].

The RC, also known as the electron transport chain, consists of four large multiprotein complexes (complexes I – IV) located in the mitochondrial inner membrane. The electrons from NADH and FADH2 enter the RC at complexes I and II, respectively, and via a stepwise reduction of the complexes are ultimately transferred to molecular oxygen producing water as the end product. Coupled to the electron transfer, protons are pumped from the matrix to the intermembrane space at complexes I, III and IV creating an electrochemical gradient across the inner membrane, referred to as mitochondrial membrane potential. The potential energy from this gradient is then converted to a chemical form by the ATP synthase, also located in the inner membrane, as proton re-entry to the matrix is coupled with the

15

phosphorylation of ADP to ATP. The four RC complexes and the ATP synthase together are often referred to as the OXPHOS complexes I-V.

2.1.3 Mitochondrial dynamics In biology textbooks, mitochondria are often depicted as bean shaped independent organelles, but it has been long recognized that this view is too simplistic. Instead, mitochondria are dynamic organelles that undergo fission and fusion events, are transported via the cytoskeleton and form contacts the endoplasmic reticulum (ER).

The distribution of mitochondria in the cell is determined by the balance of fusion and fission events, and the transport of organelles. These processes are integral for mitochondrial function, and disruptions in mitochondrial dynamics are associated with a variety of human diseases (reviewed in [11]). Mitochondrial morphology is responsive to physiological cues and a range of morphologies from fragmented to hyperfused can be observed under different conditions. Moreover, mitochondrial morphology is cell type specific: for example leukocytes contain round and more separate mitochondria, whereas mitochondria in cultured fibroblasts form connected networks (Figure 2).

Figure 2 Confocal micrographs of mitochondrial morphology in different cell types. In the left panel a monkey COS-7 fibroblast cell transfected with a mitochondrially targeted GFP. In the right panel, a surface rendered 3D reconstruction of a primary mouse leukocyte with antibody staining against the mitochondrial protein CoxI. Note that the two panels are on different scales. Imaging by Paula Marttinen.

2.1.3.1 Mitochondrial fission and fusion Mitochondrial fission is mediated by a nuclear-encoded large dynamin-related GTPase Dnm1l (dynamin 1-like, often referred to as dynamin-related protein 1 or Drp1) that is conserved from yeast to mammals (Figure 3) [12-14]. The yeast homolog of Dnm1-l is called Dnm1. Dnm1/Dnm1l contains


16

four distinct functional domains: the GTPase (G) domain, middle domain, variable B-insert region and a GTPase effector domain (GED).

Dnm1/Dnm1l mediates mitochondrial fission by forming oligomer around mitochondrial tubule via self-assembly stimulated by GTP binding. The self-oligomerization is initiated by dimer formation through middle domain interactions, which nucleates the formation of higher-order oligomer structures. The oligomer assembly stimulates GTP hydrolysis, which in turn drives a conformational change of the oligomer that constricts the mitochondrial tubule (reviewed in [15]). In yeast Dnm1 forms a spiral structure with a diameter of approximately 110 nm in the presence of a non-hydrolysable GTP analog as measured by EM, and a recent study utilizing cryo EM reported similar results [16, 17]. Cryo EM also revealed that upon GTP hydrolysis, the Dnm1 spirals constrict to diameter of approximately 70 nm [16]. The mammalian Dnm1l was originally reported to form ring-like structures with a diameter of 30 – 50 nm [12], but recent structural analysis discovered spiral like structures similar to the yeast Dnm1, suggesting similar mode of action between yeast and mammals [18].

Dnm1l is a cytosolic protein that relocalizes to mitochondria when activated to mediate fission. How the relocalization is mediated is incompletely understood, but involves mitochondrial adaptor proteins and potentially cues from the endoplasmic reticulum (detailed in section 2.1.3.3). In yeast Dnm1 interacts with the mitochondria through the mitochondrial outer membrane protein Fis1 and adaptor proteins Mdv1 and Caf4 [19-22]. Of these only Fis1 has a mammalian homolog, but Fis1 in mammalian cells is not essential for fission [23-26]. However there are three mammalian-specific mitochondrial outer membrane adaptor proteins important for mediating contacts between Dnm1l and mitochondria: Mff, Mid49 and Mid51/Mief. These adaptors may be at least partially functionally redundant (Figure 3) [23, 25, 27, 28].

The activity of Dnm1l is regulated by post-translational modifications. Many different modifications on Dnm1l have been reported in response to various physiological stimuli, such as progression though the cell cycle or nutrient starvation. These modifications can have either activating or inactivating effect on Dnm1l function (for a review on Dnm1l post-translational modifications, see [29]).

Mitochondrial fusion is also mediated by evolutionary conserved dynamin-related GTPases: optic atrophy 1 (Opa1, Mgm1 in yeast) [30, 31] and mitofusins 1 and 2 (Mfn 1 and 2, single homolog Fzo1 in yeast) [32-34] (Figure 3). Mitochondrial fusion occurs in two stages: the fusion of the outer membrane mediated by Mfn1 and 2 and the inner membrane mediated by Opa1. Usually the fusion the two membranes is coordinated, although outer membrane fusion can proceed without accompanying inner membrane fusion in cells lacking both mitofusins [35]. The exact mechanism for fusion is not as well established as it for mitochondrial fission, but fusion GTPases are required on both opposing membranes. A mechanism, where the

17

GTPases on the opposing membranes oligomerize and pull the membranes together has been proposed (for a review of the molecular mechanism of fusion, see [36]).

Figure 3 Schematic representation of key proteins involved in mitochondrial fission (green) and fusion (purple/blue).

Mutations in Opa1, Mfns and Dnm1l cause mitochondrial morphology defects. Genetic ablation or dominant negative mutations of Dnm1l consistently lead to hyperfusion of the mitochondrial network, sometimes accompanied with a perinuclear collapse of the whole network. Similarly, loss of Opa1, Mfn1 or Mfn2 function leads to fragmentation of the mitochondrial network. Opa1, Mfn1 and 2 and Dnm1l are all essential for life – lack of any of these factors in mice is lethal during embryogenesis embryogenesis [34, 37, 38].

2.1.3.2 Mitochondrial transport Mitochondria move in the cell along the microtubules and microfilaments of the cytoskeleton [39, 40]. This process is integral for proper distribution of mitochondria throughout the cytoplasm, and chemical disruption of the cytoskeleton leads to aberrant clustering of mitochondria [41, 42]. In mammals, mitochondria move predominantly along microtubules with the help of ATP dependent motor proteins, dyneins for retrograde and kinesins for anterograde movement (reviewed in [43]). While microtubule based movement is considered to be the major long range transport mechanism, there is evidence for myosin motor-based short-range movement along the actin filaments [44].

How mitochondria are recruited for movement is not well understood, but one mechanism involving the mitochondrial outer membrane protein Miro and cellular calcium concentration has been described in the neurons of the fruit fly, Drosophila melanogaster, and in mammals. In mammals there two homologs of Miro, RHOT1 and 2 [45]. Miro is an atypical Rho GTPase with


18

EF-hand calcium binding motives, which localizes to the outer mitochondrial membrane and is involved in kinesin mediated anterograde movement of mitochondria (Reviewed in [46]). Two models have been put forward to explain the mitochondrial movement mediated by Miro. One model proposes that Miro interacts directly with the kinesin motor to allow for mitochondrial movement. High cellular calcium concentrations disrupt this interaction through the EF-hands, causing the mitochondria to detach from the kinesin motor and therefore from the microtubule [47]. In the other model, mitochondrial movement is allowed by Miro interaction with the kinesin motor only through an adaptor protein. High calcium concentration promotes direct association between Miro and kinesin, which would dissociate the whole complex, including the motor, from the microtubule and halt movement [48]. One adaptor protein, Milton, has been described in D. melanogaster, but there is no mammalian homolog for this adaptor.

Mitochondrial transport in mammals has been especially studied in neurons, due to the complex architecture of these cells and manifestation of defects in mitochondrial dynamics as human neurological diseases. Dynamic movement of mitochondria has, however, been shown to be important for other cell types as well. In T cells, mitochondria are dynamically relocated during chemotaxis and immunological signaling, and these functions are impaired if mitochondrial movement is inhibited [49, 50].

2.1.3.3 The role of the endoplasmic reticulum in mitochondrial dynamics

The endoplasmic reticulum is a large membranous organelle, which has key functions in the synthesis of luminal, secretory and membrane proteins, cellular calcium storage, cellular secretory pathway and lipid biosynthesis. Mitochondria and the endoplasmic reticulum form close and stable interactions, which are functionally relevant: the contact sites between the mitochondria and ER host coordinated lipid biosynthesis and calcium exchange between the two organelles. Calcium transfer between the mitochondria and ER is important for providing sufficient local calcium concentrations for mitochondrial outer membrane proteins, as well as playing a role in the regulation programmed cell death. These functions for contact sites are reviewed in [51].

In yeast a complex tethering the ER and mitochondria, ERMES (ER-mitochondria encounter structure), has been identified [52]. ERMES is composed of four core proteins, which were identified by screening for mutants that can be rescued by artificial tethering of mitochondria and ER. In mammals, no structure corresponding to ERMES has been described. Mfn2 has been proposed to function as a tether between the two organelles in mammalian cells [53], but contradictory data was also recently published [54]. Furthermore, a fraction of ER that is attached to mitochondria can be isolated biochemically and is often referred to as the mitochondria-

19

associated membrane (MAM) [55, 56]. This fraction has been shown to be important for lipid biosynthesis [55], and displays the characteristics of a lipid raft, a specialized membrane domain [57].

In yeast, the ER-mitochondria contacts are important for mitochondrial dynamics. Deletion of core units of the ERMES complex leads to defects in mitochondrial morphology and distribution [58-60]. The yeast homolog of Miro is Gem1, which associates with the ERMES complex [61]. Furthermore, ER-mitochondrial contact sites were shown to mark sites of mitochondrial fission, and both the ERMES complex and Gem1 associate with these structures [62, 63]. Interestingly, it has also been established that dynamic distribution of mitochondria to the newly forming bud during yeast cell division is dependent on the prior localization of ER to the bud, but not vice versa (reviewed in [64]).

Evidence from recent years shows that ER-mitochondrial contacts also play an important role in mitochondrial dynamics in animal cells. Similar as in yeast, the ER has been shown to wrap around the mitochondria in areas where the mitochondria are constricted [62]. Dnm1l and one of its receptors, Mff, consistently localize to these sites to mediate fission. The constriction at the ER-mitochondrial contact sites does not require Dnm1l, indicating that this constriction may be an initiating event in mitochondrial fission. The connections between these organelles appear to be very stable as they are maintained even during organelle movement along the cytoskeleton [65].

Further support for ER involvement in mitochondrial fission was provided by a set of experiments that linked the ER resident protein, inverted formin 2 (INF2) to Dnm1l mediated fission [66]. INF2 functions in actin polymerization and depolymerization, and the expression of a constitutively active mutant of this protein increased the frequency of fission. This effect was suppressed by a dominant-negative mutation in Dnm1l, demonstrating that INF2 functions upstream of Dnm1l. Similarly, the effect of INF2 on fission was dependent on actin polymerization, and a link between actin cytoskeleton integrity and Dnm1l mediated fission had previously been reported [67, 68]. Recently a role for myosin II, a member of the Myosin motor protein family capable of constricting actin filaments, in fission was discovered: myosin II colocalizes with the ER-mitochondrial constriction sites in an actin and INF2 dependent manner [69]. Inhibition of myosin motor proteins [67] has been shown to cause elongated mitochondrial morphology, but this effect was now attributed specifically to myosin II [69]. Based on these results, a theory for the initial steps of mitochondrial fission was proposed [70]: At ER-mitochondrial contacts sites INF2 promotes actin filament formation. Myosin II then localizes to the site, and drives the pre-fission constriction at this site. Mff and Dnm1l are subsequently recruited to the constriction site, and Dnm1l oligomerization mediates the fission event. In this model, the role of ER in determining the sites for mitochondrial fission is crucial, as the instigating factor is the ER-resident INF2.


20

2.1.3.4 Mitochondrial quality control The turnover of mitochondrial components is an incompletely understood process. There is a proteolytic system operating in mitochondria, that degrades misfolded or aberrant proteins in mitochondria, and the proteasome system can act on the proteins in the outer mitochondrial membrane (reviewed in [71] and [72], respectively). Furthermore, a new pathway of mitochondria derived vesicles that deliver cargo for degradation to lysosomes and to peroxisomes was discovered recently: these vesicles exhibit cargo specificity and have been shown to contain proteins and lipids, but not DNA [73, 74]. The molecular basis for the cargo selectivity is not at present clear.

During the last ten years a model for mitochondrial quality control that links mitochondrial turnover as whole organelle via macroautophagy, a cellular process for catabolizing intracellular structures by delivery to lysosomes, with mitochondrial dynamics has been developed (reviewed in [75]). This model proposes that damaged mitochondrial contents are removed by segregating them away from the mitochondrial network through fission, preventing their re-entry to the network by inhibiting fusion and degradation by a selective form of autophagy, termed mitophagy [76].

The experimental basis for this model comes from a series of experiments in cultured mammalian cells and involves the mitochondrial protein Pink1 and the E3 ubiquitin protein ligase Parkin. When cultured cells are treated with chemical uncouplers, the membrane potential dissipates and Pink1 stabilizes on the mitochondrial outer membrane [77, 78]. The stabilized Pink1 then phosphorylates ubiquitin and Parkin, leading to activated Parkin on the mitochondrial outer membrane [79]. Activated Parkin subsequently flags the organelle for mitophagy, and ubiquitinates the Mfns, thus promoting their degradation and inhibiting the mitochondrion from fusing back to the mitochondrial network [80]. (For a detailed review on Pink1/Parkin mediated mechanisms for mitophagy in mammalian cells, see [81]).

It is at present unclear, whether Pink1/Parkin mediated mitochondrial quality control occurs in vivo in animals. Metabolic labeling studies in mice and flies have uncovered turnover times for the OXPHOS complexes that differ by an order of magnitude, which seemingly argues against mitophagy as the predominant form of turnover for mitochondrial contents at steady state level as degradation of the whole organelle should lead to more synchronized protein kinetics [82-84]. Therefore, further research in animal models is required to assess if mitophagy is quantitatively an important form of mitochondrial quality control in animal tissues under mitochondrial stress situations.

21

2.2 Mitochondrial DNA and genetics

2.2.1 Mitochondrial DNA Mitochondria contain their own genome, which is the only genetic material outside of the nucleus in animal cells. The genome size for animal mtDNA is small (typically 15-20 kilobases) and the gene content is highly conserved within the animal kingdom (reviewed in [85]). It is thought that the size of the animal mtDNA has shrunk during evolution as some of the mitochondrial genes have relocated to the nucleus through lateral gene transfer (reviewed in [86]).

The human mtDNA, which is highly conserved with the mouse mtDNA, is a circular 16.6 kilobase molecule that is located in the mitochondrial matrix [87, 88]. The mtDNA does not contain introns and there is only one major non-coding area, the D-loop (the displacement loop), which contains the regulatory sequences for the mtDNA replication of origin as well as the promoters for transcription. MtDNA encodes for 37 genes: 13 polypeptides and the two ribosomal RNAs and 22 transfer RNAs required for their translation (Figure 4). The mitochondrial DNA is double-stranded, and the open reading frames of protein coding genes are distributed unevenly between the strands. 12 protein coding genes are located in the heavy strand as opposed to only one in the light strand. The two strands are labeled heavy and light based on their density difference CsCl gradients due to their differing guanidine content. The 13 polypeptides encoded by the mtDNA are essential subunits of the RC complexes I, III-IV and ATP synthase.

There are over one thousand proteins found in mitochondria [89] and the vast majority are encoded by the nucleus, translated by cytosolic ribosomes and transported into mitochondria. This applies to RC complexes and ATP synthase as well: the majority of subunits are encoded by nuclear genes. Therefore, these complexes contain contributions from both the nuclear and mitochondrial genome. Furthermore, mitochondrial ribosomes are also dependent on both genomes, as the two ribosomal RNA components are encoded by mtDNA while all of the protein components encoded by the nucleus. This places these two mitochondrial processes under unique dual genetic control.

The mtDNA is a polyploid genome, which is present in cells in numbers ranging from 102 to 105. Due to this polyploidy mutations give rise to heteroplasmy: the co-existence of more than one variant within the same cell. Heteroplasmy is of often reported as the percentage of one of the genomes.


22

Figure 4 Mitochondrial DNA and it’s gene products. The mammalian mitochondrial DNA encodes subunits of complexes I and III-V of the OXPHOS system, transfer RNAs and the ribosomal RNAs of the mitochondrial ribosome.

2.2.1.1 Replication and repair of mitochondrial DNA Mitochondrial DNA is replicated by dedicated proteins encoded in the nucleus. The minimal replisome for mitochondrial replication has been reconstituted in vitro, and it contains the DNA polymerase gamma (PolG), Twinkle helicase and the single stranded DNA binding (mtSSB) protein [90]. Mitochondrial DNA replication is considered to be relaxed, which means that it is not strictly tied to the cell cycle in comparison to the nuclear genome [91]. Template selection appears to be random, and some mtDNA molecules may replicate more than once and some not at all during the cell cycle. The mechanism for mitochondrial DNA replication is controversial and three alternative models have been proposed (reviewed in [92]). These models may not be mutually exclusive.

In the traditional model for mammalian mtDNA replication, the strand-displacement or the strand-asynchronous model, replication of mtDNA heavy strand initiates in the D-loop region and displaces the light strand from the duplex. After proceeding approximately two thirds of the length of

23

the mtDNA molecule the replication of the light strand to the opposite direction is initiated. The model was originally based on the partially single-stranded replication intermediates observed by electron microscopy [91, 93], but is also supported by data from atomic force microscopy and 2D gel electrophoresis [94].

This model was challenged after identification of replication intermediates by neutral two dimensional (2D) agarose gel electrophoresis that were considered inconsistent with the strand-displacement model, and led to the proposal two new models of mtDNA replication: the strand-coupled model and RITOLS (ribonucleotide incorporation throughout the lagging strand) replication [95, 96]. In RITOLS replication it is proposed that RNA is incorporated into the lagging strand as the replication for the leading strand proceeds. The RNA is subsequently replaced by DNA by an unknown mechanism [97, 98]. In the strand-coupled model mtDNA replication is proposed to happen via a more traditional mechanism simultaneously on both strands with the generation of Okazaki fragments on the lagging strand [95, 99].

In addition to replication of new molecules, damaged mtDNA can be repaired in mitochondria. The repair mechanisms described for animal mtDNA are base excision repair and mismatch repair, of which base excision repair where the damaged base is recognized, excised and replaced is best characterized (reviewed in [100]). In contrast there appears to be little or no homologous recombination, a mechanism that repairs double-strand DNA breaks, in animal mitochondria. Recombinant mtDNA molecules were not detected in heteroplasmic mice under normal conditions by methods that do not rely on polymerase chain reaction (PCR) amplification [101, 102]. PCR based methods are prone for error caused by the polymerase jumping between two templates, and are therefore not appropriate for demonstrating the presence of recombinant molecules [102].

2.2.1.2 MtDNA copy number and mitochondrial biogenesis Mitochondrial DNA is a high-copy number genome, and mtDNA copy number is often used to estimate cellular mitochondrial content together with enzyme activity assays for mitochondrial enzymes such as citrate synthase and cytochrome c oxidase [103]. Due to the dynamic nature of the mitochondrial network (see section 2.1.3), analysis of mtDNA copy number and/or enzyme activity is often more relevant than determining number of organelles per cell.

Mitochondrial DNA copy number in animal cells is highly variable, ranging from hundreds of copies to hundreds of thousands of copies per cell. For example mtDNA copy number in peripheral blood cells is 150 copies per cell [104], whereas the heart has much higher mtDNA copy number of 8000 per diploid nuclear genome [105]. A striking example of mtDNA copy number variation is seen in the female germ line, where the copy number


24

changes from approximately 200 copies in primordial germ cells to 150 000 copies in mature oocytes [106-108]. MtDNA copy number is tightly regulated within a cell and mechanisms that determine the level of mtDNA copies per cell are not well understood

MtDNA copy number is determined by the balance of mtDNA replication and turnover, and the quantity and activity of factors involved in these two processes. How mitochondrial DNA is turned over is not known, but transgenic studies of proteins involved in mtDNA replication and maintenance showed that overexpression of the catalytic subunit of PolG had no effect on mtDNA copy number in cultured mammalian cells [109]. In contrast, overexpression of both Twinkle and Tfam increase mitochondrial copy number in mice [110, 111]. The mechanism for increasing the copy number is different between the two: Twinkle overexpression increased the number of newly synthesized mtDNA molecules, indicative of a mechanism involving increased replication initiation, whereas Tfam did not lead to similar changes [112]. Instead, Tfam is has role in mtDNA stability based on the mounting amount of evidence that the quantity of mtDNA and TFAM correlate [111, 113-115].

As mtDNA copy number mirrors the organelle amount in the cell the factors that affect mitochondrial biogenesis also play a role in mtDNA copy number control. One of the best described regulators of mitochondrial biogenesis, PGC-1α (peroxisome proliferator-activated receptor-γ coactivator-1α), is important in responding to physiological stimuli, such as endurance exercise [116, 117], cold exposure [118] and hypoxia [119]. It is a transcriptional coactivator that affects the transcription of nuclear respiratory factors 1 and 2 (NRF1 and NRF2) [120]. NRF1 and NRF2 promote the transcription of several mitochondrially targeted factors to induce biogenesis. PGC-1α can in turn be activated by several cellular pathways, including AMPK (AMP-activated protein kinase) and Sirtuin mediated cellular pathways that are involved in cell energy status signaling (reviewed in [121]).

In complex multicellular organisms like mammals, a big demand for mitochondrial biogenesis occurs during embryonic development and post-natal growth. Surprisingly, PGC-1α is not required for this basal mitochondrial biogenesis, as knock-out mice for this factor are viable and fertile [122]. It is not known how the cell detects or establishes elementary mitochondrial content. Recently, a new hypothesis based on studies in cultured mammalian cells was put forward that proposes a role for translation on mitochondrial ribosomes in this signaling [123].

2.2.1.3 Nucleoids Historically, mtDNA was considered to be mostly naked in mammalian cells. However, evidence accumulated over the last decades shows that the mitochondrial DNA associates with proteins and forms discreet structures

25

called nucleoids (reviewed in [124]). The structure and behavior of the nucleoids form the basis for understanding mitochondrial genetics, and is a fundamental subject in mitochondrial biology.

Nucleoids reside in the mitochondrial matrix and associate with the inner membrane [125], although the nature of this association and the identity of a potential membrane anchor are unknown to date. Nucleoids can divide and replication of mtDNA occurs at the nucleoids, but only a subset of nucleoids is replicated [125-127]. The mechanisms governing which nucleoids are involved in mtDNA replication are not known.

The estimates of mtDNA copies per nucleoid vary slightly, but the reported values range within 1 – 10 copies per nucleoid in cultured mammalian cells [127-131]. Recent studies with super resolution microscopy across a variety of cultured human, mouse, primate and marsupial cells revealed that the average size of the nucleoid is 100 nm, and either spherical or ellipsoid in shape [128-130]. However, the size and composition of nucleoids has not been investigated in differentiated tissues in vivo.

The proteins that associate with mtDNA are called nucleoid proteins. The most abundant and well established structural protein of the nucleoids is TFAM (mitochondrial transcription factor A), which colocalizes consistently with mtDNA by confocal and super resolution microscopy [125, 126, 129]. TFAM is a high motility group (HMG) protein that contains two HMG domains that intercalate mtDNA and linker region that interacts with the DNA backbone [132, 133]. TFAM is capable of coating and bending mtDNA by binding unspecific mtDNA sequences in a cooperative manner every 40 nm [134, 135]. Asides from TFAM, a number of proteins has been identified by biochemical methods to associate with the mtDNA, but their structural role is not established (reviewed in [136]).

Two models have been put forward regarding dynamics of the nucleoid structure: the faithful nucleoid model and the dynamic nucleoid model. The faithful nucleoid model postulates that each nucleoid replicates its specific genetic content, and that there is no mixing of genetic material between separate nucleoids [137]. In contrast, the dynamic nucleoid model allows for exchanging of mtDNA molecules between discreet nucleoids [138]. In cultured cells, the nucleoids are indeed dynamic structures that move within and are dispersed throughout the mitochondrial network [125, 127, 129]. If cells devoid of mtDNA, ρ0 cells, are fused with a karyoplast containing mtDNA nucleoids, the nucleoids are able to repopulate a mitochondrial network [126]. However, studies in yeast [139] and cultured human cybrid cells [140] provide evidence that nucleoids mainly do not interchange genetic material with each other, although functional complementation occurs.

2.2.2 Transmission of mtDNA In mammals, mitochondrial DNA is strictly maternally inherited through the oocyte to all of her offspring [141]. Paternal mtDNA is degraded after


26

fertilization, although the mechanism in mammals is currently unknown. In Caenorhabditis elegans, a mechanism involving autophagy has been reported [142]. This strict regulation of maternal mtDNA inheritance can, however, be disrupted by inter-species crosses in mice, proposing the existence species specific factors that recognize the maternal and/or paternal mtDNA contributions [143]. In only one instance has paternal transmission in humans been reported [144], and thus paternal transmission appears to be extremely rare [145].

During embryonic development of mammals the quantity of mtDNA is tightly regulated. In mice, the mature oocyte contains over 150 000 copies of mtDNA, but the number is reduced as mitochondrial replication is halted until embryonic day 7.5 (reviewed in [146]). This leads to reduction of mtDNA copy number in the developing embryo at every cell division. MtDNA quantity in the oocyte is imperative for embryo viability. Experimental evidence from mice shows that an oocyte with abnormally low mtDNA copy number (4000 copies) can still be fertilized, but only embryos with an initial mtDNA copy number of at least 40 000 are capable of successful implantation to the uterine wall [106].

The existence of a mitochondrial genetic bottleneck in the female germ line was proposed more than 20 years ago to explain the behavior of heteroplasmic mtDNA variants during maternal transmission in cows [147, 148]. In these studies rapid shifts in heteroplasmy levels were reported between generations. Shifts in the level of heteroplasmy between generations and maternal relatives are also observed in pedigrees transmitting pathogenic human mtDNA mutations. The mitochondrial genetic bottleneck hypothesis was first experimentally investigated in a heteroplasmic mouse model [149]. This study experimentally demonstrated the existence of a mitochondrial bottleneck in the female germ line, and showed that the shifts in heteroplasmy level predominantly occur prior to the formation of primary oocytes. The shifts were modeled to be explained by random genetic drift in a population of approximately 200 mtDNAs. Analysis of the mtDNA bottleneck in human pedigrees transmitting pathogenic mtDNA mutations by using the same mathematical modeling yielded similar estimates of mtDNA copy number, indicating similar mechanism between mice and humans [149].

While there is consensus of the mitochondrial genetic bottleneck, the precise timing and mechanistic basis remains under some debate. Studies utilizing various single cell based methodologies reported conflicting results on the lowest mtDNA copy number during oogenesis: the lowest copy number was measured in mouse primordial germ cells (PGCs) to be approximately 200 copies [107, 108] or an order of magnitude higher in the range of 103 [150, 151]. One study proposed that the physical reduction in the copy number in PGCs facilitates the genetic bottleneck [108]. Another study proposed a mechanism based on selective mtDNA template replication later in development during folliculogenesis, based on analysis on which stage of

27

oocyte development the variation in the heteroplasmy levels was determined [107].

2.2.3 MtDNA segregation To ensure continued existence of functional mitochondria, mtDNA containing organelles must be transmitted to daughter cells at cell division. It is not known how transmission of mtDNA is mediated in mammalian cells, but it may be dependent on passive mechanims via distribution of organelles throughout the cytosol. There is evidence that the distribution of mitochondria is strictly regulated during the cell cycle. Dnm1l mediated mitochondrial fission is activated during mitosis to give rise to a fragmented network of mitochondria [152, 153], which could facilitate passive transmission.

In the most fundamental form the term mtDNA segregation can refer to the transmission of mtDNA at cell division. However, it is often used to describe the temporal changes in the level of heteroplasmic mtDNA variants in cells and tissues of an individual. In this thesis, the term mtDNA segregation refers to the latter. In heteroplasmic situations mtDNA molecules can segregate mitotically because mtDNA replication is not strictly tied to the cell cycle as each template replicates independent of each other (see the previous section 2.2.2.2) and as described above, there is no known mechanism to ensure equal distribution of mtDNAs to daughter cells at cell division. This in contrast to the nuclear genome, for which strict regulatory mechanisms that ensure that each chromosome is replicated exactly once per cell cycle and one copy segregated to daughter cells at mitosis exist. Mitotic segregation of heteroplasmic mtDNA variants can lead to changes in the relative proportion of the heteroplasmic mtDNA variants (Figure 5). Heteroplasmic mtDNA variants can also segregate in post-mitotic tissues, as relaxed mtDNA replication is not dependent on mitosis and additional intracellular processes, such as mitochondrial turnover can affect the frequency of heteroplasmic mtDNA variants in tissues of an individual.


28

Figure 5 Schematic illustration of mtDNA segregation during mitosis.

The segregation of heteroplasmic mtDNA variants can be modeled by using population genetics as the changes in the frequency of heteroplasmic mtDNA variants is analogous to changes in the allele frequencies within a population. There are two key concepts relevant for mtDNA segregation: genetic drift and selection. Genetic drift describes the changes in allele frequencies due to random sampling. The effect of drift is larger when the frequency of an allele is low, and in small populations. In the case of mtDNA segregation, the heteroplasmy level is equivalent to allele frequency. The question of the population size is somewhat more complicated, as it is at present unknown which is the precise entity that represents the segregating unit in tissues: the mtDNA, nucleoid or the organelle. Population size of the

29

segregating units is dependent on this knowledge. In contrast to the random nature of genetic drift, selection occurs when a certain allele affects the fitness, or in other words the survival and reproductive capacity of an organism. In mitochondrial terms, if a certain haplotype has a fitness advantage or disadvantage, this haplotype will either increase or diminish with time, respectively.

In most cases segregation of heteroplasmic mtDNA variants is considered random and mathematical modeling has shown that it is dependent on mtDNA copy number and turnover rate [154]. Therefore changes in the relative heteroplasmy levels in most tissues are very slow, as mtDNA copy number is high. In contrast, when copy number is low changes in the heteroplasmy level can be detected, as is seen in the female germ line (see section 2.2.2). Similarly, selection against a heteroplasmic mtDNA variant can lead to detectable changes in the heteroplasmy level. Selective mtDNA segregation phenotypes have been described in patients with pathogenic mtDNA mutations and in heteroplasmic mouse models, and are detailed in the following sections 2.3 and 2.4, respectively. Such selective pressures could be exerted at any regulatory level that affects the segregation of the mitochondrial genome. Furthermore, if the heteroplasmic mtDNA variants affect the fitness of the cell differently, selection can happen on the level of the cells with different heteroplasmy levels generated by random drift. In such instance, selective mtDNA segregation would be detected at tissue level, even though the selective mechanism is not involved in the basic processes that determine mtDNA segregation. Potential regulatory processes for the segregation of heteroplasmic mtDNA variants are listed in Figure 6.

Figure 6 Possible regulatory processes of mtDNA segregation.


30

2.3 Mitochondrial diseases and heteroplasmy in human health

Mitochondrial defects underlie a wide variety of diseases, which are collectively classified as mitochondrial diseases. The exact prevalence of mitochondrial disease is not known but has been estimated to be approximately 1:5000 in England and 1:8000 Australia [155-157]. The prevalence of mitochondrial DNA mutations in the general population has been estimated to be as high as 1 in 200, making mtDNA mutations highly relevant for human health [158]. Furthermore, mtDNA mutations have been implicated in ageing. In recent years the prevalence of heteroplasmy has been shown to be much more common than previously thought in the general population, highlighting the importance of understanding the behavior of heteroplasmic mtDNA variants.

As mitochondria depend on both the nuclear and mitochondrial genomes, gene defects in either genome can cause mitochondrial disease. While diseases caused by nuclear gene defects comprise an important group of mitochondrial diseases, the mutations in the mitochondrial DNA are most relevant for this thesis. Therefore, mitochondrial diseases caused by nuclear gene defects are not discussed with the exception of diseases caused by genes involved in mitochondrial morphology.

2.3.1 Defects in mitochondrial morphology genes Mitochondria are dynamic organelles that undergo fusion and fission events (summarized in section 2.1.3.1), and mutations in the genes encoding for factors involved in mitochondrial fusion (OPA1, MFN2) and fission (DNM1L) impair mitochondrial function and cause human diseases. OPA1 mutations are predominantly dominant and cause optic atrophy [159], sometimes associated with other neurological phenotypes (reviewed in [160]). A recent report described the first recessive OPA1 disease mutation that results in infantile onset encephalopathy and cardiomyopathy [161]. Dominant and recessive MFN2 mutations manifest as the neurological syndrome Charcot-Marie-Tooth disease (reviewed in [162]), whereas no causative disease mutations have been reported for MFN1. To date, two patients with a dominant DNM1L mutations have been reported leading to lethal encephalopathy and metabolic crisis in neonatal period [163] or developmental delay and epilepsy within the first year of life [164]. A recent report attributes neurological symptoms following an infection in three children to defects in the activation of DNM1L through post-translational modifications [165]. Moreover, a homozygous truncation of MFF has also been identified by whole-exome sequencing in two children of the same family with developmental delay and other neurological symptoms [166].

31

2.3.2 Pathogenic human mtDNA mutations Mutations in the mtDNA can affect any of the OXPHOS coding subunits or the tRNA and rRNA genes involved in their translation. The mutations can be rearrangements or point mutations, and since the first discoveries in 1988 of a point mutation in the mitochondrial ND4 gene as the cause of Leber’s hereditary optic atrophy [1] and mitochondrial DNA deletions as the cause for myopathy [2], over 300 mtDNA mutations have reported in MITOMAP: a human mitochondrial DNA database (www.mitomap.org), to date.

Most mtDNA mutations are heteroplasmic, and a certain percentage of mutant to wild type mtDNA must be exceeded before the mutation manifests as a clinical disease. This percentage, or threshold, is mutation specific. Usually the threshold is approximately 60% for mtDNA deletions and 85% for point mutations [167-169], but much lower threshold values have also been reported [170]. The segregation of mutant mtDNA molecules across tissues during embryogenesis or post-natal life is therefore one of the factors that can affect age-of-onset and the clinical manifestation of the disease.

All mutations in mtDNA can impair the function of the oxidative phosphorylation system either via directly affecting the subunits, or through affecting their synthesis. It is therefore perhaps surprising that the disease phenotypes associated with mtDNA mutations are highly variable: the range spans lethal multisystem disorders and defects in isolated organs, such as the optic nerve. They can have any age of onset, and affect almost any organ with the nervous system, skeletal muscles, heart and liver being the most commonly affected tissues. Moreover, the genotype-phenotype correlation in diseases due to mtDNA mutations is complex: some syndromes, such as MELAS (mitochondrial encephalopathy, lactic acidosis and stroke-like episodes) can be caused by mutations in different genes, and mutations in the same gene can cause different syndromes in different patients. For example, the A3243G mutation in the anti-codon region of the tRNALeu gene is commonly associated with MELAS [171, 172], but also implicated in chronic progressive opthalmoplegia, maternally inherited deafness and diabetes and cardiomyopathy in different pedigrees [173-175] (the clinical phenotypes of mtDNA mutations are reviewed in [176]). At the moment there are no curative treatments for diseases caused by mtDNA mutations.

2.3.2.1 Genetics of pathogenic mtDNA mutations Many pathogenic mtDNA mutations exhibit skewed tissue distribution [167, 177-183]. In fact, one of the first studies showing mtDNA mutations as the causative molecular defect in human disease reported accumulation of mtDNA deletions in muscle, although these deletions could not be detected from the blood [2]. Similar findings were soon reported in other studies of mtDNA deletions [184, 185] as well as in post-mitotic tissues of aging individuals [186, 187], and prompted the hypothesis that some selective advantage of the mutant mtDNA operating in post-mitotic tissues accounts


32

for the expansion of deleted mtDNA molecules. The same deletion can also underlie distinct phenotypes in the same individual, depending on the tissue distribution. For example, Pearson marrow pancreas syndrome is a severe and often fatal childhood early-onset disease characterized by sideroblastic anemia [188]. However, some patients spontaneously recover only to later develop symptoms of Kearns-Sayre syndrome, a severe disorder that mainly affect post-mitotic tissues [184]. This is thought to be due to selection against the deleted mtDNA molecule in the hematopoietic stem cells or early progenitors, as the deleted molecule is often still detectable in the long-lived circulating white blood cells after the recovery from anemia.

MtDNA point mutations can segregate in a tissue specific manner, and the segregation pattern can be dependent on the mutation and/or the patient pedigree. In patients manifesting with a neuromuscular diseases the proportion of the mutant mtDNA is commonly higher in post-mitotic tissues [158, 179, 189]. In some patients the mutation has been reported to segregate to the muscle while being undetectable in other tissues [180, 190]. Within the muscle, the mutant mtDNA variant may segregate in cell specific way: ragged-red muscle fibers are a common muscle phenotype for mtDNA mutations characterized by abnormal accumulation of mitochondria, respiratory chain dysfunction and higher heteroplasmy levels than neighboring muscle fibers. It is thought that the focal segregation of the A3243G mutation to ragged red fibers in the muscle of chronic progressive external opthalmoplegia (cPEO) patients as opposed to the more uniform distribution of the mutation in the muscle of MELAS patients underlies the difference in these two distinct syndromes [182].

As point mutations can be heritable, their tissue distribution can be affected by mtDNA segregation during embryogenesis or post-natal life. The data obtained from a single time point and in a small number of tissues in general does not allow for elucidation of the timing when the tissue distribution of a particular mutant mtDNA is determined, but limited data on few mutations implies random mtDNA segregation for point mutations during intrauterine development [191-193].

Based on the observations made in the patients with mtDNA mutations it may intuitively seem that mtDNA mutations accumulate in post-mitotic tissues via some selective mechanism. Such accumulation can however be explained also by random genetic drift in combination with ascertainment bias without invoking any selective mechanisms. Data regarding pathogenic mtDNA mutations is only derived from patients (and their families) in whose tissues the mtDNA mutant load reaches pathogenic level and they are clinically investigated, whereas carriers who never manifest the disease and have no family history of mitochondrial disease will never be investigated for mtDNA mutations. This generates an ascertainment bias in the data. Moreover mathematical modeling has shown that random intracellular genetic drift and clonal expansion of cells can explain the apparent post-mitotic accumulation of pathogenic and age-related mtDNA mutations,

33

without invoking a selection mechanism [154, 194]. The accumulation of mtDNA mutations in ragged red fibers may also be a result of random intracellular drift. In some cells the mutation load will be high due to genetic drift. High mutation load causes mitochondrial dysfunction and activates a general mitochondrial biogenesis program specifically in these cells and leads to the increase of all mtDNA molecules (both wild type and mutant mtDNA) in the cell. As these cells have proportionally higher mtDNA mutation load than the tissue on average mitochondrial proliferation will in time increase the overall mutation load measured from bulk tissue, although the proportion of wild type and mutant mtDNA per cell is unchanged [154, 177, 181].

To establish selective mtDNA segregation instead of random intracellular drift requires showing consistent time-dependent changes in the frequency of the mutant mtDNA variant in large study cohorts. Most mtDNA mutations are rare and single measurements from a small number of patients are not sufficient to establish the mode of mtDNA segregation. The notable exceptions to this are the two most common pathogenic mtDNA tRNA mutations, A3243G and A8334G (commonly associated with myoclonic epilepsy with ragged red fibers, MERRF). For the A3243G mutation tissue-specific selective mtDNA segregation has been demonstrated: the heteroplasmy level of the A3243G mutation consistently and reproducibly decreases in the blood of patients from different pedigrees with age [195-199]. Mathematical modeling suggested a mechanism based on selection against the pathogenic mtDNA mutant in the hematopoietic stem cells [199], but no experimental evidence corroborating this hypothesis has been reported. No selective mtDNA segregation phenotypes have been observed for the A8334G mutation, demonstrating that mechanisms affecting mtDNA segregation can be mutation specific as well as tissue-specific.

As mtDNA point mutations can be transmitted through the female germ line, the segregation of the mutated mtDNA during oogenesis is an important factor determining the heteroplasmy level, and thus potential disease, in the resulting offspring. In pedigrees transmitting pathogenic mtDNA mutations, there is typically heterogeneity in the heteroplasmy levels between maternal relatives and generations [189, 198, 200]. Such shifts and heterogeneity are facilitated by the mitochondrial DNA bottleneck during oogenesis. Human pedigrees tend to be too small to distinguish between random and selective mechanisms, but based on one relatively large human data set of 82 primary oocytes from a carrier of the A3243G mutation, random genetic drift accounted for the variability in oocyte heteroplasmy levels [201, 202]. However, different mtDNA mutations may behave differently during transmission. Studies on a very limited number of oocytes and early embryos from carriers of another point mutation (T8993G) reported rapid segregation towards either very low or high heteroplasmy level [203-205].


34

2.3.3 Heteroplasmy in the general population Recent studies have uncovered that mtDNA heteroplasmy is common, if not universal, also in the general population. These studies utilizing next-generation sequencing techniques consistently reported the presence of heteroplasmic mtDNA variants in all [206-208] or a significant proportion of individuals studied [209]. The initial reports were based on analyses on fairly low number of individuals, but the near universal presence of heteroplasmies was corroborated by a study utilizing samples from the 1000 genomes project, which detected heteroplasmy in 90% samples [210]. In most cases a single tissue was investigated, but a study investigating heteroplasmy across ten tissues in over a hundred individuals found that 35% of the heteroplasmies are present in a single tissue, whereas 65% are present in two more tissues [211]. The heteroplasmies reported in these studies represented both pathogenic and neutral polymorphisms, and were present from very low to high levels. Maternal transmission of heteroplasmy was also reported, but these studies relied on data on two families or pedigrees with gene defects in nuclear encoded mtDNA maintenance defects [206, 207]. In some studies, selective mtDNA segregation was speculated based on either recurrent presence of the same heteroplasmic mtDNA variants in the same tissues of unrelated individuals or excess of heteroplasmic variants with non-synonymous changes detected in liver by comparison to other tissues [208, 211]. Further research will show what implications this widespread existence of heteroplasmy has on human health.

The accumulation mtDNA mutations in somatic tissues has been proposed to contribute to ageing (for a review on mitochondrial theory of ageing, see [212]). Analysis of aged individuals provides support for the mitochondrial theory of ageing: mitochondrial DNA deletions do accumulate with age, as does respiratory chain deficiency, but predominantly in the post-mitotic tissues [186, 187, 213]. The data on mtDNA point mutations is however more controversial with some studies finding no evidence for accumulation of point mutations in normal ageing [207, 214] while others do [211, 215]. The role of mtDNA mutations in ageing has been experimentally studied in the Mutator mouse model where random mtDNA mutations are inserted at a high rate due to a proofreading defect in PolG. These mice exhibit a progeroid phenotype, further supporting for a role for mtDNA mutations in aging [216, 217]. Work with this mouse model revealed that mtDNA mutations cause somatic stem cell dysregulation that promotes cell proliferation over stemness that contributes to the premature ageing phenotype [218]. The somatic stem cell defects in the Mutator mice precede any detectable respiratory chain dysfunction in these mice, suggesting that more subtle changes in mitochondrial metabolism underlie the stem cell defect (for a review see [219]).

MtDNA mutations have also been reported in cancer cells. Mitochondrial mutations that segregated rapidly to homoplasmy in colorectal tumors while being absent from the neighboring healthy tissue were first reported in 1998

35

[220]. These findings have been reproduced in both different types of solid tumors and leukemias [221-223]. Based on mathematic modeling the rapid segregation of mtDNA mutations in cancer cells can be explained random genetic drift and clonal expansion rather than positive selection for mtDNA mutations in cancer [224]. Therefore it is not at present clear whether these mutations contribute to, or are a result of, cancer progression.

2.4 Experimental research on tissue-specific mtDNA segregation

The segregation of heteroplasmic mtDNA variants in tissues can affect the age of onset and clinical outcome of mtDNA diseases, and lack of knowledge about the basic mechanisms of this process impedes accurate disease prognosis and genetic counseling. Ultimately, affecting the process of mtDNA segregation in a way that the mutated mtDNA variant would be selected against could represent a potential target for therapy for these patients, for whom there is no curative treatment available at the present time.

Early experimental research for heteroplasmic mtDNA mutations was conducted in primary cells derived from patients and in cybrid (cytoplasmic hybrid) cell line. Cybrid cells are generated by fusing an anucleated cell containing the mutant mtDNA with a recipient cell, creating a hybrid cell line harboring the desired mtDNA mutation. Cybrids cell lines had been successfully used to demonstrate that mtDNA mutations underlie the biochemical OXPHOS defects in the patients independent of the nuclear background, and in determining the mutation-specific thresholds for biochemical defects (reviewed in [225]). Regrettably, this model failed to provide robust and reproducible results in the study of mtDNA segregation, as different groups reported variable and opposing results for the segregation behavior of the same mtDNA variant, potentially owing to the unstable aneuploid nuclear genetic background of the cybrid cells [226-228]. Furthermore the recipient cells used in the generation these cybrid cells were osteosarcoma or other cancer cell lines, and cannot therefore accurately model the tissue and/or cell type specific mtDNA segregation patterns seen in patients.

The generation of a heteroplasmic mouse model segregating two non-pathogenic mtDNA genomes twenty years ago facilitated the research of study mtDNA segregation in a more physiological context [149]. These mtDNA variants were derived from two old inbred strains, Balb/c and NZB, and differ at 90 nucleotide positions at the sequence level [102]. This model was originally created to study transmission of heteroplasmy but has proved useful for studying mtDNA segregation in somatic tissues as well. This model is referred to as the BALB/NZB model in this thesis. Other heteroplasmic mouse models have also been generated [229-232].


36

2.4.1 Transmission of mtDNA variants and purifying selection Due to the uniparental inheritance mode, the mammalian mtDNA is fundamentally an asexually reproducing genome without homologous recombination. In principle, this should render the mtDNA vulnerable to Müller’s ratchet: the accumulation of deleterious mutations as they cannot be removed by recombination, and the mitochondrial genome does indeed accumulate mutations faster than the nuclear genome ([233], reviewed in [146]). The mitochondrial genetic bottleneck is thought to counteract this accumulation of mtDNA mutations in subsequent generations by exposing deleterious mtDNA mutations to purifying selection.

The transmission of neutral mtDNA variants has been studied in the BALB/NZB model and there is no evidence for selection during transmission. Instead the transmission of the neutral mtDNA variants is consistent with random genetic drift with a small population of segregating units in the mitochondrial genetic bottleneck. To better model the segregation of heteroplasmic variants in the female germ line, a model of neutral genetic drift based on a modified Kimura distribution was developed [202]. The predictions of the modified Kimura distribution were shown to model the distribution of heteroplasmy in the offspring of heteroplasmic females of the BALB/NZB heteroplasmic mice and in oocytes derived from an A3243G mutation carrier.

There is, however, experimental evidence for a purifying selection process against highly deleterious mtDNA mutations in protein coding genes from mouse models. In the offspring of female mice carrying a defective PolG (Mutator mouse model) that introduces random mtDNA mutations at a high rate, a strong bias against non-synonymous mutations in the protein coding genes was detected [231]. Furthermore, in a mouse model heteroplasmic for a deletion in the protein coding Nd6 gene, the mutation was selectively eliminated during oogenesis in a few generations [232]. In contrast no bias in transmission of mutations in the tRNA genes in the Mutator mice was reported [231], and no purifying selection against a mutant tRNA gene for methionine was observed in the female germ line. However for the heteroplasmic tRNA methionine the authors reported selection against very high mutation load in the embryos [230].

Based on these findings, there are processes in the female germ line that mediate purifying selection against certain mtDNA variants, but other variants escape this selection. In the light of current data, more severe mutations such as deletions and point mutations affecting the protein coding genes are selected against, whereas tRNA mutations and polymorphic variants appear to be inherited neutrally.

37

2.4.2 MtDNA segregation in somatic tissues of the BALB/NZB heteroplasmic mice

In the BALB/NZB heteroplasmic mouse model the heteroplasmy levels are similar across tissues at birth, consistent with random mtDNA segregation during embryogenesis similarly to what has been reported for some pathogenic mtDNA mutations [191-193]. Post-natally, however, there is mtDNA selection in three tissue types: the liver, kidney and hematopoietic tissues. Surprisingly, the selection occurs in opposite directions in the tissues. The NZB genome is selected for and increases with time in the liver and kidney, whereas it is selected against in the hematopoietic tissues. The mechanism governing the segregation in liver differs from that in the hematopoietic tissues, because the dynamics of mtDNA segregation are different. In liver, the rate of segregation is constant and independent of the initial heteroplasmy level, leading to fixation of the NZB genome [234], whereas in the spleen segregation is best modeled as an exponential decay proportional to the initial heteroplasmy level [235]. Tissue-specific mtDNA selection has also been observed in other heteroplasmic mouse models, and it appears to be a common phenotype in heteroplasmic mice [229, 236-238].

As all of the polypeptide genes encoded by the mtDNA are subunits of the OXPHOS complexes differences in the capacity for ATP production could mediate selective mtDNA segregation phenotypes. Similarly, differences in replication rates between the heteroplasmic variants could lead to selection of one mtDNA variant over the other. However, there is no difference in these parameters between the two genomes in the BALB/NZB genomes [234, 239]. Similarly in patients the MELAS mutation is selected against in the blood at levels well below the biochemical threshold for dysfunction for this mutation. Furthermore there is no selection against other pathogenic mtDNA variants in patient tissues where the threshold for biochemical defect is exceeded. Based on these data selection mechanisms that are not dependent on OXPHOS exist.

2.4.2.1 Genetic modifiers of selective mtDNA segregation An advantage of mouse models is the ability to use forward genetics approaches to identify genes and pathways involved in phenotypes under investigation. The selection phenotype seen in the BALB/NZB model is common to all M. m. domesticus strains as shown by backcrossing with six different laboratory strains, precluding genetic mapping in these backgrounds. However, an intercross to another mouse subspecies M. m. castaneus (referred to as Cast/Ei hereafter) uncovered quantitative effects on the selective mtDNA segregation phenotypes in the liver, kidney and spleen in the F2 offspring, providing the first experimental evidence that nuclear genes can affect mtDNA selection [240]. The evolutionary lines of the two mouse subspecies diverged approximately one million years ago and thus there is more genetic variability than between different M. m. domesticus


38

strains. A genome wide linkage scan was performed on the F2 data and independent quantitative trait loci (QTL) were identified for each tissue. The QTLs were named segregation of mitochondrial DNA 1–3 (Smdq1–3) for liver, kidney and spleen respectively. Further backcrossing to the Cast/Ei background revealed that the mtDNA selection phenotype in the hematopoietic tissues can be completely lost on this background, confirming the presence of limited number of nuclear genes that regulate the mtDNA phenotype [235].

2.4.2.2 MtDNA selection in hematopoietic tissues In the BALB/NZB model, the selection against the NZB variants is common to both lymphoid and myeloid lineages [235]. The decrease in the relative amount of the NZB genome is proportional to the initial heteroplasmy level of the animal and can be modeled as an exponential decay function. This decrease is approximately 50% during the first 100 days of post-natal life, and eventually reaches an asymptote so that the NZB genome is never completely lost [235].

The immune system defends the body from pathogens and in mammals the immune system is based on general pattern recognition by the innate immune system and specific pathogen recognition by the adaptive immune system. As mitochondria have prokaryotic origin and characteristics (see section 2.1.1), they could be recognized by the immune system as pathogens and a selection mechanism based on recognition of specific mtDNA variants by the innate or adaptive immune system and a subsequent immune reaction against them could be envisioned. While such a mechanism could explain mtDNA selection in any tissue type, this question has mostly investigated in the hematopoietic compartment.

The adaptive immune system relies on the recognition of specific antigens from pathogens by T cells, and the formation of memory cells after first encounter (priming) for quick immune responses upon re-encounter of the same pathogen. Peptides derived from proteins encoded by the mtDNA have a role in priming the T cells against intracellular pathogens through presentation of mitochondrial peptides as self-antigens for T cells [241]. One of the nucleotide differences between BALB and NZB genomes is in the Nd1 gene, which has been shown to function as a self-antigen [242]. Moreover, the gene required for the presentation of mitochondrial peptides is functionally null in Cast/Ei mice, where the selection against the NZB mtDNA in the hematopoietic tissues is lost [243], prompting the hypothesis that an adaptive immune system reaction against the NZB genome would underlie the mtDNA selection in the hematopoietic tissues of the BALB/NZB mice. This hypothesis was tested with transgenic mouse models incapable of presenting mitochondrial peptides (Tap1 and β-microglobulin knock-out mice) or incapable of mounting T-cell mediated immune responses (Rag1 knock-out mouse) [235]. None of these genetic modifications affected the

39

selection against the NZB genome in hematopoietic tissues, showing that the selection is not dependent on adaptive immune responses or mitochondrial self-antigen presentation. Furthermore the Tap1 and β-microglobulin knock-out had no effect on the mtDNA selection in the liver, demonstrating that mitochondrial self-antigen presentation does not underlie mtDNA selection in this tissue either.

The role of the innate immune system has not been investigated in the BALB/NZB model, but one interesting study reported a role for the innate system in recognition of specific mtDNA variants [244]. Xenografts harboring either the same mtDNA as the host (syngenic) or distinct mtDNA (allogenic) were transplanted into mice, and specific rejection of the allogenic grafts was reported. This specificity was lost when the recipient mouse was of a transgenic strain with defective innate immune system (Myd99 knock-out strain), but not when the recipient mouse had a defect in adaptive immune system (Tap1 and β-microglobulin knock-out mice). Moreover, the ability of the innate immune system to recognize and select against the allogenic mtDNA was at least partially assigned for a specific cell type, the Natural Killer (NK) cells: specific reduction of NK cell quantity with an injection of an anti-NK cell antibody was sufficient to allow some tumor growth after transplantation, albeit slower than with syngenic transplant. The role of this interesting mechanism in tissues under normal physiological conditions is at present unknown, and requires further investigation.

2.5 Gimaps (GTPases of the immunity associated protein)

The Gimap gene cluster is a family of GTPases that was revealed to be important for tissue-specific mtDNA segregation by the work presented in this thesis. Therefore it is appropriate to discuss them here.

The Gimap gene cluster is specific to vertebrates with an orthologous gene in Arabidopsis thaliana in which the prototype gene AIG1 for the family was identified. The common domain between A. thaliana AIG1 gene and the vertebrate Gimap family is the AIG domain, which contains the P-loop GTPase domain and a conserved box of unknown function (CB) [245-247]. Some of the Gimap proteins are soluble and reside in the cytosol, while others are membrane proteins with a carboxy-terminal transmembrane domain localizing to various subcellular compartments (Table 1). The Gimap genes reside in a cluster that in mice consists of eight functional genes on chromosome 6 and in humans seven functional genes on chromosome 7 [245, 248, 249]. GIMAP2 is specific to humans, whereas Gimap9 is found only in mice [250]. Expression of the Gimap family is enriched in immune tissues [245, 246, 248, 249, 251-258].


40

Table 1 Reported subcellular localizations of the Gimap family proteins in mice and humans. *Gimap7 does not contain a transmembrane domain, and may localize to lipid droplets via interaction with Gimap2 or other factors. NA stands for data not available.

Protein Subcellular localization

Reference Human Mouse

Gimap1 Endoplasmic reticulum

Golgi [249, 259]

Gimap2 Lipid droplets NA [260] Gimap3 NA Mitochondria [256] Gimap4 Cytosol Cytosol [261, 262] Gimap5 Lysosome Lysosome [259] Gimap6 Cytosol NA [261]

Gimap7* Diffuse, lipid droplets

NA [261]

Gimap8 Cytosol Endoplasmic reticulum Mitochondrion Golgi

[250, 261]

Gimap9 NA NA The mammalian prototype gene of the family, Gimap1, was originally

reported as a response gene to malaria infection [258], however, these results were not reproducible [263]. In the light of current data the Gimap proteins appear to be involved in leukocyte development and cell survival regulation, potentially through interactions with various Bcl-2 family regulators of cell survival[246, 248, 252, 262, 264-269]. However, the specific role of Gimaps in these functions is not known. In humans, the GIMAP locus associates with autoimmune disorders [270, 271], but causative disease mutations have not been reported.

Structural analysis of the Gimap proteins revealed that these GTPases are most related to the dynamin family of membrane remodeling proteins and the septin family of intracellular scaffold proteins [260]. Analysis of the membrane-bound GIMAP2 showed that this protein has low inherent GTP hydrolysis activity and upon GTP binding, forms stable oligomers instead of GTP hydrolysis. Based on these findings and the homology to septins, it was proposed that the membrane-bound Gimaps could function as scaffolds that facilitate the binding of other factors. In contrast, the soluble GIMAP7 was able to readily hydrolyze GTP upon binding, and stimulate GTP hydrolysis and disassembly of GIMAP2 oligomers through hetero-oligomerization, thus providing a potential regulatory mechanism for Gimaps [261].

Gimap3 and Gimap5 are two membrane-bound paralogs. 84% of their amino acid sequence is identical, with major variation seen only in the carboxy-terminal transmembrane domain and in the amino-terminus (Figure 7). GIMAP3 is annotated as a pseudogene in humans but as a functional gene in mice, whereas Gimap5 is a functional gene in both species.

41

Gimap3 had a reported subcellular localization to the outer mitochondrial membrane [256]. Gimap5 was originally reported to localize to various cellular membranes [248, 272], but more recent data utilizing species-specific antibodies demonstrated a lysosomal localization for human, mouse and rat Gimap5 [259]. Both Gimap3 and 5 have been reported to interact with various Bcl-2 family factors, and to be important for lymphocyte development in fetal thymocyte cultures.

Figure 7 Comparison of the protein domains between Gimap3 and Gimap5. Areas of major variation are highlighted with purple for Gimap3 and orange for Gimap5. CB = Conserved box, CC = Coiled-coil domain, TM = Transmembrane domain.

In rats, a naturally occurring Gimap5 null allele causes T cell lymphopenia and is a susceptibility factor for autoimmune mediated diabetes [253, 254]. In mice, three independent models for Gimap5 deficiency have been reported. The first published model was a germ line genetic ablation with dysregulation of all of the leukocyte lineages, characterized by severe anemia and T cell lymphopenia, and liver dysfunction [264, 273]. An almost identical phenotype was reported in a mouse model generated by embryonic stem cell mutagenesis that carries a homozygous missense mutation in Gimap5 rendering the protein unstable [274]. In contrast the third mouse model, another germ line genetic ablation, was reported to have a much milder phenotype [275]. A Gimap3 knock-out mouse was not available when this thesis was initiated, but a germ line genetic knock-out was published in 2014. The Gimap3 knock-out does not exhibit a phenotype in the hematopoietic compartment under normal conditions [275]. However, Gimap3 deficient bone marrow was shown to perform poorly in repopulating the hematopoietic system after bone marrow transplantation

Aims of the study

42

3 Aims of the study

The purpose of the studies presented in this thesis was to investigate the basis for genetic regulation of tissue-specific mtDNA segregation phenotypes in mammals by utilizing the BALB/NZB heteroplasmic mouse model. The specific aims were:

1. To test the role of Gimap3 in tissue-specific mtDNA segregation.

2. To investigate the characteristics of Gimap3 and its paralog Gimap5 to elucidate their role in tissue-specific mtDNA segregation.

3. To investigate the importance of mitochondrial fission for mtDNA segregation.

43

4 Materials and methods

The materials and methods used in this thesis are presented in detail in the original publications (I-III), and summarized here.

4.1 Ethical statements

All the animal work presented in this thesis was approved by the national Animal Experiment Board and were performed under the following animal experiment project licenses: ESAVI/6615/04.10.03/2012 and ESLH-2009-09824/Ym-23. The author of this thesis has competence for performing and designing animal experiments as defined in the European Union directive 2010/63/EU and the Finnish government act and decree for the use of animals for scientific or educational purposes (564/2013).

4.2 Mouse models animal housing

4.2.1 Animal housing All the animals were housed under standard conditions applied by the University of Helsinki Laboratory Animal Center with ad libitum feeding and 12 + 12 hour light/dark cycle. Animals were housed in random groups and sampled in random order. Both male and female mice were used in the analyses.

4.2.2 BALB/NZB heteroplasmic mice The BALB/NZB heteroplasmic mouse model was created by cytoplasmic transfer to one cell recipient embryos, and carries the mtDNA haplotypes from Balb/c and NZB inbred laboratory mouse strains [149]. They have been backcrossed and maintained on the Balb/c nuclear background for 20 years since their generation, and exhibit no known pathology. The heteroplasmic mice used in this thesis were derived from our own colony.

4.2.3 Cast Gimap3 transgenics The generation of the Cast Gimap3 transgenic mouse model was part of the work described in this thesis. The coding sequence the Cast/Ei Gimap3 allele was cloned into the EcoRI site of pBroad3 vector (Invivogen) and microinjected to FVB embryos at the University of Helsinki Laboratory

Materials and methods

44

Animal Center’s transgenic unit. The resulting chimeras were bred to Balb/c mice for further analysis.

4.2.4 Gimap5 knock-out The Gimap5 knock-out strain (Gimap5tm1Wlr) was generated by targeted deletion of exon 2 and part of exon 3 of the mouse Gimap5 gene. The deleted are contains the initiation sequence for translation. The Gimap5 KO strain on Balb/c nuclear background was obtained through collaboration with Professor Hartmut Weiler (Blood Research Institute, Blood Center of Wisconsin, Milwaukee, United States) and the mice used this thesis were produced in our colony.

4.2.5 Python mouse The Python mouse model (Dnm1lPy) harbors a C to T transversion in exon 11 of Dnm1l gene that leads to substitution of a conserved cysteine at amino acid position 452 to phenylalanine [276]. This mutation is dominant-negative, and homozygosity for the Dnm1lPy allele is lethal during embryonic development. The Python mouse was identified in a mutagenesis screen for cardiomyopathy. We obtained the Python mouse model on C57BL/6 nuclear background through collaboration with Professor Neil Dear (South Australian Health and Medical Research Institute, Adelaide, Australia). The animals used in this thesis were produced in our own colony and were either F1 crosses to the BALB/NZB heteroplasmic mouse model or N2 backcrosses of those F1 females to Balb/c males.

4.2.6 Mouse crosses F2 generation from BALB/NZB heteroplasmic x M. m. castaneus intercross was produced by crossing female BALB/NZB heteroplasmic to male M. m. castaneus mice. Animals from the resulting F1 generation were bred with each other (F1 x F1) to produce F2 generation, referred to in the results section as F2 (BALB/NZB heteroplasmic x Cast/Ei).

F2 generation from the cross BALB/NZB heteroplasmic x Cast Gimap3 transgenics was produced by breeding the founder of the Cast Gimap3 transgenic (on a FVB background) with Balb/c animals to produce the F1 generation. Males from the F1 generation were bred to BALB/NZB heteroplasmic females to produce the F2 generation data set referred to in the results section as F2 (BALB/NZB heteroplasmic x Cast Gimap3).

N2 generation from the cross BALB/NZB heteroplasmic x Python mouse was generated by breeding female BALB/NZB heteroplasmic mice to male Python mice. Females of the resulting F1 generation were bred to C57BL

45

males to produce the N2 generation referred to in the results section as N2 (BALB/NZB heteroplasmic x Python).

4.2.7 Genotyping The mice used in this thesis were genotyped from DNA extracted by isopropanol precipitation from ear punches. The Cast Gimap3 transgenic and Gimap5 KO mice were genotyped by PCR and agarose gel electrophoresis. The Python mice were genotyped by PCR and restriction with ApoI enzyme (New England Biolabs), followed by agarose gel electrophoresis. The BALB/NZB heteroplasmic mice were genotyped by last cycle radioactive PCR and restriction fragment length polymorphism (RFLP) analysis by polyacrylamide gel electrophoresis, see 4.3.2 for details. The primers for genotyping are listed in Table 2.

Table 2 Primer sequences and product sizes for genotyping genetically modified mice. * Product sizes refer to digestion products with Apo1 for Python and RsaI for BALB/NZB heteroplasmic mice. F=forward, R=reverse).

Strain Primers Product size in bp

Wild type Modified

Cast Gimap3 transgenic

F: CATACCGTCACACCATCTGC R: CTTTTACCGCAGCCAGATTT

1700 320

Gimap5 KO WT F: CCAGAAGCCCACTGTGTAGAAGAAT KO F: TCCAGACTGCCTTGGGAAAAGC R: GTGAGAAGAGTCAAACCAAGCACAAT

845 674

Python* F: GCAGAGGATCATTCAGAATT R: TGGCATTTCAAATCAGTGTCAGG

100 80

BALB/NZB heteroplasmic*

F: GAGCATCTTATCCACGCTTCC R: CTGCTTCAGTTGATCGTGGGT

(BALB) 218, 170

& 121

(NZB) 339 & 170

4.3 DNA analyses

4.3.1 DNA extraction Tissue pieces were snap frozen in liquid nitrogen upon collection and stored in -20 ºC prior to DNA extraction. The tissues were lysed overnight at +55 ºC in buffer (20 mM Tris-HCl, 5 mM EDTA, 1% SDS, 400 mM NaCl) containing 0.2 mg/ml proteinase K. The DNA from lysate was extracted by standard


46

phenol-chloroform extraction and resuspended in sterile TE-buffer (pH 8). The DNA samples were stored at +4 ºC.

4.3.2 Heteroplasmy analysis The relative heteroplasmy level was measured as the proportion of the NZB mtDNA genome RFLP analysis. The RFLP analysis is based on the RsaI restriction enzyme site at nucleotide position 3691 unique to the NZB genome. The area containing the polymorphism was amplified by PCR and 32P (alpha) labeled dCTP added to the reaction for the last cycle. The PCR product was digested with RsaI (Roche) and separated on non-denaturing PAGE. The gel was dried and exposed to Storage Phosphor screen and the signal detected and quantified with a Typhoon 9400 laser scanner. Four bands (table 3) from the heteroplasmic mice can be detected: band 1 is unique to NZB and bands 2 and 4 unique to BALB. Band 3 shared and therefore omitted from analysis. The relative signal of band 1 was used to calculate the heteroplasmy level of NZB (equation 1). For tissue heteroplasmy analysis, each sample was run in duplicates. For genotyping of animals from ear punches a single reaction was analyzed.

(1)

The selection against the NZB genome in the hematopoietic tissues was modeled as the proportion of NZB mtDNA variant left in the tissue at the given time point as described in [235]. To estimate this the percentage of NZB in the hematopoietic tissues relative to the percentage in a neutral tissue of the same animal was calculated. The neutral tissue is used as an approximate what the percentage of NZB was initially in the hematopoietic tissues, since at birth the heteroplasmy level is similar across tissues. The selection for the NZB genome in the liver and kidney was modeled as a relative fitness for the NZB genome, as described in [234]. The relative fitness calculation uses a population genetics equation that compares two asexual populations after n generations to estimate the relative advantage of the NZB genome according to equation 2, where p and q represent the frequency of NZB and BALB respectively, w/w1 the relative fitness and n the number of generations. To calculate the number of generations, mtDNA half-life in liver and kidney was assumed to be similar to that experimentally determined for rats [277].

(2)

47

4.3.3 MtDNA quantity

4.3.3.1 Quantitative PCR The quantity of mtDNA was determined relative to a single copy nuclear gene β-2-microglobulin. The quantitation was performed with SYBR Green qPCR kit (Kapa Biosystems) on a Bio-Rad CFX96 thermal cycler. All the samples were run in technical triplicates.

4.3.3.2 Southern blotting The DNA was digested with the NcoI restriction enzyme (New England Biolabs) and run on 0.8% agarose gel by electrophoresis. Subsequently the DNA was transferred to Hybond-XL membrane by alkaline transfer. The membrane was consecutively hybridized with a 32P (alpha) labeled nuclear probe against the 18S gene and mtDNA probe. The radioactive signal was recorded on a storage phosphor screen and imaged with a Typhoon 9400 scanner. The relative intensity of mtDNA signal to nDNA signal was calculated with ImageQuant program.

The hybridization conditions were the following. The membrane was prehybridized in 7% SDS, 0.25M sodium phosphate, 0.24M NaCl and 1mM EDTA at +42 ºC for one hour. The hybridization buffer (as prehybridization except for 50% formamide) and the labeled probe were added after prehybridization the membrane allowed to hybridize at 42 ºC overnight. The membrane was then washed with 2 X SSC, 0.1% SDS for one hour, 0.2 X SSC, 0.1% SDS for 30 minutes and 0.1 X SSC, 0.1%SDS for 20 minutes at 37 ºC.

4.4 RNA analyses

4.4.1 RNA extraction Tissues were snap frozen in liquid nitrogen upon sample collection and stored at -80 ºC. For RT-PCR analysis, tissue pieces were homogenized in 1 ml of Trizol reagent (Invitrogen) with PT Polytron 1200 E power homogenizer and the RNA isolated according to manufacturer’s instructions for Trizol. To isolate total RNA for northern blotting the frozen tissue homogenized with Precellys 24 tissue homogenizer (Bertin technologies) with mixed beads and a homogenization cycle of 5500 rpm for 25 sec in 1 ml of Trizol reagent and RNA isolated as in manufacturer’s instructions with the following modifications to minimize RNA degradation: 1) the dissociation step was performed on ice instead of room temperature, 2) the isopropanol precipitation was performed on ice 1 hour and 3) the ethanol wash of the pellet was done overnight at -20 ºC. All RNA samples were resuspended in


48

DEPC treated sterile water and treated with DNase I (New England Biolabs) prior to use in downstream applications and stored at -80 ºC.

4.4.2 Northern blotting 15 μg of total tissue RNA was separated on a 1.2 % agarose-formaldehyde gel and transferred by neutral transfer to Hybond N+ membrane (GE Healthcare). The membrane was UV cross-linked and used for hybridization. The probes for Gimap3 and Atp5b were end labeled with 32P (gamma) with T4 polynucleotide kinase (New England Biolabs) and purified with Illustra ProbeQuant G-50 microcolumns (GE Healthcare). The membranes were prehybridized in hybridization buffer (25% formamide, 7% SDS, 1% BSA, 0.25 M sodium phosphate pH 7.2, 1 mM EDTA pH 8.0, 0.25 M NaCl) at 65 ºC for 1 hour prior to addition of the probe. After probe addition, the temperature was lowered to 37 ºC and the hybridization allowed to proceed overnight. The membranes were consecutively washed with 2 x SSC, 0.1% SDS, 1 mM EDTA and 0.2 x SSC, 0.1% SDS, 1 mM, dried and exposed to Storage Phosphor screens, which were scanned and quantified with a Typhoon 9400 laser scanner.

4.4.3 Reverse transcriptase PCR (RT-PCR) RNA levels expression of Gimap3 was investigated with Qiagen’s one-step RT-PCR kit with primers amplifying over exon 4, which is present in Balb Gimap3 but absent from Cast Gimap3 mRNA. The corresponding product sizes detected on AGE are 462 bp and 427 bp, respectively. To semi quantitatively analyze the allelic expression of Gimap3 in F2 (Balb/c x Cast/Ei) the RT-PCR was compared to a standard curve generated with equimolar mixtures of Balb/c and Cast/Ei RNA (r2=0.97). The signals were quantified with a Typhoon 9400 laser scanner.

4.5 Protein analysis

4.5.1 Immunoblotting and histodenz gradients Tissue samples for protein analysis were snap frozen in liquid nitrogen upon collection and stored at -80 ºC. For immunoblotting, samples were homogenized in buffer (HIM: 200 Mm mannitol, 70 mM sucrose, 10 mM HEPES, 1 mM EGTA pH 7.5) with a Teflon pestle homogenizer and centrifuged at 20 000 x g for 30 minutes. The resulting pellet was used for protein solubilization. To obtain protein samples from splenic leukocytes freshly collected spleens were dissected in PBS and pressed through 70 nm cell strainer. The resulting cell suspension was washed with PBS and pipetted

49

through a fresh cell strainer. The cells were pelleted and the pellet used for solubilization. For protein samples from cultured cells, the cells were scraped off the tissue culture plates and pelleted by centrifugation and the pellet washed with PBS. The washed pellet was used for solubilization. Proteins were solubilized with 1% DDM, 1 x complete mini protease inhibitor, 1 mM PMSF in PBS for 20 minutes on ice. The samples were the centrifuged at 20 000 x g at +4 ºC for 30 minutes. The supernatant was collected and used as total protein sample. Samples were stored in -80 ºC.

Protein concentration was determined by the Bradford method and equal amounts of protein sample in Laemmli sample buffer separated on SDS-PAGE. The proteins were transferred onto a membrane by semidry transfer, and the membranes blocked with 1% milk in TBS-T. The primary antibodies (Table 3) were incubated at +4 ºC overnight. Antibody detection was by secondary HRP conjugates and enhanced chemiluminescense (Cell signaling technologies). The membranes were exposed to medical X-ray film or imaged with a BioRad Chemidoc imaging station. When western blots were quantified, the Chemidoc imaging station was used.

For Histodenz gradients mouse spleens were homogenized in HIM-buffer with a Teflon pestle homogenizer and centrifuged twice at 600 x g at +4 ºC for 10 minutes. The resulting post nuclear suspension was subsequently mixed with an equal volume of 50% of Histodenz (Sigma) and separated on a discontinuous sucrose gradient by centrifugation at 52 000 x g at +4 ºC for 90 minutes. Samples were collected and TCA precipitated, and analyzed by SDS-PAGE and immunoblotting.

Table 3 Antibodies used in immunoblotting. Balb and Cast Gimap3 antibodies are polyclonal antibodies raised in rabbits. Other antibodies are commercial.

Antibody Company Raised against peptides (amino acids)

Balb Gimap Biogenes ETLQNVVTGGKKGGC (2 – 16) CEGSWVLKVLPIGKK (269 – 272)

Cast Gimap3 Biogenes RIPVYTTDHLRCPDS (32 – 45)

Calnexin Proteintech Group NA

Tom40 Santa Cruz NA

Atg5 Sigma NA

Sdha Mitosciences NA

Porin Millipore NA


50

4.5.2 Isobaric tags for relative and absolute quantification (iTRAQ) analysis

ITRAQ analysis is based on chemical tags with stable isotopes for relative quantification of peptides identified by mass-spectrometry (MS). The tags are of equal mass but contain specific reporter groups based on N-methylpiperazine that can be detected by LC-MS/MS (liquid chromatography-mass spectrometry/mass spectrometry). In our analysis we used three tags with different reporter groups to analyze the relative abundance of peptides between three samples. The iTRAQ analysis was performed on protein obtained from membrane enriched spleen samples. The membrane enrichment work flow is depicted in Figure 8. 120 μg of solubilized protein from the membrane enrichment was precipitated with 2-D Clean Up kit (GE-healthcare). The protein samples were trypsinized, labeled with the iTRAQ labels and analyzed by LC-MS/MS. Three biological replicates were included for each genotype.

Figure 8 Subsequent centrifugation steps to obtain a pellet enriched in the cellular membrane fraction for protein solubilization

4.5.3 In vitro translation Proteins were synthesized with TNT T7 reticulocyte lysate system (Promega) from the following constructs: A) YFP with N-terminal fusion of the Cast Gimap3 amino acids 1 – 68, B) amino acids 1 – 68 of Cast Gimap3, C) Balb Gimap3 coding sequence, D) Cast Gimap3 coding sequence and E) YFP. All the constructs were cloned in pCDNA3.1 vector. The optimal reaction time for the in vitro translation with (35S)Met-Cys was determined linear radiolabel incorporation to YFP and was 25 minutes. The samples were then separated by SDS-PAGE, the gel dried and the radioactive signal detected and quantified with a Typhoon 9400 laser scanner.

4.6 Blood analysis

Whole blood sample was collected by cardiac puncture immediately after euthanasia into 1 ml syringes with a 25 gauge needle. The blood was

51

transferred into EDTA coated tubes and analyzed within 24 hours with Advia 2120i analyzer at the University of Helsinki Small Animal Hospital.

4.7 Cell culture and microscopy

Cell lines (MEFs, COS-7 and NIH3T3) were cultured under standard conditions in DMEM supplemented with 10% FBS and Glutamax.

4.7.1 Generation of murine embryonic fibroblasts (MEFs) To generate MEFs with the Python mutation in the Dnm1l gene, C57BL/6 females were bred to C57BL/6 male carrier of the Python mutation. The embryos were collected from euthanized females at E13.5, and a single cell line established from each embryo. The embryos were dissected and incubated for 60 – 90 minutes at +37 ºc in 1 X Trypsin-EDTA in PBS, and the suspension was mixed repeatedly during incubation. The Trypsin in the resulting cell suspension was inactivated with FBS, and the cells washed with medium. The cells were plated on cell culture dishes in DMEM supplemented with 10% FBS, Glutamax, Penicillin and Streptomycin, and allowed attach. Once the cells reached confluency, they were passaged and sample for genotyping obtained. Genotyping of the cell lines was as for Python mice (4.2.6, table 4).

4.7.2 Transient transfection and retroviral transduction Constructs for transient transfections were cloned into the pCDNA3.1 vector and transfected to cells with jetPRIME transfection reagent (Polyplus). The GFP-Sec61β used for transfection was received as gift from Professor Benoit Kornman (ETH Zürich, Institute for Biochemistry, Switzerland). For generation of stable cell line through retroviral transductions constructs were cloned into Gateway converted retroviral expression vectors (pBABE-puro, pMYS-IRES-Neo, or pMXs-IRES-Blasticidin). The pGFP-Omp25 was received as a gift from Professor Hans Spelbrink (Nijmegen Center for Molecular Life Sciences, Institute for Genetic and Metabolic Disease, the Netherlands). For virus production the plasmids were transfected into Phoenix A packaging cell line. The virus was collected and used to transduce recipient cell lines, which were subjected to selection with the appropriate antibiotic prior to use in experiments.

4.7.3 Cell fixation and antibody staining Cells were grown on cover slips and fixed with 4% paraformaldehyde for 10 minutes. For antibody staining, cells were permeabilized 0.2% Triton X and


52

blocked with 5% BSA for two hours. The primary antibody was incubated overnight at +4 ºc. The secondary Alexa fluorophore conjugated antibody was incubated for one hour, and the cover slips mounted onto a microscopy slide with Dabco/Mowiol 4-88.

4.7.4 Microscopy Microscopy slides were imaged with a Leica TCS Sp8 CARS (Coherent Anti-Stokes Raman Scattering) microscope with 633 APO (1.2 numerical apperture (NA)) water objective using the Argon (488 nm) and DPSS (561 nm) lasers or Zeiss META 510 with the 633 Plan-Apochroma (1.4 NA) objective using the Argon (488 nm) and HeNe1 (543 nm) lasers. Image processing was performed with ImageJ program. Only linear corrections were applied during processing.

4.8 Statistical analysis

Statistical analysis was performed with Statplus or GraphPad Prism 6 programs. To analyze differences in between the means of groups analysis of variance (ANOVA) or two-tailed T-test was used, depending on the number of groups in the comparison. To test for difference in variances between the groups, F-test was used. All data sets were tested for normality prior to use of parametric statistic tests. When data did not follow normal distribution, nonparametric test (Mann-Whitney U test) was used.

Nonlinear regression analysis was performed in GraphPad prism with default parameters (least squares fit). The line was constrained to go through the origin to determine the best fit slopes for each data set. The goodness of fit estimated with r2 values, and a runs test was performed on the residuals to evaluate whether the fitted line deviates systematically from the data.

The Kimura distribution analysis for neutral mtDNA transmission was done in collaboration with Dr. James Stewart (Max Planck Institute for Biology of Ageing, Cologne, Germany). The analysis was done as described in [202] and publication III.

53

5 Results

5.1 Gimap3 is a genetic modifier of tissue-specific mtDNA segregation in mice (I)

5.1.1 Genetic mapping of a candidate gene for tissue-specific mtDNA selection

At the time when this thesis was initiated, not a single gene involved in tissue-specific mtDNA segregation in mammals had been identified and Smdq1-3 represented the only mapped nuclear loci. However, a linkage study to identify candidate genes had already been conducted, and was later published as a part of publication I of this thesis. Therefore, it is appropriate to summarize the results of the linkage study here, even though it preceded the work done for this thesis.

In the BALB/NZB heteroplasmic mice, there is age-dependent selection against the NZB genome in the hematopoietic tissues. This selection phenotype can be progressively lost with backcrossing to Cast/Ei background, indicating regulation by a limited number of nuclear-encoded genes [235, 240]. F2 (BALB/NZB heteroplasmic x Cast/Ei) animals of intercrosses between the BALB/NZB heteroplasmic mice and Cast/Ei mice (see section 4.2.6 details of the cross) can be sorted into two groups: animals where selective mtDNA segregation is lost ((-) selection group) and animals where selective mtDNA segregation occurs ((+) selection group). At the age of one year, six percent of the animals exhibited no selection against the NZB genome. A genome wide linkage analysis was performed in one-year-old F2 (BALB/NZB heteroplasmic x Cast/Ei) animals a single statistically significant locus on chromosome 6 was identified. This locus is within the previously mapped nuclear regulator of mtDNA segregation in the spleen, Smdq-3 [240], but this new linkage analysis narrowed down the size of the locus to 11 megabases. This locus contained six genes with putative mitochondrial roles (Table 4). Sequencing of the full-length mRNA of these six genes revealed a major splicing difference in Gimap3 (detailed in section 5.1.2). Moreover, Gimap3 and Gimap5 were the only genes in the group with expression restricted to hematopoietic tissues. Therefore we hypothesized that Gimap3 affects mtDNA segregation in the spleen and prioritized this gene for further investigation.

Results

54

Table 4 Genes within the locus identified by linkage analysis with putative roles in mitochondrial biology.

Gene Function Adck2 Kinase of unknown function Ndufb2 Respiratory chain complex 1 subunit Mrps33 Mitochondrial ribosome protein Gstk1 Protein disulfide oxidoreductase Gimap5 Immune related GTPase Gimap3 Immune related GTPase

5.1.2 A splicing defect in the Cast/Ei Gimap3 allele In both M. m. domesticus and M. m. castaneus the Gimap3 gene consists of five exons. The mRNA from the allele present in Balb/c and other M. m. domesticus laboratory mouse strains, denoted from here onwards as Balb Gimap3, contains all of the five exons and two AUG sites for the initiation of translation. The first AUG site is located in exon 3, and the second in exon 4. The second start site in exon 4 is also preceded by a stop codon, and the mature Gimap3 is a polypeptide produced by translation utilizing the second AUG site in exon 4 with a predicted size of 31 kDa (Figure 9). In contrast, in Cast/Ei mice a G to A transition in the splice acceptor site of exon 4 is present and exon 4 is absent from the mature mRNA (Figure 9). This allele is referred to as Cast Gimap3. The mature Cast Gimap3 protein is translated from the alternative AUG site in exon 3, and produces a polypeptide with a predicted size of 41 kDa. The two variants, Balb and Cast Gimap3, are identical within all of the conserved protein domains of Gimap3, but the Cast Gimap3 has an extra 58 amino acids in the N-terminus of the protein (Figure 9).

55

Figure 9 Schematic presentation of the exons of the Gimap3 gene, mRNA and protein structure in Balb/c and Cast/Ei mice. The coding sequence and the differentiating feature between the subspecies, exon 4, are color coded. Black arrows above the exons indicate translation start sites. Conserved domains in the protein are color coded and indicated above (P-loop=GTPase domain CB= conserved box, CC=coiled coil, TM=transmembrane). The location of the extra amino acids present in the Cast Gimap3 protein is colored by orange.

To test whether the Cast Gimap3 allele is enriched within the group of F2 (BALB/NZB heteroplasmic x Cast/Ei) animals where the selective mtDNA segregation is lost we investigated the allele distribution of Gimap3 between the (+) selection group and (-) selection group (defined in section 2.4.3). The genotype distributions between the groups were significantly different from those predicted by Mendelian ratios (p<0.01, χ2 –test), with enrichment of the Cast Gimap3 allele in (-) selection group.

5.1.3 Generation of Cast Gimap3 transgenic mice To experimentally study the role of Gimap3 in mtDNA selection, a transgenic model expressing the Cast Gimap3 allele on a Balb/c nuclear background was generated. The cDNA of the Cast Gimap3 coding sequence driven off the ubiquitous promoter ROSA26 [278, 279] was microinjected into embryos and gave rise to seven chimeric founder lines. Of the seven only four transmitted the transgene to their offspring, and this transmission did not differ from expected Mendelian ratios as determined by χ2 –square test.

The transgene expression in these lines was assessed by reverse transcriptase PCR. A primer set amplifying a region spanning over exon 4, which is missing in the Cast Gimap3 mRNA, allows detection of mRNA from both Gimap3 alleles simultaneously as they produce PCR products that differ in size by 35 base pairs. One of the founder lines was found to exhibit reproducible and robust expression of the transgenic Cast Gimap3 allele in a variety of tissues (Figure 10). This line was selected for further experiments, and is referred to as the Cast Gimap3 transgenic strain. The endogenous Balb Gimap3 allele was detected in the spleen sample of the Cast Gimap3 transgenic strain as well as in the parental strain, but was absent from other tissues investigated consistent with previous reports [248].

Results

56

Figure 10 Expression of Balb and Cast Gimap3 alleles by RT-PCR. S=spleen, H=heart, B=brain and L=lung.

5.1.4 Transgenic expression of Cast Gimap3 modifies mtDNA selection in the spleen

To test the role of Cast Gimap3 in mtDNA selection, we crossed the Cast Gimap3 transgenic mice with the BALB/NZB heteroplasmic mouse model, and analyzed the tissue distribution of heteroplasmy in the F2 (BALB/NZB heteroplasmic x Cast Gimap3) generation (see section 4.2.6 for details of the cross). Tissues were collected at the age of three months, where normally the relative level of the NZB genome approaches 50% of the initial heteroplasmy level. We analyzed the level of reduction in the relative level of the NZB genome by comparing the percentage of NZB genome in the spleen to the percentage in tissues with neutral mtDNA segregation, where the heteroplasmy level does not change with age. In such analysis a value of 1.0 would indicate that the relative level of the NZB genome has not changed, whereas 0.0 would indicate that the NZB genome had been selected away completely. We observed that the relative level of NZB decreased significantly less in the spleen of transgenic animals expressing the Cast Gimap3 than in the transgene negative litter mate controls, or in the BALB/NZB heteroplasmic mouse model under pure Balb/c nuclear background (ANOVA p<0.01). The transgene negative F2 (BALB/NZB heteroplasmic x Cast Gimap3) animals were indistinguishable from the animals on the pure Balb/c background, showing that the observed difference was not due to mixed nuclear background (Figure 11).

57

Figure 11 The proportion of the NZB mtDNA variant in the spleen relative to the neutral tissues in the BALB/NZB heteroplasmic animals on pure Balb/c nuclear background (Balb/c, n=23) and in F2 animals either negative (F2 Tg neg, n=16) or positive (F2 Tg pos, n=17) for the Cast Gimap3 transgene. The line indicates the mean.

To examine whether expression of Cast Gimap3 affects the mtDNA selection phenotypes seen in other tissues we examined the heteroplasmy level in the liver and kidney of transgenic positive and negative animals. The mtDNA selection in these tissues is best modeled with a relative fitness value, which estimates the selective advantage of the NZB genome [234]. Expression of Cast Gimap3 did not cause any statistically significant differences in the relative fitness of the NZB genome in either liver or kidney (Figure 12). Therefore Gimap3 is a tissue-specific genetic modulator of mtDNA selection in the hematopoietic tissues.

Figure 12 Relative fitness of the NZB genome in liver and kidney. The data is presented as means with standard deviations, n=16 for transgenic negative and n=17 for the transgenic positive groups.

Results

58

5.1.5 Gimap3 does not affect mtDNA copy number We next analyzed whether the modulatory effect of Gimap3 on mtDNA selection in the spleen was due to changes in mtDNA copy number. First we measured mtDNA quantity relative to nuclear DNA by qPCR in F2 (BALB/NZB heteroplasmic x Cast/Ei) groups of (+) selection and (-) selection. There was no difference in the mean relative mtDNA copy number or in variance between these groups (Figure 13). Then we analyzed whether the expression Cast Gimap3 affects copy number, but there was no difference in the relative mtDNA quantity between the transgenic negative and positive litter mates (Figure 13, unpublished). Taken together, these data show that while Gimap3 modulates the mtDNA selection in the spleen, it does not affect mtDNA copy number at steady state.

Figure 13 Relative mtDNA quantity determined by qPCR. In the left panel data from F2 (BALB/NZB heteroplasmic X Cast/Ei) crosses, n=32 in the selection group and n=13 in the no selection group. In the right panel data from F2 (BALB/NZB heteroplasmic x Cast Gimap3) transgenics, n=7 in the Tg neg and n=12 in the Tg pos groups. Data is presented as means with standard deviations.

5.2 Molecular studies of Gimap3 reveal complex expression regulation and a novel subcellular localization (I and II)

5.2.1 Cast and Balb Gimap3 are differentially expressed in mice (I and II)

To gain insight into how Gimap3 might be affecting the tissue-specific mtDNA selection in mice, we investigated the gene expression of the two alleles, Balb and Cast Gimap3. MRNA from both alleles can be detected by RT-PCR in the spleen of Balb/c and Cast/Ei animals, respectively (Figure 10), but to definitely test the expression of mRNA originating from Gimap3

59

in the different subspecies we performed northern blotting with total RNA samples isolated from the spleen of Balb/c and Cast/Ei animals. Cell line controls stably expressing the coding sequence of Balb Gimap3 and the highly similar paralog, Gimap5, were included to control for probe specificity. We used three independent probes for Gimap3 and detected robust mRNA expression from both alleles with probes a and b (Figure 14). Probe c binds to the junction of exon 4 and exon 5 so only half of the probe sequence is present in the Cast Gimap3 mRNA. Correspondingly, stronger expression with this probe was detected from the Balb allele (Figure 14). In both subspecies, there appears to be three separate transcripts, the significance of which is at present unknown.

Figure 14 RNA level expression of Balb and Cast Gimap3. On the left, northern blotting with Gimap3 probes a-c and control probe against Atp5B are shown, along with the ethidium bromide stained gel. On the right the location of the Gimap3 probes is illustrated above the Balb and Cast Gimap3 mRNA. The coding sequence is highlighted in purple and the locations of probes a – c are indicated above the graphic. The number of the exon is indicated below the graphic.

We next analyzed the protein level expression from the two alleles using polyclonal antibodies raised against allele specific peptides in rabbit. Both Balb and Cast Gimap3 can be expressed in cultured cells via retroviral transduction, and the protein detected with our antibodies. As a control for the antibodies we included a cell line expressing both variants simultaneously (Figure 15). To our surprise, we could not detect Cast Gimap3 protein in the spleen of Cast/Ei mice, or in the F2 (BALB/NZB heteroplasmic x Cast/Ei) crosses heterozygous for the locus (Figure 15). In contrast, the Balb Gimap3 protein was expressed in Balb/c animals and detected in the F2

Results

60

(BALB/NZB heteroplasmic x Cast/Ei) animals, albeit in reduced quantity to the parental strains (Figure 15). Based on these results the mature Gimap3 protein in mice is only produced from the Balb Gimap3 allele. Furthermore there appears to be a gene dosage effect on the protein abundance, as F2 (BALB/NZB heteroplasmic x Cast/Ei) animals heterozygous for the Gimap3 allele exhibited reduced protein quantity by comparison to the parental Balb/c strain.

Figure 15 Western blotting with indicated antibodies of protein samples isolated from the spleen of Cast/Ei, Balb/c and F2 (BALB/NZB heteroplasmic x Cast/Ei) mice. Atg5-Atg12 and Tom40 antibodies were used as loading controls. BXC stands for BALB/NZB heteroplasmic x Cast/Ei. The control NIH3T3 cell line expresses epitope tagged versions of both Balb and Cast Gimap3 proteins ectopically.

5.2.2 A potential role for an upstream open reading frame in the regulation Gimap3 translation (II)

The Balb Gimap3 gene contains an upstream open reading frame (uORF) sequence, which in the Cast Gimap3 variant is a part of the coding sequence and codes for a amino acid sequence in the N-terminus of the Cast Gimap3 protein (referred to as the CAST(1-68) fragment). This fragment is not present in the Balb Gimap3 protein. Translation from the upstream open reading frame can act as a post-transcriptional regulator of expression [280, 281]. To investigate whether translation regulation mediated by the Balb Gimap3 uORF underlies the differential expression of the Balb and Cast Gimap3 allele observed in mice, we analyzed the translation of the two alleles and a marker protein YFP with or without the presence of the CAST(1-68) fragment fragment with an in vitro translation assay (Figure 16). The constructs used in this analysis are listed in Table 5. The CAST(1-68) fragment (B) could not be detected on its own, and incorporation of this fragment to YFP (A) reduced

61

translation by comparison to YFP alone (E). Reduced translation was also observed from the Cast Gimap3 allele (D) by comparison to the Balb Gimap3 allele (C), confirming that the sequence encoding for the CAST(1-68) fragment can repress translation in vitro when incorporated into the coding sequence.

Table 5 Constructs used in in vitro translation analysis.

A CAST(1-68) fragment + YFP B CAST(1-68) fragment C Balb Gimap3 CDS D Cast Gimap3 CDS E YFP

Figure 16 Analysis of in vitro translation of the CAST(1-68) fragment fused to YFP (A), the CAST(1-68) fragment alone (B), the Balb Gimap3 coding sequence (C), the Cast Gimap3 coding sequence (D) and YFP (E). The signal intensity was quantified for construct A relative to construct E, and construct D relative to construct C.

Results

62

In the in vitro analysis of the YFP fused with the CAST(1-68) fragment, most of the protein co-migrated at the molecular weight of the full construct but weaker bands of smaller size were observed. One of these corresponded in size with YFP. To further investigate this observation we expressed the same constructs in cultured cells, and observed that the majority of the protein detected with the YFP antibody corresponded to the size of YFP, whereas only a small fraction was detectable by overexposure to the full length construct. This difference between the in vitro translation and in vivo suggests that a more complex regulation with additional factors takes place in living cells.

A stalled ribosome can cause translational repression, and is one of the mechanisms underlying regulation of translation by uORFs [280, 281]. Stalled ribosomes activate cellular pathways that lead to the degradation of the polypeptide on the stalled ribosome by the proteasome (reviewed in [282]). Three lines of evidence show that ribosome stalling occurs at sequence encoding for the CAST(1-68) fragment. First, the smearing observed in the in vitro translation of YFP with the CAST(1-68) fragment (Figure 16), could be indicative of stalled ribosomes. Second, accumulation of smaller molecular weight peptides was detected in cells expressing the YFP with the CAST(1-68) fragment in the presence of a proteasomal inhibitor. Last, proteasomal inhibition increased the association of the CAST(1-68) fragment containing YFP with the assembled ribosome, indicating that the CAST(1-68) fragment can induce proteasome dependent degradation when on the ribosome (for details of the experiments with proteasomal inhibition, see publication II).

These data show that the Balb Gimap3 uORF sequence, when incorporated to the coding sequence in Cast Gimap3, is capable of repressing translation, which can explain the lack of mature protein in Cast/Ei mice. This phenotype is detectable in vitro and further modified in vivo, indicating the involvement of multiple factors. Upstream open reading frames are common in mammalian mRNAs, and have been previously described for proteins involved in immune response [280, 283]. Such a regulatory mechanism facilitates rapid responses in protein expression level, and therefore it is possible that Gimap3 in vivo responds to immunological signals. Yet based on our data that Cast/Ei mice lack almost any detectable Gimap3 protein at the steady state level, it appears to be dispensable under conditions where the immune system is not challenged. These results are consistent with the recently published Gimap3 knock-out mouse that has no phenotype under normal conditions, demonstrating that Gimap3 is not essential for life or embryonic development [275].

63

5.2.3 The expression level of Gimap3 associates with the mtDNA selection phenotype (II)

To analyze whether the expression level differences we uncovered correlate with the mtDNA selection phenotype in the mice, we analyzed the relative mRNA expression level from each allele in F2 (BALB/NZB heteroplasmic x Cast/Ei) groups of (+) selection and (-) selection, where Gimap3 was originally identified as a candidate gene by linkage analysis. We used semi-quantitative RT-PCR and observed a significantly stronger relative expression from the Balb Gimap3 allele in the (+) selection group of mice than in the (-) selection group. As the mature protein is only produced from the Balb Gimap3 mRNA it is likely that it is the abundance of mature Balb Gimap3 protein is a critical factor affecting the mtDNA selection phenotype.

Transgenic expression of the Cast Gimap3 coding sequence in the BALB/NZB heteroplasmic mouse model reduced the rate of mtDNA segregation in the spleen (Figure 11). How this effect was mediated is unclear, given that no mature protein produced from this template is detected in vivo in mice. It is possible that transgenic expression of Cast Gimap3 mRNA affects the abundance of endogenous Balb Gimap3 mRNA through some feedback regulation, and thus affects mtDNA segregation through the abundance of Balb Gimap3. However, the abundance of Balb Gimap3 mRNA was not quantitatively examined.

5.2.4 Gimap3 is a resident endoplasmic reticulum protein (II) A single report placed Gimap3 on the outer mitochondrial membrane [256], which was one of the criteria that helped to establish Gimap3 as the preferred candidate gene in modifying mtDNA segregation. However, we were unable to validate the mitochondrial localization of Gimap3 in our experiments and therefore we investigated the subcellular localization of Gimap3 in more detail. To analyze the localization of the endogenous Gimap3, we separated total protein samples isolated from the spleen of Balb/c animals on a histodenz gradient to determine with which markers of subcellular compartments Gimap3 co-sediments. Surprisingly, we consistently observed cosedimentation of Gimap3 with markers for the ER, while no co-sedimentation was observed with either the outer mitochondrial membrane protein Porin, or the matrix protein Sdha.

To further study the localization of Gimap3, we visualized Gimap3 distribution in cultured cells with fluorescent light microscopy. Unfortunately our polyclonal Gimap3 antibody is ineffective in indirect immunofluorescent detection by light microscopy. Therefore cultured cells were cotransfected with Gimap3 tagged N-terminally with RFP and GFP- tagged markers for the ER and mitochondria, respectively, to visualize subcellular localization of this protein. We consistently observed colocalization of Gimap3 with the ER marker Sec61β. No colocalization with Omp25, a bona fide mitochondrial marker [284], was observed (Figure 17).

Results

64

Figure 17 Confocal micrographs of COS7 fibroblast cells cotransfected with the indicated constructs. The scale bar indicates 10 μm.

Ideally, fluorescent microscopy showing subcellular colocalization would be achieved with endogenous expression and with no tags. Unfortunately our polyclonal Gimap3 antibody is ineffective in fluorescent microscopy. Moreover, epitope tagged (HA and C-myc) versions of Gimap3 were also ineffective in immunofluorescence suggesting that the epitope might be inaccessible to antibodies (unpublished data). The localization of tail-anchored membrane proteins has been shown to be dependent only on the transmembrane domain and flanking sequences (reviewed in [285]). For Gimap3, these sequences reside in C -terminus, so an amino-terminal RFP- tag did not affect correct localization. We were also able to show that the C-terminal domain alone yielded similar subcellular distribution as the full-length Gimap3, and replacing C-terminal sequence of Gimap3 with C-terminal sequence of the mitochondrial marker Omp25 relocalizes the protein to mitochondria. Taken together, the sedimentation profile of endogenous Gimap3 and fluorescent imaging conclusively show that Gimap3 localizes to endoplasmic reticulum.

65

5.3 Involvement of Gimap5 in tissue-specific mtDNA segregation (II)

5.3.1 Heterozygous loss of Gimap5 modulates mtDNA segregation The initial linkage analysis that led to the cloning of Gimap3 as modifier of tissue-specific mtDNA segregation, could not distinguish between Gimap3 and Gimap5 as these genes are in linkage. Although we have established a role for Gimap3 in modifying mtDNA segregation in the hematopoietic compartment, we also investigated a potential role for Gimap5.

We took advantage of a germ line genetic knock-out mouse for Gimap5, Gimap5tm1Wlr, referred here to as Gimap5 KO [273]. The homozygous Gimap5 KO animals exhibit severe dysregulation of all of the hematopoietic lineages, with red blood cells, T cells and NK cells being the most severely affected. The genetic ablation does not affect the expression of other Gimap genes on the RNA level. Animals heterozygous for the Gimap5 KO allele, do not share any of the pathogenic phenotypes, but exhibit 50% decrease in the abundance of Gimap5 mRNA and/or protein – a gene dosage effect that is consistent between all of the three Gimap5 null mice reported [273-275]. We crossed the BALB/NZB heteroplasmic mice with the Gimap5 KO strain to generate heteroplasmic mice carrying the Gimap5 KO allele. Both strains were on a Balb/c nuclear background. We then analyzed the tissue specific segregation in the heterozygous and wild type litter mates, but the homozygous Gimap5 KO animals were excluded from this analysis due to potential confounding factors produced by the extensive hematological pathologies and differences in leukocyte numbers present in these mice. We observed that the relative proportion of NZB decreased significantly less in the bone marrow (p<0.01, two-tailed t-test) and spleen (p<0.05, two-tailed t-test) of the heterozygous Gimap5 KO animals by comparison wild type controls (Figure 18). The variance between the groups was not significantly different in either tissue. This effect was specific to the hematopoietic tissues, as no significant difference in the mtDNA selection phenotype measured as relative fitness of the NZB genome in the liver was observed between the Gimap5 KO wild type (mean = 1.08721, standard deviation = 0.024, n = 17) and heterozygous (mean = 1.09749, standard deviation = 0.040, n = 17) animals.

Results

66

Figure 18 MtDNA segregation in the bone marrow and spleen of Gimap5 KO heterozygous and wild type mice. In the left panel, n=18 for both groups. In the right panel for the spleen, n=18 for the Gimap5 WT and n=20 for the Gimap5 HET group. A line indicates the mean of each data set.

5.3.2 The abundance of Gimap3 and factors involved in actin cytoskeleton biology are dependent on Gimap5

Gimap3 can modulate mtDNA segregation, and therefore we investigated whether the loss of Gimap5 affects the expression of Gimap3. We analyzed the expression of Gimap3 (which in these mice is the Balb Gimap3 variant) in the heterozygous Gimap5 KO animals. We detected similar mRNA level expression of Gimap3 in both the Gimap5 WT and Gimap5 HET animals by northern blotting from total spleen RNA. In contrast, the protein level as determined by Western blotting was surprisingly reduced by approximately 50% (Figure 19).

67

Figure 19 Expression of Gimap3 in Gimap5 KO heterozygous and wild type animals. Panel A shows a representative northern blotting and quantification with probes against Gimap3 and Atp5B, and the ethidium bromide stained gel. In panel B, a representative western blot and quantification from splenic leukocytes is shown. In both panels, quantification results were standardized against a wild type value.

To identify other factors affected by the heterozygous loss of Gimap5, we performed quantitative mass-spec (LC-MS/MS) analysis of the proteins isolated from the spleen. We isolated protein from homogenized spleens from three pairs Gimap5 KO wild type and heterozygous litter mates, which were used as three biological replicates for analysis by iTRAQ (isobaric tags for relative and absolute quantitation) mass spectrometry. In iTRAQ, the peptides of each sample are labeled with a distinct chemical tag that allows for relative quantitation of the peptides between the two samples (Gimap5 KO heterozygous versus wild type) after identification of peptides by mass-spec. Five proteins exhibited robust changes in abundance in the Gimap5 het animals (Table 6). Surprisingly, all of these proteins were involved in the regulation of actin cytoskeleton and cell motility (data retrieved from UniprotKB).

Results

68

Table 6 Factors with quantitative changes in abundance iTRAQ analysis between Gimap5 wild type and heterozygote animals.

Protein Gene Fold

change het/wt

Biological process

Cyfip2 Cytoplasmic FMR1 interacting protein 2

0.55 Component of WAVE complex for assembly of F-actin complex

Arhgdia Rho GDP dissociation inhibitor (GDI) alpha

0.57 Rho protein signal transduction, regulation of protein localization

Vasp Vasodilator-stimulated phosphoprotein

0.57 Actin cytoskeleton reorganization

Elmo1 Engulfment and cell motility 1

1.83 Actin filament-based process, phagocytosis

S100A9 S100 calcium binding protein A9

2.12 Actin cytoskeleton reorganization, leukocyte chemotaxis, phagocytosis

5.4 A role for mitochondrial fission in tissue-specific mtDNA segregation (III)

The morphology and distribution of the mitochondrial network have the potential to affect mtDNA segregation in many ways, for example through mediating distribution to daughter cells at cell division or affecting organelle turnover. This question has previously only been investigated in a single study in cybrid cells [286], but problems in using cybrid cell models to study mtDNA segregation are outlined in section 2.4. To investigate this question in an animal model we manipulated mitochondrial fission in the BALB/NZB heteroplasmic mouse model by crossing it with a mouse model expressing a dominant-negative mutation in Dnm1l, the master regulator of fission. This mutation changes a conserved cysteine residue at amino acid position 452 in the middle domain of Dnm1l to phenylalanine. The allele is named the Python (Py) mutation. The Python mutation causes the mitochondrial network to adopt a hyperfused network (Figure 20, [276]), and the Dnm1lPy/Wt mice manifest with adult-onset dilated cardiomyopathy that eventually leads to congestive heart failure [276].

69

Figure 20 Visualization of mitochondrial network morphology. Representative confocal micrographs of mouse embryonic fibroblasts stained with an antibody against the mitochondrial protein Sdha derived from a Python mouse (right panel) and wild type control (left panel). The scale bar is 20 μm.

5.4.1 A defect in fission does not affect transmission heteroplasmy in the female germ line

In the BALB/NZB heteroplasmic mouse model the transmission of the heteroplasmic mtDNA variants is random [149], and the segregation of the variants in the female germ line follows neutral genetic drift, that is best modeled with a modified Kimura distribution [202]. Due to the mitochondrial DNA genetic bottle neck (described in sections 2.2.2 and 2.4.1) a range of heteroplasmy levels centering on the mothers heteroplasmy level is seen in the offspring [107, 202, 230]. We analyzed the heteroplasmy levels from ear punches of N2 offspring of F1 heteroplasmic Python mothers (see section 4.2.6 for details of the cross), and observed no differences in the range or mean heteroplasmy level of the offspring by comparison to wild type litter mate control mothers (Table 7).

Results

70

Table 7 The mean and distribution of heteroplasmy in the offspring of F1 heteroplasmic Dnm1lPy/Wt and Dnm1Wt/Wt females. For the modified Kimura distribution analysis, Sidak’s adjustment for multiple testing was used to determine significance (α=0.0073).

To test the data against the Kimura distribution we grouped together

mothers with similar heteroplasmy levels as this analysis requires high n numbers to be effective. The heteroplasmy distribution of the offspring from mothers of both genotypes fit the predictions of the modified Kimura distribution, as indicated by the insignificant p-values (Table 7, Figure 21).

Mothers Offspring Kimura

Genotype %NZB Mean %NZB Range %NZB n p n

Wt/Wt 16 17 7 - 31 34 0.910 34

Wt/Wt 34 31 9 - 51 37

0.012 100 Wt/Wt 34 37 12 - 62 30

Wt/Wt 36 31 16 - 47 33

Py/Wt 21 24 4 - 55 28 0.178 28

Py/Wt 29 32 10 - 53 12

0.124 54 Py/Wt 30 31 9 - 51 28

Py/Wt 36 41 24 - 61 14

Py/Wt 41 40 21 - 60 13

0.052 46 Py/Wt 44 41 32 - 56 13

Py/Wt 48 50 27 - 74 20

71

Figure 21 Example of the Kimura distribution analysis. The grey bars represent the distribution of the actual heteroplasmy levels observed in the offspring, and the black line the Kimura prediction. In these panels, data from three females of either wild type (left panel) or Dnm1lPy/Wt (right panel) mothers were grouped together, as shown in table 7. The average heteroplasmy level of the mother and number of pups in the analysis is indicated.

5.4.2 The effect of defective fission on somatic mtDNA segregation To analyze the effect of the Python mutation on somatic mtDNA segregation in tissues, we analyzed the heteroplasmy level across tissues in N2 generation produced by crossing the F1 heteroplasmic Dnm1lPy/Wt females to Balb/c males.

In the BALB/NZB mouse model the segregation of the mtDNA variants during embryogenesis is neutral and the heteroplasmy level across tissues at birth is similar [238]. In most tissues post-natal mtDNA segregation is also neutral, the only exceptions being the well described selection phenotypes that occur in the liver, kidney and hematopoietic tissues [234, 235, 238]. Although genetic drift may have occurred in individual cells of tissues with neutral mtDNA segregation, the heteroplasmy level as measured from bulk tissue is stable with age and remains similar between tissues.

To investigate whether neutral mtDNA segregation is affected by the Python mutation, we compared the heteroplasmy levels between five tissues where mtDNA segregation is neutral: brain, skeletal muscle, heart, small intestine and skin. We performed pairwise regression analysis of the tissues using the brain as tissue of reference. In such analysis, a line through the origin with a slope of 1 indicates that the values between the tissues are identical, and deviations from the slope of 1 signify a shift in the heteroplasmy levels between the tissues. We determined the best fit slope values with non-linear regression analysis and observed no major deviation from a slope of 1 for either the wild type litter mate controls or the Dnm1lPy/Wt animals for any of the tissues (Table 8, Figure 22). Non-linear line fit was selected over linear regression to allow for analysis of goodness-of-fit through the r2 value. When similar analysis is performed for the spleen or liver, where mtDNA selection occurs, the best fit slope deviates from 1. A

Results

72

runs test of the residuals was performed to analyze whether the fitted line significantly deviates from the data, and was insignificant in all cases.

Figure 22 Representatives of regression analysis of tissues with neutral mtDNA segregation. Data presented for the skeletal muscle (left panel) and skin (right panel) as examples. A line with a slope of 1 going through the origin is indicated with a black line.

Table 8 Regression analysis of tissue heteroplasmy in N2 heteroplasmic Dnm1lPy/Wt

animals and wild type controls.

Brain to Dnm1lWt/Wt Dnm1lPy/Wt

Slope r2 n Slope r2 n Heart 0.95 0.95 18 0.95 0.94 15 Muscle 0.97 0.90 18 1.00 0.76 14 Small intestine 1.07 0.90 16 1.05 0.87 15

Skin 0.99 0.94 11 1.04 0.91 14 Spleen 0.73 0.88 16 0.63 0.70 15 Liver 1.29 0.87 16 1.30 0.67 16

Based on these results, mitochondrial hyperfusion caused by the Python

mutation does not affect neutral post-natal mtDNA segregation. We did not directly investigate mtDNA segregation during embryogenesis in this study, but the tissues from all three germ layers are included in this analysis: brain and skin from the ectoderm, muscle and heart from the mesoderm and small intestine from the endoderm. Therefore it is unlikely, that the Python mutation caused any significant changes in the random mtDNA segregation during intrauterine development.

73

5.4.2.1 A defect in mitochondrial fission modulates mtDNA segregation in the spleen

We next analyzed whether expression of the dominant-negative Python mutation affects the mtDNA selection phenotypes in the spleen and liver.

To analyze the effect on mtDNA selection in the spleen we calculated the relative amount of NZB genome left in this tissue by comparing the heteroplasmy level in the spleen to the heteroplasmy level in neutral tissues. In the Dnm1lPy/Wt animals the relative amount of the NZB genome in the spleen was smaller than in wild type controls (Figure 23). This difference was statistically significant (p<0.01, two-tailed t -test). The variation within the groups did not differ significantly, and the degree of change in the relative amount of NZB in the spleen did not correlate with changes in the mtDNA copy number as measured by Southern blotting (Figure 23).

Figure 23 MtDNA segregation and quantity in the spleen of Dnm1lPy mice. In the left panel, the proportion of NZB genome left in the spleen at the age of 85 days is shown (n=16 in both groups). Means are indicated. The right panel shows relative mtDNA quantity in relation to proportion of NZB left observed in the left panel.

A dominant-negative mutation in Dnm1l could affect white blood cell development, and therefore the observed difference in mtDNA selection could reflect the presence of abnormal leukocyte numbers or aberrant ratios of blood cell lineages in these mice. To test this we measured basic blood parameters from the Dnm1lPy/Wt animals and wild type controls. No significant differences were observed in the amounts of major lymphoid and myeloid lineages in these mice (Table 9).

Results

74

Table 9 Blood parameters from N2 heteroplasmic Dnm1lPy/Wt mice (n=5) and wild type litter mate controls (n=8). Data is presented as means with standard error of the mean.

Parameter Dnm1lWt/Wt Dnm1lPy/Wt Unit

White blood cell count 8.4 ± 1.4 9.3 ± 1.9 10E09 cells/L

Lymphocytes 69 ± 5.1 74 ± 2.0 %

Granulocytes 27.7 ± 5.1 20.0 ± 2.6 %

Monocytes 1.4 ± 0.1 1.4 ± 0.4 %

Red blood cell count 10.7 ± 0.1 10.8 ± 0.1 10E06 cells/μL

Hemoglobin 158 ± 2.1 157 ± 3.1 g/L

Hematocrit 56 ± 1.2 55 ± 1.0 %

Mean corpuscular volume 53 ± 1.0 51 ± 0.7 fL

To investigate if the Python mutation affected the mtDNA selection in the

liver, we calculated the relative fitness value of the NZB genome in this tissue. There was no significant difference in the relative fitness of the NZB genome in the liver between the Dnm1lPy/Wt animals (mean = 1.080, standard deviation = 0.0273, n = 12) and wild type controls (mean = 1.072, standard deviation = 0.0212, n = 16), showing that the defect in fission did not affect the selective mtDNA segregation in this tissue.

In conclusion, manipulation of mitochondrial morphology through a defect in fission affects the selective mtDNA segregation phenotype in the spleen, but does not affect mtDNA selection in the liver or the neutral mtDNA segregation other tissues and in the female germ line.

75

6 Discussion

6.1 The role of Gimap3 and Gimap5 in mtDNA selection in leukocytes (I,II)

When this thesis was initiated little was known about the function of Gimap3 and Gimap5, or the function of the whole Gimap protein family. A role in apoptosis for Gimap3 and Gimap5 had been proposed based on three factors. First, loss of these proteins resulted in impaired survival of T cells in fetal thymocyte cultures, and overexpression of Gimap5 protected cultured cells from specific cell death inducers [248, 252]. Moreover, loss of Gimap5 resulted in T cell lymphopenia in rats [253, 254, 268, 269]. Second, they both have been reported to localize to mitochondria, and the role of mitochondria in apoptosis is well established. Third, Gimap3 and Gimap5 were reported to co-immunoprecipitate with various members of the Bcl-2 family of apoptosis regulators. An interaction with the anti-apoptotic Bcl-2 and Bcl-Xl as well as the proapoptotic members Bax, Bak, Bad and BimEL was detected in fetal thymocyte cultures [248] and for Gimap5 these results were replicated for Bcl-2 and Bcl-Xl but not for Bad and Bax in a pre B cell line. An additional interaction partner Mcl-1, another antiapoptotic member of the Bcl2-family, was detected in the pre B cell line [264].

The mitochondrial localization has turned out be inaccurate for both Gimap3 and Gimap5. Our work has placed Gimap3 in the endoplasmic reticulum and others have shown that Gimap5 is lysosomal protein [259]. While mitochondrial localization helped to form the hypothesis of apoptosis regulators, these subcellular localizations would still permit for a role in apoptosis as both ER and lysosomes are involved in the apoptotic signaling together with mitochondria (Reviewed in [51] and [287], respectively). However, our work has shown that the Cast/Ei mice are deficient for functional Gimap3 protein at the steady state level and yet they exhibit no hematological abnormality. Similarly, a genetic knock-out of Gimap3 does not cause any pathology in the hematopoietic lineages during normal development [275]. Therefore it seems unlikely that Gimap3 would be a major regulator of apoptosis, which is an integral part of lymphoid and myeloid cell development (reviewed in [288] and [289], respectively). For Gimap5, the situation is more complex, as loss of Gimap5 unarguably generates a critical cell survival and developmental defect in the hematopoietic compartment of mice, corroborating the results seen in Gimap5 deficient rats [264, 273, 274].

During the completion of this thesis important research on the Gimap proteins uncovered increasing evidence for cellular functions other than apoptosis, indicating that these proteins may be involved in several cellular processes. Based on structural homology and analysis of properties of

Discussion

76

membrane-bound Gimap proteins it was proposed that Gimaps could have functions similar to the Septin family of scaffold proteins [260, 261]. Septins are involved in intracellular transport, cell migration and cell division (reviewed in [290]). In 2012, a small interfering RNA (siRNA) screen revealed that GIMAP2 and GIMAP6 knock down interferes with cargo delivery from the ER to the plasma membrane [291]. The following year GIMAP6 was implicated in macroautophagy, and the abundance of GABARAPL2 (the mammalian homologue of the yeast autophagy protein Atg8) was shown to be dependent on GIMAP6 [292]. Furthermore, the soluble GIMAP4 was shown to colocalize with both the tubulin and actin components of the cytoskeleton, and to regulate cytokine secretion in T cells [293]. Based on these findings, a role for Gimaps in the regulation and organization of intracellular trafficking seems likely. Our findings that Gimap3 localizes to the endoplasmic reticulum and that the abundance of factors involved in actin cytoskeleton regulation are dependent on Gimap5 are consistent with such a role.

In this thesis, we report genetic evidence that both Gimap3 and Gimap5 modify mtDNA segregation in mouse leukocytes, and that their modifying effect is dependent on the abundance of these proteins. Moreover we found that the abundance of the ER protein Gimap3 is dependent on Gimap5 in the lysosomes, although the basis for this dependence is unknown. These results indicate that Gimap3 and Gimap5 may function in the same cellular pathway. In corroboration, recent paper suggested possible co-operation for Gimap3 and Gimap5 in leukocyte development [275]. In this paper another germ line knock-out for Gimap5 reported. The phenotype of this Gimap5 KO mouse is very mild by comparison to the Gimap5 KO used in this thesis or a Gimap5 null mouse produced by mutagenesis [273, 274], although the reasons for this are not clear. However, this group also reported that simultaneous genetic ablation of both Gimap5 and Gimap3 resulted in a severe phenotype similar to the two other Gimap5 null mouse strains.

Intracellular trafficking of vesicles is of integral importance for immune functions such as cytokine secretion, phagocytosis, signaling via receptors of the innate immune system, antigen presentation and removal of intracellular pathogens via autophagy (reviewed in [294]). Furthermore, dynamic trafficking of mitochondria is also important for the function of leukocytes during cell migration and signaling at the immunological synapse [49, 50]. Leukocytes are a very specialized cell type with a distinct morphological feature of small cytosolic volume. These cells also constantly migrate throughout the body, and move to sites of infection through chemotaxis, a process that requires drastic and dynamic changes in cell morphology. Therefore, it may especially important to regulate the organization of subcellular organelles in this cell type. It is tempting to hypothesize that Gimap3 and Gimap5 would be involved in such regulation, which in turn is important for mtDNA segregation in leukocytes. Such a role could also include their reported interactions with the Bcl-2 family members. While the

77

Bcl-2 protein family members are best known as regulators of apoptosis, they are involved in other cellular processes as well. For example Bax and Bad have been shown to be involved in the regulation of mitochondrial morphology independent of their role in apoptosis [295, 296]. Furthermore Bcl-2 mediated cell death signaling overlaps with the cellular pathway for macroautophagy through Beclin-1 (reviewed in [297]).

6.2 The effect of mitochondrial morphology on mtDNA selection and the segregating unit (III)

Selection processes that affect mtDNA segregation could occurred on several different levels: the mtDNA itself, the organelle or the cell. As the molecular mechanisms that mediate mtDNA selection remain elusive, the level of selection is at present unknown. However, some inferences can be made based on our findings with the Python mouse where mitochondrial morphology is hyperfused due to a defect in Dnm1l. If a selection process was operating on the level of the mtDNA molecules or the cell, alteration in morphology of the organelle would be unlikely to affect such a process. In contrast, a mechanism operating on the organelle would likely be sensitive to changes in the morphology of the mitochondrial network. In our experiments, mitochondrial hyperfusion did not affect mtDNA selection in the liver or kidney, suggesting that the selection mechanism present in these tissue types is not operating on the level of the organelle. However, the altered mitochondrial morphology in the spleen of Python mice led to increased selection against the NZB mtDNA, indicative of a potential selection mechanism acting on the organelle level. These results are consistent with previous data based on differences of the the selection dynamics that proposes selection on the mtDNA itself in the liver and organelle in the hematopoietic tissues [234, 235].

A closely related unresolved question in the field of mtDNA genetics is the nature of the segregating unit. The segregating unit could be the mtDNA molecule, the nucleoid, a group of spatially linked nucleoids or the organelle. This matter is further complicated by the fact that it is not known whether mtDNA nucleoids are heteroplasmic or not. Knowledge of the organization of the nucleoid at the cytological and molecular level is very important for our understanding of the segregating unit, but at present remains beyond the technical detection capacity of even super resolution microscopy. Future technical advances will hopefully help increase the resolution so that this question can be directly investigated.

Temporal changes in the frequency heteroplasmic mtDNA variants in tissues are determined either by genetic drift of selection. Both of these mechanisms are affected by the population size of the segregating unit: the smaller the population size the bigger the effect of drift, which would be observed as increased variation in the heteroplasmy levels. Similarly, the

Discussion

78

effect of selection is faster the smaller the population of segregating units. If the segregating unit is the organelle, then hyperfusion would decrease the population size of segregating units. In such instance, an increase in variation caused by random drift or in the rate mtDNA selection should be seen. In contrast if the segregating unit is the mtDNA or nucleoids, the population size of segregating units should not be sensitive to changes in mitochondrial morphology.

In our experiments with the Python mouse, we observed no deviation from the mtDNA segregation patterns normally seen in the BALB/NZB heteroplasmic mice in any other tissue except the spleen. This result was irrespective of the germ layer origin or mitotic status of the tissue. These findings suggest that in most tissues the population size segregating units is not sensitive to changes in the morphology of the organelle, providing indirect evidence for the hypothesis that the segregating unit is either the mtDNA itself or the nucleoid. In contrast, the increased mtDNA selection in the spleen suggests that mitochondrial hyperfusion decreased population size of segregating units in the spleen. Therefore it is possible that in the spleen the segregating unit is the organelle rather than mtDNA or nucleoids.

The defect in fission did not have any effect in the segregation of the heteroplasmic mtDNA variants through the female germ line. We observed neither increase in variance of heteroplasmy levels in the offspring, nor a deviation from the random genetic drift model, showing that no selective mechanisms were turned on. These results indicate that the segregating unit in the female germ line is more likely to be mtDNA/nucleoids that individual organelles. Such a model is consistent with both of the mechanisms proposed to underlie the mitochondrial DNA bottleneck: a physical reduction in mtDNA copy number (and thus in the number of nucleoids) [108] or selective replication of a subset mtDNA molecules [107].

6.3 New insight into the selective mtDNA segregation in mouse hematopoietic tissues (I-III)

In this thesis we report three genetic modifiers of mtDNA selection in the hematopoietic tissues. Our data shows that proteins in other organelles can modulate mtDNA selection without any known direct link to mitochondria, demonstrating a complex picture for the regulation of selective mtDNA segregation in the hematopoietic tissues. While the molecular mechanism underlying mtDNA selection remains unknown, potential cellular pathways involved in mtDNA selection can be discussed based on our genetic findings and other advances in the field.

The connection of mitochondria with the ER is important for many cellular functions, but one of special interest in relation to mtDNA segregation is the recently described involvement of ER in mitochondrial dynamics via fission, potentially via modifying the actin cytoskeleton [62, 66,

79

69]. In yeast, a link between the ER mediated and Dnm1 (yeast homolog for Dnm1l) dependent mitochondrial fission and the distribution of mtDNA nucleoids, and their segregation at yeast cell division has been established. This link is mediated by the ERMES complex, which is a physical interaction between the ER and mitochondria. The deletion of ERMES core subunits leads to disruption of nucleoid structure and loss of mtDNA [58, 59, 298, 299]. ERMES colocalizes with both replicating nucleoids and the ER mediated mitochondrial fission sites [63, 298]. Moreover, a recent study demonstrated that nucleoids are present at the majority of the ER mediated fission sites, and that they dynamically move and segregate to the emerging tips prior to the fission event, although this segregation was not observed at all fission sites [63]. The integral connecting factor of mitochondrial division and mtDNA segregation in yeast is the ERMES complex for which there is no mammalian counterpart identified thus far, but an analogous system could still be discovered.

Our research has established that Gimap3 localizes to the ER, while others have shown that Gimap5 is a lysosomal protein. These proteins modify mtDNA segregation in the leukocytes, and may have a role in orchestrating organization of subcellular compartments as discussed in section 6.1. Our data indicates that factors involved in actin cytoskeleton biology are dependent on the abundance of Gimap5 in mice, and others have shown an association for the Gimap proteins with the actin cytoskeleton [293], a cellular component involved in the ER and Dnm1l mediated mitochondrial fission [62, 66, 69]. Furthermore, our work uncovered a direct genetic effect on mtDNA selection for Dnm1l. Based on these findings, a coupling of the ER and dnm1l mediated fission and the segregation of mtDNA nucleoids like in yeast would seem plausible, although the direct link to mtDNA nucleoids is at present missing. Mfn2, the only protein so far implicated in tethering mitochondria to the ER in mammalian cells, is not required for the ER mediated fission contact sites implying the existence of additional tethering factors. Gimap3 could be involved in mediating the interactions of ER with other organelles, including mitochondria. While we have no evidence that Gimap3 would function as a direct tether at ER-mitochondrial contact sites, the ability of the membrane-bound Gimaps to form stable scaffolds that could function as a platform for other interacting factors [261, 300] is consistent with such a role. What the mechanism for selectivity in such model is remains to be investigated in future research.

6.3.1 Possible mechanisms for mtDNA selection

6.3.1.1 Selection in the hematopoietic stem cells Selection against cells with a high heteroplasmy level in the hematopoietic stem cells is a possible mechanism to explain mtDNA selection that is

Discussion

80

specific for hematopoietic tissues. Mathematical modeling suggested such a mechanism to explain the decrease the A3243G mutation in patients [199] and could underlie the selection against the NZB genome in mice, as the selection against these mtDNA variants occurs in a similar manner. Moreover, the selection against the NZB mtDNA variant is common to all investigated leukocyte lineages [235], consistent with a selection mechanism occurring either in the hematopoietic stem cell population or independently in all cell lineages of hematopoietic origin.

Hematopoietic stem cells, when in quiescent state, contain few mitochondria and rely mainly on glycolysis for energy production while maintaining minimal basal metabolic activity [301, 302]. A metabolic shift to oxidative phosphorylation from glycolysis is associated with loss of quiescence and activation to lineage commitment [303]. Furthermore in mice mtDNA mutations have been shown cause loss of stemness and promote proliferation in the hematopoietic stem cell cells prior to any detectable defects in the respiratory chain function (reviewed in [219]). Therefore it is conceivable that subtle metabolic changes caused by the differences between the BALB and NZB mtDNA could be the underlying signal that leads to selection against te NZB genome in an especially sensitive cell type, such as the hematopoietic stem cells, even though there is no detectable difference in the respiratory chain function [234, 239].

Gimap5 is important for the normal development and maintenance of the hematopoietic stem cells and lack of this protein leads to a severe hematopoietic stem cell defect characterized by loss stem cell quiescence [264, 273]. The potential role for Gimap3 is the maintenance of hematopoietic stem cells is less clear as loss of this protein in mice does not cause any defects in the hematopoietic lineages, although it may play a more subtle role in co-operation with Gimap5 [275]. Therefore our findings that Gimap3 and Gimap5 are genetic modifiers of mtDNA selection in hematopoietic tissues are consistent with a selection mechanism occurring in the hematopoietic stem cells. However, our experiments do not experimentally address this question and further research is required to pinpoint whether the selection occurs in the hematopoietic stem cells. One potential way to clarify this issue in future research could be to isolate the stem cells by flow cytometric cell sorting, and directly analyze the heteroplasmy level in these cells in relation to the peripheral immune tissues at the same time point.

6.3.1.2 Selection by innate immunity Mitochondria have bacterial origins and some of their components can therefore have the molecular appearance of intracellular pathogens: formylated peptides originating from mitochondrial translation and mitochondrial DNA have been shown to activate an innate immune reaction when mitochondrial contents are aberrantly released following an injury

81

[304]. Furthermore, peptides derived from the mitochondrial ND1 prime the adaptive immune system against the intracellular bacterium Listeria monocytogenes [241], and although adaptive immune responses have been ruled out as a mechanism for mtDNA selection [235], it is possible that peptides derived from ND1 are recognized by innate immune mechanisms. ND1 harbors one of the nucleotide differences between the BALB and NZB mtDNA genomes, and could serve as a signal to differentiate between these mtDNA variants. Interestingly recent experimental work demonstrated a role for Parkin, a protein implicated in marking mitochondria for degradation via macroautophagy in cell culture model systems, in host defence against the intracellular pathogens Mycobacterium tuberculosis and L. monocytogenes in transgenic mice [305]. Mice deficient for Parkin were shown to be significantly more susceptible for these pathogens. In cultured human and mouse macrophages Parkin was shown to colocalize with a subset of these pathogens, and this colocalization was prerequisite for subsequent colocalization with markers of autophagy. Polymorphisms in PARKIN also associate with susceptibility to intracellular bacterial infections in various human populations [306-308]. Perhaps in the mouse hematopoietic compartment, mitochondria harboring a high percentage of NZB are incorrectly perceived as an intracellular pathogen and targeted for destruction via an autophagic pathway.

In principle, some of our findings are compatible with a mechanism for mtDNA selection that depends on mitochondrial turnover, potentially via macroautophagy. Our results with dominant-negative Dnm1l indicate that the segregating unit in the spleen is likely to be the organelle, consistent with a mechanism based on organelle turnover. The effect of Gimap3 could be facilitated through ER mediated fission, which potentially links the segregation of nucleoids to mitochondria targeted for degradation. Gimap5 could mediate the final delivery of the autophagosomes to lysosome. In contrast our data that inhibition of fission accelerates the selection against the NZB genome does not support a mechanism based on autophagy, as fission is required to produce mitochondria that are small enough to be engulfed by autophagosomes.

Although the involvement of autophagy in mtDNA selection is at present speculative, the innate immune system is a promising candidate for mediating a potential mechanism. The NK cells of the innate system have been shown to be able to recognize and reject cells with mtDNA variants that differ from the recipient upon transplantation [244]. Therefore it is possible to envision an immune reaction against the NZB genome in the BALB/NZB mouse model as the basis for mtDNA selection in these mice. It is however unclear why such a selection mechanism would be tissue-specific to the hematopoietic compartment, a shared feature between the BALB/NZB model and patients harboring the A3242G mutation. It is unfortunate that we were unable to test the involvement of NK cells in our study set up: while the Gimap5 KO animals lack any detectable NK cells, they cannot serve as a

Discussion

82

model for NK cell depletion due the complex deficiencies of other immune cell types that accompany the loss of NK cells. The function of the immune system is to discriminate self from foreign, and in these mice the NZB mtDNA variant is foreign, as these mice are on a Balb/c nuclear background. Future research could clarify this issue by using mouse models with a specific defect in innate immunity.

83

7 Conclusions and future prospects

In this thesis, we report the first genes known to be involved in tissue-specific mtDNA segregation in mammals. In 2010 we showed for the first time a modulatory effect for a specific gene, Gimap3, on tissue-specific mtDNA segregation in mammals. The specific function of Gimap3 in cells was unknown but it did not appear to be involved in in oxidative phosphorylation, a process conventionally proposed as potential mechanisms for mtDNA selection. Therefore the finding of Gimap3 enabled a whole new direction of research in the search for mechanisms of mtDNA segregation.

Our follow-up research on Gimap3 revealed a picture of selective mtDNA segregation that is far more complex than originally envisioned. We showed that the Gimap3 protein consistently localizes to the endoplasmic reticulum instead of the previously reported mitochondrial localization. Moreover, we showed that Gimap5, a paralog of Gimap3 that encodes a lysosomal protein, is also a genetic modifier of the tissue-specific mtDNA selection phenotype in the spleen, potentially through some coordinated function with Gimap3. However, these proteins have no apparent direct link to mitochondria. In recent years, a potential role for Gimaps as orchestrators of intracellular trafficking has emerged. Moreover, it has become more apparent that organelles within the cell do not operate as isolated agents, although traditionally research has focused on the function of a specific organelle type. Functionally relevant interactions are now known between many organelles. Our findings that Gimap3 and Gimap5, proteins in separate cellular subcompartments can affect the segregation of mitochondrial DNA, build on these advances and suggest that future research should strive to encompass the cooperative nature of different organelles.

Experimental evidence from the single cell eukaryotic model S. cerevisiae has linked ER mediated mitochondrial fission to mtDNA segregation. We tested the role of mitochondrial fission in mtDNA segregation in mice by introducing a dominant-negative mutation to the fission protein Dnm1l and showed that while there is a specific effect on the mtDNA selection phenotype in the spleen, a defect in fission is inconsequential to the mtDNA segregation phenotype in most tissues. Considered together with our findings with Gimap3 and Gimap5, it appears likely that subcellular distribution of mitochondria and their interactions with other organelles are relevant for the mtDNA selection in hematopoietic tissues. However, the mechanism for the selections remains unknown and further research is needed to elucidate the mechanistic role of these three genetic factors reported in this thesis.

Studying the genetic and mechanistic basis for mtDNA segregation in mice remains highly relevant for understanding the behavior pathogenic mtDNA mutations in patients, as these can generally only be observed at static time point and cannot be studied experimentally. Due to the potential

Conclusions and future prospects

84

mutation specific differences in the segregation behavior, it would be optimal generate heteroplasmic models with patient specific mtDNA mutations. Genetic modification of mammalian mtDNA has been unfeasible, but current advances in genome editing tools in the germ line may pave the way for studying tissue-specific segregation of patient mtDNA mutations, if they can be modified to work inside the mitochondria. Conceivably the generation of heteroplasmic models in lower vertebrates, such as zebrafish, could also be useful as they are more amenable for high through-put methodology than mice. Patient derived induced pluripotent stem cells represent another potential research model, although it remains to be shown whether cell based models even when differentiated to specialized cell types could model the tissue-specific segregation observed in complex animals.

Taken together, the results described in this thesis have advanced our understanding of the regulation of tissue-specific mtDNA segregation. Our results point towards organellar interactions as being central in the underlying mechanism, and suggest that future research in this field should be directed towards ER mitochondrial interactions and organelle distribution to gain mechanistic insight to the process of tissue-specific mtDNA segregation.

85

ACKNOWLEDGEMENTS

This thesis work was carried out in Biomedicum-Helsinki, in the Research Program for Molecular Neurology, the Faculty of Medicine, University of Helsinki and in Academy of Finland Center of Excellence FinMIT (terms 2008-2013 and 2014-2019). Financial support for this work was provided by the Doctoral Programme in Biomedicine of the Doctoral School in Health Sciences, the Finnish Cultural Foundation, the Biomedicum-Helsinki Foundation, the Emil Aaltonen Foundation, the Waldemar von Frenckell Foundation and by general grants to the research group from Jane and Aatos Erkko Foundation, the Academy of Finland, University of Helsinki and the United Mitochondrial Disease Foundation.

I wish to sincerely express my gratitude to my PhD supervisor, docent Brendan Battersby. Thank you for having the faith in me and taking me on as a graduate student to work on the challenging scientific projects that in the end comprised this thesis. During these years I have learned a great deal about experimental science, problem solving and analytical thinking through your guidance and continuous encouragement. Your enthusiasm for science and optimism are truly inspirational.

Professor Juha Partanen and assistant Professor Sjoerd Wanrooij are thanked for lending their valuable time and expertise to serve as the external reviewers of my thesis. Professor Partanen was also a member of my thesis committee together with docent Iiris Hovatta. Both are warmly thanked for helpful advice and interesting discussions during these years. I really enjoyed the enthusiastic atmosphere of our meetings. I express my gratitude to Professor Robert Taylor for giving me the honor of accepting the role of official opponent.

Science is truly a collaborative enterprise, and no advances are made in solitude. Therefore I wish to acknowledge the important contribution of all my collaborators and co-authors. Completing these projects would not have been possible without your collective expertise. Professors Anu Wartiovaara, the director of the Research Program of Molecular Neurology, and Howy Jacobs, the head of FinMIT, are thanked for creating and fostering the excellent scientific environment in our units.

Paula Marttinen and Taina Lahtinen, your continued support over the years as colleagues, co-authors and friends has been invaluable. The skills that both of you continuously exhibit in the lab never cease to amaze me and it has been a privilege to work with you. Your friendship is no less important. I am grateful to Nicolas Yeung and Katarin Sandell for their help with the

ACKNOWLEDGEMENTS

86

mouse work in this thesis – many a day would have been a lot darker without your companionship. Uwe Richter is thanked for always having the time for discussions, be it scientific, philosophical or silly in nature. I also wish to thank all past and present members of groups Battersby, Wartiovaara and Tyynismaa for the great and supportive workplace atmosphere, and for the fun times outside of work.

To my friends outside of academia, Ilona, Johanna, Milla, Kati, Christel and others. I am lucky that you have been there for all these years, guaranteed to put me in a good mood every time we meet. It is a privilege to belong to this brilliant group of people. Finally, I am grateful to my family for being the solid foundation everything in life is built on. To my parents, I am in debt to you in countless ways. I thank you for all of your support. To Chris, I am fortunate to share my life with you. You believed that I can achieve this goal even in those moments when I did not, which made all the difference.

Espoo, January 2016 Riikka Jokinen

87

References

1. Wallace, D.C., Singh, G., Lott, M.T., Hodge, J.A., Schurr, T.G., Lezza,

A.M., Elsas, L.J., and Nikoskelainen, E.K., Mitochondrial DNA mutation associated with Leber's hereditary optic neuropathy. Science, 1988. 242(4884): p. 1427-30.

2. Holt, I.J., Harding, A.E., and Morgan-Hughes, J.A., Deletions of muscle mitochondrial DNA in patients with mitochondrial myopathies. Nature, 1988. 331(6158): p. 717-719.

3. Lightowlers, R.N., Taylor, R.W., and Turnbull, D.M., Mutations causing mitochondrial disease: What is new and what challenges remain? Science, 2015. 349(6255): p. 1494-1499.

4. Schon, E.A., DiMauro, S., and Hirano, M., Human mitochondrial DNA: roles of inherited and somatic mutations. Nat Rev Genet, 2012. 13(12): p. 878-90.

5. Margulis, L., Recombination of non-chromosomal genes in Chlamydomonas: assortment of mitochondria and chloroplasts? J Theor Biol, 1970. 26(2): p. 337-42.

6. Gray, M.W., Mitochondrial Evolution. Cold Spring Harb Perspect Biol, 2012. 4(9): p. a011403.

7. Hackenbrock, C.R., ULTRASTRUCTURAL BASES FOR METABOLICALLY LINKED MECHANICAL ACTIVITY IN MITOCHONDRIA : I. Reversible Ultrastructural Changes with Change in Metabolic Steady State in Isolated Liver Mitochondria. J Cell Biol, 1966. 30(2): p. 269-297.

8. Frey, T.G. and Mannella, C.A., The internal structure of mitochondria. Trends in Biochemical Sciences. 25(7): p. 319-324.

9. Krebs, H.A. and Johnson, W.A., Metabolism of ketonic acids in animal tissues. Biochem J, 1937. 31(4): p. 645-60.

10. Mitchell, P., Coupling of phosphorylation to electron and hydrogen transfer by a chemi-osmotic type of mechanism. Nature, 1961. 191: p. 144-8.

11. Schon, E.A. and Przedborski, S., Mitochondria: the next (neurode)generation. Neuron, 2011. 70(6): p. 1033-53.

12. Smirnova, E., Griparic, L., Shurland, D.L., and van der Bliek, A.M., Dynamin-related protein Drp1 is required for mitochondrial division in mammalian cells. Mol Biol Cell, 2001. 12(8): p. 2245-56.

13. Labrousse, A.M., Zappaterra, M.D., Rube, D.A., and van der Bliek, A.M., C. elegans dynamin-related protein DRP-1 controls severing of the mitochondrial outer membrane. Mol Cell, 1999. 4(5): p. 815-26.

14. Smirnova, E., Shurland, D.L., Ryazantsev, S.N., and van der Bliek, A.M., A human dynamin-related protein controls the distribution of mitochondria. J Cell Biol, 1998. 143(2): p. 351-8.

15. Hoppins, S., Lackner, L., and Nunnari, J., The machines that divide and fuse mitochondria. Annu Rev Biochem, 2007. 76: p. 751-80.

16. Mears, J.A., Lackner, L.L., Fang, S., Ingerman, E., Nunnari, J., and Hinshaw, J.E., Conformational changes in Dnm1 support a contractile mechanism for mitochondrial fission. Nat Struct Mol Biol, 2011. 18(1): p. 20-26.

17. Ingerman, E., Perkins, E.M., Marino, M., Mears, J.A., McCaffery, J.M., Hinshaw, J.E., and Nunnari, J., Dnm1 forms spirals that are

References

88

structurally tailored to fit mitochondria. J Cell Biol, 2005. 170(7): p. 1021-1027.

18. Fröhlich, C., Grabiger, S., Schwefel, D., Faelber, K., Rosenbaum, E., Mears, J., Rocks, O., and Daumke, O., Structural insights into oligomerization and mitochondrial remodelling of dynamin 1-like protein. EMBO J, 2013. 32(9): p. 1280-92.

19. Tieu, Q. and Nunnari, J., Mdv1p Is a Wd Repeat Protein That Interacts with the Dynamin-Related Gtpase, Dnm1p, to Trigger Mitochondrial Division. J Cell Biol, 2000. 151(2): p. 353-366.

20. Mozdy, A.D., McCaffery, J.M., and Shaw, J.M., Dnm1p Gtpase-Mediated Mitochondrial Fission Is a Multi-Step Process Requiring the Novel Integral Membrane Component Fis1p. J Cell Biol, 2000. 151(2): p. 367-380.

21. Fekkes, P., Shepard, K.A., and Yaffe, M.P., Gag3p, an Outer Membrane Protein Required for Fission of Mitochondrial Tubules. J Cell Biol, 2000. 151(2): p. 333-340.

22. Griffin, E.E., Graumann, J., and Chan, D.C., The WD40 protein Caf4p is a component of the mitochondrial fission machinery and recruits Dnm1p to mitochondria. J Cell Biol, 2005. 170(2): p. 237-248.

23. Otera, H., Wang, C., Cleland, M.M., Setoguchi, K., Yokota, S., Youle, R.J., and Mihara, K., Mff is an essential factor for mitochondrial recruitment of Drp1 during mitochondrial fission in mammalian cells. J Cell Biol, 2010. 191(6): p. 1141-1158.

24. Yoon, Y., Krueger, E.W., Oswald, B.J., and McNiven, M.A., The Mitochondrial Protein hFis1 Regulates Mitochondrial Fission in Mammalian Cells through an Interaction with the Dynamin-Like Protein DLP1. Mol Cell Biol, 2003. 23(15): p. 5409-5420.

25. Losón, O.C., Song, Z., Chen, H., and Chan, D.C., Fis1, Mff, MiD49, and MiD51 mediate Drp1 recruitment in mitochondrial fission. Mol Biol Cell, 2013. 24(5): p. 659-667.

26. Stojanovski, D., Koutsopoulos, O.S., Okamoto, K., and Ryan, M.T., Levels of human Fis1 at the mitochondrial outer membrane regulate mitochondrial morphology. J Cell Sci, 2004. 117(7): p. 1201-1210.

27. Gandre-Babbe, S. and van der Bliek, A.M., The Novel Tail-anchored Membrane Protein Mff Controls Mitochondrial and Peroxisomal Fission in Mammalian Cells. Mol Biol Cell, 2008. 19(6): p. 2402-2412.

28. Palmer, C.S., Osellame, L.D., Laine, D., Koutsopoulos, O.S., Frazier, A.E., and Ryan, M.T., MiD49 and MiD51, new components of the mitochondrial fission machinery. EMBO reports, 2011. 12(6): p. 565-573.

29. Otera, H., Ishihara, N., and Mihara, K., New insights into the function and regulation of mitochondrial fission. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research, 2013. 1833(5): p. 1256-1268.

30. Meeusen, S., DeVay, R., Block, J., Cassidy-Stone, A., Wayson, S., McCaffery, J.M., and Nunnari, J., Mitochondrial Inner-Membrane Fusion and Crista Maintenance Requires the Dynamin-Related GTPase Mgm1. Cell, 2006. 127(2): p. 383-395.

31. Cipolat, S., de Brito, O.M., Dal Zilio, B., and Scorrano, L., OPA1 requires mitofusin 1 to promote mitochondrial fusion. Proc Natl Acad Sci U S A, 2004. 101(45): p. 15927-15932.

32. Hermann, G.J., Thatcher, J.W., Mills, J.P., Hales, K.G., Fuller, M.T., Nunnari, J., and Shaw, J.M., Mitochondrial Fusion in Yeast Requires the Transmembrane GTPase Fzo1p. J Cell Biol, 1998. 143(2): p. 359-373.

33. Santel, A. and Fuller, M.T., Control of mitochondrial morphology by a human mitofusin. J Cell Sci, 2001. 114(5): p. 867-874.

89

34. Chen, H., Detmer, S.A., Ewald, A.J., Griffin, E.E., Fraser, S.E., and Chan, D.C., Mitofusins Mfn1 and Mfn2 coordinately regulate mitochondrial fusion and are essential for embryonic development. J Cell Biol, 2003. 160(2): p. 189-200.

35. Song, Z., Ghochani, M., McCaffery, J.M., Frey, T.G., and Chan, D.C., Mitofusins and OPA1 Mediate Sequential Steps in Mitochondrial Membrane Fusion. Mol Biol Cell, 2009. 20(15): p. 3525-3532.

36. Hoppins, S. and Nunnari, J., The molecular mechanism of mitochondrial fusion. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research, 2009. 1793(1): p. 20-26.

37. Ishihara, N., Nomura, M., Jofuku, A., Kato, H., Suzuki, S.O., Masuda, K., Otera, H., Nakanishi, Y., Nonaka, I., Goto, Y.-I., Taguchi, N., Morinaga, H., Maeda, M., Takayanagi, R., Yokota, S., and Mihara, K., Mitochondrial fission factor Drp1 is essential for embryonic development and synapse formation in mice. Nat Cell Biol, 2009. 11(8): p. 958-66.

38. Davies, V.J., Hollins, A.J., Piechota, M.J., Yip, W., Davies, J.R., White, K.E., Nicols, P.P., Boulton, M.E., and Votruba, M., Opa1 deficiency in a mouse model of autosomal dominant optic atrophy impairs mitochondrial morphology, optic nerve structure and visual function. Hum Mol Genet, 2007. 16(11): p. 1307-18.

39. Morris, R.L. and Hollenbeck, P.J., Axonal transport of mitochondria along microtubules and F-actin in living vertebrate neurons. J Cell Biol, 1995. 131(5): p. 1315-1326.

40. Morris, R.L. and Hollenbeck, P.J., The regulation of bidirectional mitochondrial transport is coordinated with axonal outgrowth. J Cell Sci, 1993. 104 ( Pt 3): p. 917-27.

41. Heggeness, M.H., Simon, M., and Singer, S.J., Association of mitochondria with microtubules in cultured cells. Proc Natl Acad Sci U S A, 1978. 75(8): p. 3863-3866.

42. Ball, E.H. and Singer, S.J., Mitochondria are associated with microtubules and not with intermediate filaments in cultured fibroblasts. Proc Natl Acad Sci U S A, 1982. 79(1): p. 123-126.

43. Sheng, Z.-H. and Cai, Q., Mitochondrial transport in neurons: impact on synaptic homeostasis and neurodegeneration. Nat Rev Neurosci, 2012. 13(2): p. 77-93.

44. Quintero, O.A., DiVito, M.M., Adikes, R.C., Kortan, M.B., Case, L.B., Lier, A.J., Panaretos, N.S., Slater, S.Q., Rengarajan, M., Feliu, M., and Cheney, R.E., Human Myo19 Is a Novel Myosin that Associates with Mitochondria. Curr Biol, 2009. 19(23): p. 2008-2013.

45. Fransson, A., Ruusala, A., and Aspenström, P., Atypical Rho GTPases have roles in mitochondrial homeostasis and apoptosis. J Biol Chem, 2003. 278(8): p. 6495-502.

46. Reis, K., Fransson, A., and Aspenström, P., The Miro GTPases: at the heart of the mitochondrial transport machinery. FEBS Lett, 2009. 583(9): p. 1391-8.

47. MacAskill, A.F., Rinholm, J.E., Twelvetrees, A.E., Arancibia-Carcamo, I.L., Muir, J., Fransson, A., Aspenstrom, P., Attwell, D., and Kittler, J.T., Miro1 Is a Calcium Sensor for Glutamate Receptor-Dependent Localization of Mitochondria at Synapses. Neuron, 2009. 61(4): p. 541-555.

48. Wang, X. and Schwarz, T.L., The Mechanism of Ca2+-Dependent Regulation of Kinesin-Mediated Mitochondrial Motility. Cell, 2009. 136(1): p. 163-174.

49. Quintana, A., Schwindling, C., Wenning, A.S., Becherer, U., Rettig, J., Schwarz, E.C., and Hoth, M., T cell activation requires mitochondrial

References

90

translocation to the immunological synapse. Proc Natl Acad Sci USA, 2007. 104(36): p. 14418-23.

50. Campello, S., Lacalle, R.A., Bettella, M., Mañes, S., Scorrano, L., and Viola, A., Orchestration of lymphocyte chemotaxis by mitochondrial dynamics. J Exp Med, 2006. 203(13): p. 2879-86.

51. Grimm, S., The ER–mitochondria interface: The social network of cell death. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research, 2012. 1823(2): p. 327-334.

52. Kornmann, B., Currie, E., Collins, S.R., Schuldiner, M., Nunnari, J., Weissman, J.S., and Walter, P., An ER-mitochondria tethering complex revealed by a synthetic biology screen. Science, 2009. 325(5939): p. 477-81.

53. de Brito, O.M. and Scorrano, L., Mitofusin 2 tethers endoplasmic reticulum to mitochondria. Nature, 2008. 456(7222): p. 605-10.

54. Filadi, R., Greotti, E., Turacchio, G., Luini, A., Pozzan, T., and Pizzo, P., Mitofusin 2 ablation increases endoplasmic reticulum-mitochondria coupling. Proc Natl Acad Sci U S A, 2015. 112(17): p. E2174-81.

55. Rusiñol, A.E., Cui, Z., Chen, M.H., and Vance, J.E., A unique mitochondria-associated membrane fraction from rat liver has a high capacity for lipid synthesis and contains pre-Golgi secretory proteins including nascent lipoproteins. J Biol Chem, 1994. 269(44): p. 27494-27502.

56. Vance, J.E., Phospholipid synthesis in a membrane fraction associated with mitochondria. J Biol Chem, 1990. 265(13): p. 7248-7256.

57. Area-Gomez, E., del Carmen Lara Castillo, M., Tambini, M.D., Guardia-Laguarta, C., de Groof, A.J.C., Madra, M., Ikenouchi, J., Umeda, M., Bird, T.D., Sturley, S.L., and Schon, E.A., Upregulated function of mitochondria-associated ER membranes in Alzheimer disease. EMBO J, 2012. 31(21): p. 4106-4123.

58. Boldogh, I.R., Nowakowski, D.W., Yang, H.-C., Chung, H., Karmon, S., Royes, P., and Pon, L.A., A protein complex containing Mdm10p, Mdm12p, and Mmm1p links mitochondrial membranes and DNA to the cytoskeleton-based segregation machinery. Mol Biol Cell, 2003. 14(11): p. 4618-27.

59. Youngman, M.J., Hobbs, A.E.A., Burgess, S.M., Srinivasan, M., and Jensen, R.E., Mmm2p, a mitochondrial outer membrane protein required for yeast mitochondrial shape and maintenance of mtDNA nucleoids. J Cell Biol, 2004. 164(5): p. 677-688.

60. Burgess, S.M., Delannoy, M., and Jensen, R.E., MMM1 encodes a mitochondrial outer membrane protein essential for establishing and maintaining the structure of yeast mitochondria. J Cell Biol, 1994. 126(6): p. 1375-1391.

61. Kornmann, B., Osman, C., and Walter, P., The conserved GTPase Gem1 regulates endoplasmic reticulum–mitochondria connections. Proc Natl Acad Sci U S A, 2011. 108(34): p. 14151-14156.

62. Friedman, J.R., Lackner, L.L., West, M., DiBenedetto, J.R., Nunnari, J., and Voeltz, G.K., ER tubules mark sites of mitochondrial division. Science, 2011. 334(6054): p. 358-62.

63. Murley, A., Lackner, L.L., Osman, C., West, M., Voeltz, G.K., Walter, P., and Nunnari, J., ER-associated mitochondrial division links the distribution of mitochondria and mitochondrial DNA in yeast. Elife, 2013. 2: p. e00422.

64. Rowland, A.A. and Voeltz, G.K., Endoplasmic reticulum-mitochondria contacts: function of the junction. Nat Rev Mol Cell Biol, 2012. 13(10): p. 607-625.

91

65. Friedman, J.R., Webster, B.M., Mastronarde, D.N., Verhey, K.J., and Voeltz, G.K., ER sliding dynamics and ER–mitochondrial contacts occur on acetylated microtubules. J Cell Biol, 2010. 190(3): p. 363-375.

66. Korobova, F., Ramabhadran, V., and Higgs, H.N., An actin-dependent step in mitochondrial fission mediated by the ER-associated formin INF2. Science, 2013. 339(6118): p. 464-7.

67. DuBoff, B., Götz, J., and Feany, Mel B., Tau Promotes Neurodegeneration via DRP1 Mislocalization In Vivo. Neuron, 2012. 75(4): p. 618-632.

68. De Vos, K.J., Allan, V.J., Grierson, A.J., and Sheetz, M.P., Mitochondrial Function and Actin Regulate Dynamin-Related Protein 1-Dependent Mitochondrial Fission. Curr Biol, 2005. 15(7): p. 678-683.

69. Korobova, F., Gauvin, T.J., and Higgs, H.N., A role for myosin II in mammalian mitochondrial fission. Curr Biol, 2014. 24(4): p. 409-14.

70. Hatch, A.L., Gurel, P.S., and Higgs, H.N., Novel roles for actin in mitochondrial fission. J Cell Sci, 2014. 127(21): p. 4549-4560.

71. Matsushima, Y. and Kaguni, L.S., Matrix proteases in mitochondrial DNA function. Biochimica et Biophysica Acta (BBA) - Gene Regulatory Mechanisms, 2012. 1819(9–10): p. 1080-1087.

72. Karbowski, M. and Youle, R.J., Regulating mitochondrial outer membrane proteins by ubiquitination and proteasomal degradation. Curr Opin Cell Biol, 2011. 23(4): p. 476-482.

73. Soubannier, V., McLelland, G.-L., Zunino, R., Braschi, E., Rippstein, P., Fon, E.A., and McBride, H.M., A vesicular transport pathway shuttles cargo from mitochondria to lysosomes. Curr Biol, 2012. 22(2): p. 135-41.

74. Neuspiel, M., Schauss, A.C., Braschi, E., Zunino, R., Rippstein, P., Rachubinski, R.A., Andrade-Navarro, M.A., and McBride, H.M., Cargo-selected transport from the mitochondria to peroxisomes is mediated by vesicular carriers. Curr Biol, 2008. 18(2): p. 102-8.

75. Kornmann, B., Quality control in mitochondria: use it, break it, fix it, trash it. F1000Prime Reports, 2014. 6: p. 15.

76. Twig, G., Elorza, A., Molina, A.J.A., Mohamed, H., Wikstrom, J.D., Walzer, G., Stiles, L., Haigh, S.E., Katz, S., Las, G., Alroy, J., Wu, M., Py, B.F., Yuan, J., Deeney, J.T., Corkey, B.E., and Shirihai, O.S., Fission and selective fusion govern mitochondrial segregation and elimination by autophagy. EMBO J, 2008. 27(2): p. 433-46.

77. Narendra, D.P., Jin, S.M., Tanaka, A., Suen, D.-F., Gautier, C.A., Shen, J., Cookson, M.R., and Youle, R.J., PINK1 is selectively stabilized on impaired mitochondria to activate Parkin. PLoS Biol, 2010. 8(1): p. e1000298.

78. Matsuda, N., Sato, S., Shiba, K., Okatsu, K., Saisho, K., Gautier, C.A., Sou, Y.-S., Saiki, S., Kawajiri, S., Sato, F., Kimura, M., Komatsu, M., Hattori, N., and Tanaka, K., PINK1 stabilized by mitochondrial depolarization recruits Parkin to damaged mitochondria and activates latent Parkin for mitophagy. J Cell Biol, 2010. 189(2): p. 211-21.

79. Narendra, D., Tanaka, A., Suen, D.-F., and Youle, R.J., Parkin is recruited selectively to impaired mitochondria and promotes their autophagy. J Cell Biol, 2008. 183(5): p. 795-803.

80. Tanaka, A., Cleland, M.M., Xu, S., Narendra, D.P., Suen, D.-F., Karbowski, M., and Youle, R.J., Proteasome and p97 mediate mitophagy and degradation of mitofusins induced by Parkin. J Cell Biol, 2010. 191(7): p. 1367-1380.

References

92

81. Eiyama, A. and Okamoto, K., PINK1/Parkin-mediated mitophagy in mammalian cells. Curr Opin Cell Biol, 2015. 33(0): p. 95-101.

82. Kim, T.-Y., Wang, D., Kim, A.K., Lau, E., Lin, A.J., Liem, D.A., Zhang, J., Zong, N.C., Lam, M.P.Y., and Ping, P., Metabolic labeling reveals proteome dynamics of mouse mitochondria. Mol Cell Proteomics, 2012. 11(12): p. 1586-94.

83. Vincow, E.S., Merrihew, G., Thomas, R.E., Shulman, N.J., Beyer, R.P., MacCoss, M.J., and Pallanck, L.J., The PINK1–Parkin pathway promotes both mitophagy and selective respiratory chain turnover in vivo. Proc Natl Acad Sci U S A, 2013. 110(16): p. 6400-6405.

84. Karunadharma, P.P., Basisty, N., Chiao, Y.A., Dai, D.-F., Drake, R., Levy, N., Koh, W.J., Emond, M.J., Kruse, S., Marcinek, D., Maccoss, M.J., and Rabinovitch, P.S., Respiratory chain protein turnover rates in mice are highly heterogeneous but strikingly conserved across tissues, ages, and treatments. FASEB J, 2015: p. 10.1096/fj.15-272666.

85. Boore, J.L., Animal mitochondrial genomes. Nucleic Acids Res, 1999. 27(8): p. 1767-1780.

86. Timmis, J.N., Ayliffe, M.A., Huang, C.Y., and Martin, W., Endosymbiotic gene transfer: organelle genomes forge eukaryotic chromosomes. Nat Rev Genet, 2004. 5(2): p. 123-135.

87. Anderson, S., Bankier, A.T., Barrell, B.G., de Bruijn, M.H.L., Coulson, A.R., Drouin, J., Eperon, I.C., Nierlich, D.P., Roe, B.A., Sanger, F., Schreier, P.H., Smith, A.J.H., Staden, R., and Young, I.G., Sequence and organization of the human mitochondrial genome. Nature, 1981. 290(5806): p. 457-465.

88. Bibb, M.J., Van Etten, R.A., Wright, C.T., Walberg, M.W., and Clayton, D.A., Sequence and gene organization of mouse mitochondrial DNA. Cell. 26(2): p. 167-180.

89. Pagliarini, D.J., Calvo, S.E., Chang, B., Sheth, S.A., Vafai, S.B., Ong, S.-E., Walford, G.A., Sugiana, C., Boneh, A., Chen, W.K., Hill, D.E., Vidal, M., Evans, J.G., Thorburn, D.R., Carr, S.A., and Mootha, V.K., A mitochondrial protein compendium elucidates complex I disease biology. Cell, 2008. 134(1): p. 112-23.

90. Korhonen, J.A., Pham, X.H., Pellegrini, M., and Falkenberg, M., Reconstitution of a minimal mtDNA replisome in vitro. EMBO J, 2004. 23(12): p. 2423-9.

91. Clayton, D.A., Replication of animal mitochondrial DNA. Cell, 1982. 28(4): p. 693-705.

92. Holt, I.J. and Reyes, A., Human Mitochondrial DNA Replication. Cold Spring Harb Perspect Biol, 2012. 4(12).

93. Robberson, D.L., Kasamatsu, H., and Vinograd, J., Replication of Mitochondrial DNA. Circular Replicative Intermediates in Mouse L Cells. Proc Natl Acad Sci U S A, 1972. 69(3): p. 737-741.

94. Brown, T.A., Cecconi, C., Tkachuk, A.N., Bustamante, C., and Clayton, D.A., Replication of mitochondrial DNA occurs by strand displacement with alternative light-strand origins, not via a strand-coupled mechanism. Genes Dev, 2005. 19(20): p. 2466-2476.

95. Bowmaker, M., Yang, M.Y., Yasukawa, T., Reyes, A., Jacobs, H.T., Huberman, J.A., and Holt, I.J., Mammalian Mitochondrial DNA Replicates Bidirectionally from an Initiation Zone. J Biol Chem, 2003. 278(51): p. 50961-50969.

96. Holt, I.J., Lorimer, H.E., and Jacobs, H.T., Coupled Leading- and Lagging-Strand Synthesis of Mammalian Mitochondrial DNA. Cell, 2000. 100(5): p. 515-524.

97. Yasukawa, T., Reyes, A., Cluett, T.J., Yang, M.Y., Bowmaker, M., Jacobs, H.T., and Holt, I.J., Replication of vertebrate mitochondrial

93

DNA entails transient ribonucleotide incorporation throughout the lagging strand. EMBO J, 2006. 25(22): p. 5358-5371.

98. Yang, M.Y., Bowmaker, M., Reyes, A., Vergani, L., Angeli, P., Gringeri, E., Jacobs, H.T., and Holt, I.J., Biased Incorporation of Ribonucleotides on the Mitochondrial L-Strand Accounts for Apparent Strand-Asymmetric DNA Replication. Cell. 111(4): p. 495-505.

99. Yasukawa, T., Yang, M.-Y., Jacobs, H.T., and Holt, I.J., A Bidirectional Origin of Replication Maps to the Major Noncoding Region of Human Mitochondrial DNA. Mol Cell, 2005. 18(6): p. 651-662.

100. Kazak, L., Reyes, A., and Holt, I.J., Minimizing the damage: repair pathways keep mitochondrial DNA intact. Nat Rev Mol Cell Biol, 2012. 13(10): p. 659-671.

101. Sato, A., Nakada, K., Akimoto, M., Ishikawa, K., Ono, T., Shitara, H., Yonekawa, H., and Hayashi, J.-I., Rare creation of recombinant mtDNA haplotypes in mammalian tissues. Proc Natl Acad Sci U S A, 2005. 102(17): p. 6057-6062.

102. Hagström, E., Freyer, C., Battersby, B.J., Stewart, J.B., and Larsson, N.-G., No recombination of mtDNA after heteroplasmy for 50 generations in the mouse maternal germline. Nucleic Acids Res, 2014. 42(2): p. 1111-1116.

103. Fernández-Vizarra, E., Enríquez, J.A., Pérez-Martos, A., Montoya, J., and Fernández-Silva, P., Tissue-specific differences in mitochondrial activity and biogenesis. Mitochondrion, 2011. 11(1): p. 207-213.

104. Chan, S.W., Chevalier, S., Aprikian, A., and Chen, J.Z., Simultaneous Quantification of Mitochondrial DNA Damage and Copy Number in Circulating Blood: A Sensitive Approach to Systemic Oxidative Stress. BioMed Research International, 2013. 2013: p. 157547.

105. Miller, F.J., Rosenfeldt, F.L., Zhang, C., Linnane, A.W., and Nagley, P., Precise determination of mitochondrial DNA copy number in human skeletal and cardiac muscle by a PCR-based assay: lack of change of copy number with age. Nucleic Acids Res, 2003. 31(11): p. e61-e61.

106. Wai, T., Ao, A., Zhang, X., Cyr, D., Dufort, D., and Shoubridge, E.A., The role of mitochondrial DNA copy number in mammalian fertility. Biol Reprod, 2010. 83(1): p. 52-62.

107. Wai, T., Teoli, D., and Shoubridge, E.A., The mitochondrial DNA genetic bottleneck results from replication of a subpopulation of genomes. Nat Genet, 2008. 40(12): p. 1484-8.

108. Cree, L.M., Samuels, D.C., de Sousa Lopes, S.C., Rajasimha, H.K., Wonnapinij, P., Mann, J.R., Dahl, H.-H.M., and Chinnery, P.F., A reduction of mitochondrial DNA molecules during embryogenesis explains the rapid segregation of genotypes. Nat Genet, 2008. 40(2): p. 249-54.

109. Spelbrink, J.N., Toivonen, J.M., Hakkaart, G.A., Kurkela, J.M., Cooper, H.M., Lehtinen, S.K., Lecrenier, N., Back, J.W., Speijer, D., Foury, F., and Jacobs, H.T., In vivo functional analysis of the human mitochondrial DNA polymerase POLG expressed in cultured human cells. J Biol Chem, 2000. 275(32): p. 24818-28.

110. Tyynismaa, H., Sembongi, H., Bokori-Brown, M., Granycome, C., Ashley, N., Poulton, J., Jalanko, A., Spelbrink, J.N., Holt, I.J., and Suomalainen, A., Twinkle helicase is essential for mtDNA maintenance and regulates mtDNA copy number. Hum Mol Genet, 2004. 13(24): p. 3219-27.

111. Ekstrand, M.I., Falkenberg, M., Rantanen, A., Park, C.B., Gaspari, M., Hultenby, K., Rustin, P., Gustafsson, C.M., and Larsson, N.-G.,

References

94

Mitochondrial transcription factor A regulates mtDNA copy number in mammals. Hum Mol Genet, 2004. 13(9): p. 935-44.

112. Ylikallio, E., Tyynismaa, H., Tsutsui, H., Ide, T., and Suomalainen, A., High mitochondrial DNA copy number has detrimental effects in mice. Hum Mol Genet, 2010. 19(13): p. 2695-705.

113. Larsson, N.G., Wang, J., Wilhelmsson, H., Oldfors, A., Rustin, P., Lewandoski, M., Barsh, G.S., and Clayton, D.A., Mitochondrial transcription factor A is necessary for mtDNA maintenance and embryogenesis in mice. Nat Genet, 1998. 18(3): p. 231-6.

114. Larsson, N.G., Oldfors, A., Holme, E., and Clayton, D.A., Low levels of mitochondrial transcription factor A in mitochondrial DNA depletion. Biochem Biophys Res Commun, 1994. 200(3): p. 1374-81.

115. Kanki, T., Ohgaki, K., Gaspari, M., Gustafsson, C.M., Fukuoh, A., Sasaki, N., Hamasaki, N., and Kang, D., Architectural role of mitochondrial transcription factor A in maintenance of human mitochondrial DNA. Mol Cell Biol, 2004. 24(22): p. 9823-34.

116. Baar, K., Wende, A.R., Jones, T.E., Marison, M., Nolte, L.A., Chen, M., Kelly, D.P., and Holloszy, J.O., Adaptations of skeletal muscle to exercise: rapid increase in the transcriptional coactivator PGC-1. FASEB J, 2002. 16(14): p. 1879-86.

117. Pilegaard, H., Saltin, B., and Neufer, P.D., Exercise induces transient transcriptional activation of the PGC-1alpha gene in human skeletal muscle. J Physiol (Lond), 2003. 546(Pt 3): p. 851-8.

118. Puigserver, P., Wu, Z., Park, C.W., Graves, R., Wright, M., and Spiegelman, B.M., A cold-inducible coactivator of nuclear receptors linked to adaptive thermogenesis. Cell, 1998. 92(6): p. 829-39.

119. Zhu, L., Wang, Q., Zhang, L., Fang, Z., Zhao, F., Lv, Z., Gu, Z., Zhang, J., Wang, J., Zen, K., Xiang, Y., Wang, D., and Zhang, C.-Y., Hypoxia induces PGC-1α expression and mitochondrial biogenesis in the myocardium of TOF patients. Cell Res, 2010. 20(6): p. 676-87.

120. Wu, Z., Puigserver, P., Andersson, U., Zhang, C., Adelmant, G., Mootha, V., Troy, A., Cinti, S., Lowell, B., Scarpulla, R.C., and Spiegelman, B.M., Mechanisms controlling mitochondrial biogenesis and respiration through the thermogenic coactivator PGC-1. Cell, 1999. 98(1): p. 115-24.

121. Jornayvaz, F.R. and Shulman, G.I., Regulation of mitochondrial biogenesis. Essays Biochem, 2010. 47: p. 10.1042/bse0470069.

122. Lin, J., Handschin, C., and Spiegelman, B.M., Metabolic control through the PGC-1 family of transcription coactivators. Cell Metab, 2005. 1(6): p. 361-70.

123. Battersby, B.J. and Richter, U., Why translation counts for mitochondria – retrograde signalling links mitochondrial protein synthesis to mitochondrial biogenesis and cell proliferation. J Cell Sci, 2013. 126(19): p. 4331-4338.

124. Chen, X.J. and Butow, R.A., The organization and inheritance of the mitochondrial genome. Nat Rev Genet, 2005. 6(11): p. 815-825.

125. Garrido, N., Griparic, L., Jokitalo, E., Wartiovaara, J., van der Bliek, A.M., and Spelbrink, J.N., Composition and dynamics of human mitochondrial nucleoids. Mol Biol Cell, 2003. 14(4): p. 1583-96.

126. Legros, F., Malka, F., Frachon, P., Lombès, A., and Rojo, M., Organization and dynamics of human mitochondrial DNA. J Cell Sci, 2004. 117(Pt 13): p. 2653-62.

127. Iborra, F.J., Kimura, H., and Cook, P.R., The functional organization of mitochondrial genomes in human cells. BMC Biol, 2004. 2: p. 9.

128. Kukat, C., Davies, K.M., Wurm, C.A., Spåhr, H., Bonekamp, N.A., Kühl, I., Joos, F., Polosa, P.L., Park, C.B., Posse, V., Falkenberg, M.,

95

Jakobs, S., Kühlbrandt, W., and Larsson, N.-G., Cross-strand binding of TFAM to a single mtDNA molecule forms the mitochondrial nucleoid. Proc Natl Acad Sci U S A, 2015.

129. Kukat, C., Wurm, C.A., Spåhr, H., Falkenberg, M., Larsson, N.-G., and Jakobs, S., Super-resolution microscopy reveals that mammalian mitochondrial nucleoids have a uniform size and frequently contain a single copy of mtDNA. Proc Natl Acad Sci USA, 2011. 108(33): p. 13534-9.

130. Brown, T.A., Tkachuk, A.N., Shtengel, G., Kopek, B.G., Bogenhagen, D.F., Hess, H.F., and Clayton, D.A., Superresolution Fluorescence Imaging of Mitochondrial Nucleoids Reveals Their Spatial Range, Limits, and Membrane Interaction. Mol Cell Biol, 2011. 31(24): p. 4994-5010.

131. Satoh, M. and Kuroiwa, T., Organization of multiple nucleoids and DNA molecules in mitochondria of a human cell. Exp Cell Res, 1991. 196(1): p. 137-140.

132. Rubio-Cosials, A., Sidow, J.F., Jiménez-Menéndez, N., Fernández-Millán, P., Montoya, J., Jacobs, H.T., Coll, M., Bernadó, P., and Solà, M., Human mitochondrial transcription factor A induces a U-turn structure in the light strand promoter. Nat Struct Mol Biol, 2011. 18(11): p. 1281-1289.

133. Ngo, H.B., Kaiser, J.T., and Chan, D.C., The mitochondrial transcription and packaging factor Tfam imposes a U-turn on mitochondrial DNA. Nat Struct Mol Biol, 2011. 18(11): p. 1290-1296.

134. Kaufman, B.A., Durisic, N., Mativetsky, J.M., Costantino, S., Hancock, M.A., Grutter, P., and Shoubridge, E.A., The mitochondrial transcription factor TFAM coordinates the assembly of multiple DNA molecules into nucleoid-like structures. Mol Biol Cell, 2007. 18(9): p. 3225-36.

135. Fisher, R.P., Lisowsky, T., Parisi, M.A., and Clayton, D.A., DNA wrapping and bending by a mitochondrial high mobility group-like transcriptional activator protein. J Biol Chem, 1992. 267(5): p. 3358-67.

136. Bogenhagen, D.F., Mitochondrial DNA nucleoid structure. Biochim Biophys Acta, 2011: p. 10.1016/j.bbagrm.2011.11.005.

137. Jacobs, H.T., Lehtinen, S.K., and Spelbrink, J.N., No sex please, we're mitochondria: a hypothesis on the somatic unit of inheritance of mammalian mtDNA. Bioessays, 2000. 22(6): p. 564-572.

138. D'Aurelio, M., Gajewski, C.D., Lin, M.T., Mauck, W.M., Shao, L.Z., Lenaz, G., Moraes, C.T., and Manfredi, G., Heterologous mitochondrial DNA recombination in human cells. Hum Mol Genet, 2004. 13(24): p. 3171-3179.

139. Nunnari, J., Marshall, W.F., Straight, A., Murray, A., Sedat, J.W., and Walter, P., Mitochondrial transmission during mating in Saccharomyces cerevisiae is determined by mitochondrial fusion and fission and the intramitochondrial segregation of mitochondrial DNA. Mol Biol Cell, 1997. 8(7): p. 1233-42.

140. Gilkerson, R.W., Schon, E.A., Hernandez, E., and Davidson, M.M., Mitochondrial nucleoids maintain genetic autonomy but allow for functional complementation. J Cell Biol, 2008. 181(7): p. 1117-28.

141. Giles, R.E., Blanc, H., Cann, H.M., and Wallace, D.C., Maternal inheritance of human mitochondrial DNA. Proc Natl Acad Sci USA, 1980. 77(11): p. 6715-9.

142. Al Rawi, S., Louvet-Vallée, S., Djeddi, A., Sachse, M., Culetto, E., Hajjar, C., Boyd, L., Legouis, R., and Galy, V., Postfertilization

References

96

autophagy of sperm organelles prevents paternal mitochondrial DNA transmission. Science, 2011. 334(6059): p. 1144-7.

143. Kaneda, H., Hayashi, J., Takahama, S., Taya, C., Lindahl, K.F., and Yonekawa, H., Elimination of paternal mitochondrial DNA in intraspecific crosses during early mouse embryogenesis. Proc Natl Acad Sci U S A, 1995. 92(10): p. 4542-6.

144. Schwartz, M. and Vissing, J., Paternal Inheritance of Mitochondrial DNA. N Engl J Med, 2002. 347(8): p. 576-580.

145. Pyle, A., Hudson, G., Wilson, I.J., Coxhead, J., Smertenko, T., Herbert, M., Santibanez-Koref, M., and Chinnery, P.F., Extreme-Depth Re-sequencing of Mitochondrial DNA Finds No Evidence of Paternal Transmission in Humans. PLoS Genet, 2015. 11(5): p. e1005040.

146. Stewart, J.B. and Larsson, N.-G., Keeping mtDNA in shape between generations. PLoS Genet, 2014. 10(10): p. e1004670.

147. Hauswirth, W.W. and Laipis, P.J., Mitochondrial DNA polymorphism in a maternal lineage of Holstein cows. Proc Natl Acad Sci USA, 1982. 79(15): p. 4686-90.

148. Olivo, P.D., Van de Walle, M.J., Laipis, P.J., and Hauswirth, W.W., Nucleotide sequence evidence for rapid genotypic shifts in the bovine mitochondrial DNA D-loop. Nature, 1983. 306(5941): p. 400-402.

149. Jenuth, J.P., Peterson, A.C., Fu, K., and Shoubridge, E.A., Random genetic drift in the female germline explains the rapid segregation of mammalian mitochondrial DNA. Nat Genet, 1996. 14(2): p. 146-51.

150. Cao, L., Shitara, H., Sugimoto, M., Hayashi, J.-I., Abe, K., and Yonekawa, H., New Evidence Confirms That the Mitochondrial Bottleneck Is Generated without Reduction of Mitochondrial DNA Content in Early Primordial Germ Cells of Mice. PLoS Genet, 2009. 5(12): p. e1000756.

151. Cao, L., Shitara, H., Horii, T., Nagao, Y., Imai, H., Abe, K., Hara, T., Hayashi, J.-I., and Yonekawa, H., The mitochondrial bottleneck occurs without reduction of mtDNA content in female mouse germ cells. Nat Genet, 2007. 39(3): p. 386-390.

152. Taguchi, N., Ishihara, N., Jofuku, A., Oka, T., and Mihara, K., Mitotic phosphorylation of dynamin-related GTPase Drp1 participates in mitochondrial fission. J Biol Chem, 2007. 282(15): p. 11521-9.

153. Mitra, K., Wunder, C., Roysam, B., Lin, G., and Lippincott-Schwartz, J., A hyperfused mitochondrial state achieved at G1-S regulates cyclin E buildup and entry into S phase. Proc Natl Acad Sci USA, 2009. 106(29): p. 11960-5.

154. Chinnery, P.F. and Samuels, D.C., Relaxed replication of mtDNA: A model with implications for the expression of disease. Am J Hum Genet, 1999. 64(4): p. 1158-65.

155. Gorman, G.S., Schaefer, A.M., Ng, Y., Gomez, N., Blakely, E.L., Alston, C.L., Feeney, C., Horvath, R., Yu-Wai-Man, P., Chinnery, P.F., Taylor, R.W., Turnbull, D.M., and McFarland, R., Prevalence of nuclear and mitochondrial DNA mutations related to adult mitochondrial disease. Ann Neurol, 2015. 77(5): p. 753-9.

156. Schaefer, A.M., McFarland, R., Blakely, E.L., He, L., Whittaker, R.G., Taylor, R.W., Chinnery, P.F., and Turnbull, D.M., Prevalence of mitochondrial DNA disease in adults. Ann Neurol, 2008. 63(1): p. 35-9.

157. Skladal, D., Halliday, J., and Thorburn, D.R., Minimum birth prevalence of mitochondrial respiratory chain disorders in children. Brain, 2003. 126(8): p. 1905-1912.

97

158. Elliott, H.R., Samuels, D.C., Eden, J.A., Relton, C.L., and Chinnery, P.F., Pathogenic Mitochondrial DNA Mutations Are Common in the General Population. Am J Hum Genet, 2008. 83(2): p. 254-260.

159. Delettre, C., Lenaers, G., Griffoin, J.-M., Gigarel, N., Lorenzo, C., Belenguer, P., Pelloquin, L., Grosgeorge, J., Turc-Carel, C., Perret, E., Astarie-Dequeker, C., Lasquellec, L., Arnaud, B., Ducommun, B., Kaplan, J., and Hamel, C.P., Nuclear gene OPA1, encoding a mitochondrial dynamin-related protein, is mutated in dominant optic atrophy. Nat Genet, 2000. 26(2): p. 207-210.

160. Skidd, P.M., Lessell, S., and Cestari, D.M., Autosomal Dominant Hereditary Optic Neuropathy (ADOA): A Review of the Genetics and Clinical Manifestations of ADOA and ADOA+. Semin Ophthalmol, 2013. 28(5-6): p. 422-426.

161. Spiegel, R., Saada, A., Flannery, P.J., Burté, F., Soiferman, D., Khayat, M., Eisner, V., Vladovski, E., Taylor, R.W., Bindoff, L.A., Shaag, A., Mandel, H., Schuler-Furman, O., Shalev, S.A., Elpeleg, O., and Yu-Wai-Man, P., Fatal infantile mitochondrial encephalomyopathy, hypertrophic cardiomyopathy and optic atrophy associated with a homozygous OPA1 mutation. J Med Genet, 2015.

162. Calvo, J., Funalot, B., Ouvrier, R.A., and et al., GEnotype-phenotype correlations in charcot-marie-tooth disease type 2 caused by mitofusin 2 mutations. Arch Neurol, 2009. 66(12): p. 1511-1516.

163. Waterham, H.R., Koster, J., van Roermund, C.W.T., Mooyer, P.A.W., Wanders, R.J.A., and Leonard, J.V., A lethal defect of mitochondrial and peroxisomal fission. N Engl J Med, 2007. 356(17): p. 1736-41.

164. Vanstone, J.R., Smith, A.M., McBride, S., Naas, T., Holcik, M., Antoun, G., Harper, M.-E., Michaud, J., Sell, E., Chakraborty, P., Tetreault, M., Care4Rare, C., Majewski, J., Baird, S., Boycott, K.M., Dyment, D.A., MacKenzie, A., and Lines, M.A., DNM1L-related mitochondrial fission defect presenting as refractory epilepsy. Eur J Hum Genet, 2015.

165. Shahni, R., Cale, C.M., Anderson, G., Osellame, L.D., Hambleton, S., Jacques, T.S., Wedatilake, Y., Taanman, J.-W., Chan, E., Qasim, W., Plagnol, V., Chalasani, A., Duchen, M.R., Gilmour, K.C., and Rahman, S., Signal transducer and activator of transcription 2 deficiency is a novel disorder of mitochondrial fission. Brain, 2015.

166. Shamseldin, H.E., Alshammari, M., Al-Sheddi, T., Salih, M.A., Alkhalidi, H., Kentab, A., Repetto, G.M., Hashem, M., and Alkuraya, F.S., Genomic analysis of mitochondrial diseases in a consanguineous population reveals novel candidate disease genes. J Med Genet, 2012. 49(4): p. 234-241.

167. Boulet, L., Karpati, G., and Shoubridge, E.A., Distribution and threshold expression of the tRNA(Lys) mutation in skeletal muscle of patients with myoclonic epilepsy and ragged-red fibers (MERRF). Am J Hum Genet, 1992. 51(6): p. 1187-200.

168. Yoneda, M., Miyatake, T., and Attardi, G., Heteroplasmic mitochondrial tRNA(Lys) mutation and its complementation in MERRF patient-derived mitochondrial transformants. Muscle Nerve Suppl, 1995. 3: p. S95-101.

169. Hayashi, J., Ohta, S., Kikuchi, A., Takemitsu, M., Goto, Y., and Nonaka, I., Introduction of disease-related mitochondrial DNA deletions into HeLa cells lacking mitochondrial DNA results in mitochondrial dysfunction. Proc Natl Acad Sci USA, 1991. 88(23): p. 10614-8.

170. Sacconi, S., Salviati, L., Nishigaki, Y., Walker, W.F., Hernandez-Rosa, E., Trevisson, E., Delplace, S., Desnuelle, C., Shanske, S., Hirano, M.,

References

98

Schon, E.A., Bonilla, E., De Vivo, D.C., DiMauro, S., and Davidson, M.M., A functionally dominant mitochondrial DNA mutation. Hum Mol Genet, 2008. 17(12): p. 1814-1820.

171. Kobayashi, Y., Momoi, M.Y., Tominaga, K., Momoi, T., Nihei, K., Yanagisawa, M., Kagawa, Y., and Ohta, S., A point mutation in the mitochondrial tRNA(Leu)(UUR) gene in MELAS (mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes). Biochem Biophys Res Commun, 1990. 173(3): p. 816-22.

172. Goto, Y., Nonaka, I., and Horai, S., A mutation in the tRNA(Leu)(UUR) gene associated with the MELAS subgroup of mitochondrial encephalomyopathies. Nature, 1990. 348(6302): p. 651-3.

173. Moraes, C.T., Ciacci, F., Silvestri, G., Shanske, S., Sciacco, M., Hirano, M., Schon, E.A., Bonilla, E., and DiMauro, S., Atypical clinical presentations associated with the MELAS mutation at position 3243 of human mitochondrial DNA. Neuromuscul Disord, 1993. 3(1): p. 43-50.

174. Reardon, W., Ross, R.J., Sweeney, M.G., Luxon, L.M., Pembrey, M.E., Harding, A.E., and Trembath, R.C., Diabetes mellitus associated with a pathogenic point mutation in mitochondrial DNA. Lancet, 1992. 340(8832): p. 1376-9.

175. Vilarinho, L., Santorelli, F.M., Rosas, M.J., Tavares, C., Melo-Pires, M., and DiMauro, S., The mitochondrial A3243G mutation presenting as severe cardiomyopathy. J Med Genet, 1997. 34(7): p. 607-609.

176. Tuppen, H.A.L., Blakely, E.L., Turnbull, D.M., and Taylor, R.W., Mitochondrial DNA mutations and human disease. Biochimica et Biophysica Acta (BBA) - Bioenergetics, 2010. 1797(2): p. 113-128.

177. Mita, S., Tokunaga, M., Uyama, E., Kumamoto, T., Uekawa, K., and Uchino, M., Single muscle fiber analysis of myoclonus epilepsy with ragged-red fibers. Muscle Nerve, 1998. 21(4): p. 490-7.

178. Marzuki, S., Berkovic, S.F., Saifuddin Noer, A., Kapsa, R.M., Kalnins, R.M., Byrne, E., Sasmono, T., and Sudoyo, H., Developmental genetics of deleted mtDNA in mitochondrial oculomyopathy. J Neurol Sci, 1997. 145(2): p. 155-62.

179. Chinnery, P.F., Howell, N., Lightowlers, R.N., and Turnbull, D.M., Molecular pathology of MELAS and MERRF. The relationship between mutation load and clinical phenotypes. Brain, 1997. 120 ( Pt 10): p. 1713-21.

180. Fu, K., Hartlen, R., Johns, T., Genge, A., Karpati, G., and Shoubridge, E.A., A novel heteroplasmic tRNAleu(CUN) mtDNA point mutation in a sporadic patient with mitochondrial encephalomyopathy segregates rapidly in skeletal muscle and suggests an approach to therapy. Hum Mol Genet, 1996. 5(11): p. 1835-40.

181. Tokunaga, M., Mita, S., Murakami, T., Kumamoto, T., Uchino, M., Nonaka, I., and Ando, M., Single muscle fiber analysis of mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS). Ann Neurol, 1994. 35(4): p. 413-9.

182. Petruzzella, V., Moraes, C.T., Sano, M.C., Bonilla, E., DiMauro, S., and Schon, E.A., Extremely high levels of mutant mtDNAs co-localize with cytochrome c oxidase-negative ragged-red fibers in patients harboring a point mutation at nt 3243. Hum Mol Genet, 1994. 3(3): p. 449-54.

183. Spyropoulos, A., Manford, M., Horvath, R., Alston, C.L., Yu-Wai-Man, P., He, L., Taylor, R.W., and Chinnery, P.F., Near-identical segregation of mtDNA heteroplasmy in blood, muscle, urinary epithelium, and hair follicles in twins with optic atrophy, ptosis, and intractable epilepsy. JAMA Neurol, 2013. 70(12): p. 1552-5.

99

184. Larsson, N.G., Holme, E., Kristiansson, B., Oldfors, A., and Tulinius, M., Progressive increase of the mutated mitochondrial DNA fraction in Kearns-Sayre syndrome. Pediatr Res, 1990. 28(2): p. 131-6.

185. Shoffner, J.M., Lott, M.T., Voljavec, A.S., Soueidan, S.A., Costigan, D.A., and Wallace, D.C., Spontaneous Kearns-Sayre/chronic external ophthalmoplegia plus syndrome associated with a mitochondrial DNA deletion: a slip-replication model and metabolic therapy. Proc Natl Acad Sci U S A, 1989. 86(20): p. 7952-7956.

186. Cortopassi, G.A., Shibata, D., Soong, N.W., and Arnheim, N., A pattern of accumulation of a somatic deletion of mitochondrial DNA in aging human tissues. Proc Natl Acad Sci U S A, 1992. 89(16): p. 7370-7374.

187. Corral-Debrinski, M., Horton, T., Lott, M.T., Shoffner, J.M., Beal, M.F., and Wallace, D.C., Mitochondrial DNA deletions in human brain: regional variability and increase with advanced age. Nat Genet, 1992. 2(4): p. 324-9.

188. Rötig, A., Cormier, V., Blanche, S., Bonnefont, J.P., Ledeist, F., Romero, N., Schmitz, J., Rustin, P., Fischer, A., and Saudubray, J.M., Pearson's marrow-pancreas syndrome. A multisystem mitochondrial disorder in infancy. J Clin Invest, 1990. 86(5): p. 1601-1608.

189. Larsson, N.G., Tulinius, M.H., Holme, E., Oldfors, A., Andersen, O., Wahlström, J., and Aasly, J., Segregation and manifestations of the mtDNA tRNA(Lys) A-->G(8344) mutation of myoclonus epilepsy and ragged-red fibers (MERRF) syndrome. Am J Hum Genet, 1992. 51(6): p. 1201-1212.

190. Weber, K., Wilson, J.N., Taylor, L., Brierley, E., Johnson, M.A., Turnbull, D.M., and Bindoff, L.A., A new mtDNA mutation showing accumulation with time and restriction to skeletal muscle. Am J Hum Genet, 1997. 60(2): p. 373-80.

191. Harding, A.E., Holt, I.J., Sweeney, M.G., Brockington, M., and Davis, M.B., Prenatal diagnosis of mitochondrial DNA8993 T----G disease. Am J Hum Genet, 1992. 50(3): p. 629-633.

192. Matthews, P.M., Hopkin, J., Brown, R.M., Stephenson, J.B., Hilton-Jones, D., and Brown, G.K., Comparison of the relative levels of the 3243 (A-->G) mtDNA mutation in heteroplasmic adult and fetal tissues. J Med Genet, 1994. 31(1): p. 41-44.

193. Monnot, S., Gigarel, N., Samuels, D.C., Burlet, P., Hesters, L., Frydman, N., Frydman, R., Kerbrat, V., Funalot, B., Martinovic, J., Benachi, A., Feingold, J., Munnich, A., Bonnefont, J.-P., and Steffann, J., Segregation of mtDNA throughout human embryofetal development: m.3243A>G as a model system. Hum Mutat, 2011. 32(1): p. 116-25.

194. Elson, J.L., Samuels, D.C., Turnbull, D.M., and Chinnery, P.F., Random intracellular drift explains the clonal expansion of mitochondrial DNA mutations with age. Am J Hum Genet, 2001. 68(3): p. 802-6.

195. Rahman, S., Poulton, J., Marchington, D., and Suomalainen, A., Decrease of 3243 A-->G mtDNA mutation from blood in MELAS syndrome: a longitudinal study. Am J Hum Genet, 2001. 68(1): p. 238-40.

196. Chinnery, P.F., Zwijnenburg, P.J., Walker, M., Howell, N., Taylor, R.W., Lightowlers, R.N., Bindoff, L., and Turnbull, D.M., Nonrandom tissue distribution of mutant mtDNA. Am J Med Genet, 1999. 85(5): p. 498-501.

197. 't Hart, L.M., Jansen, J.J., Lemkes, H.H., de Knijff, P., and Maassen, J.A., Heteroplasmy levels of a mitochondrial gene mutation associated

References

100

with diabetes mellitus decrease in leucocyte DNA upon aging. Hum Mutat, 1996. 7(3): p. 193-7.

198. Macmillan, C., Lach, B., and Shoubridge, E.A., Variable distribution of mutant mitochondria1 DNAs (tRNALeu[3243]) in tissues of symptomatic relatives with MELAS: The role of mitotic segregation. Neurology, 1993. 43(8): p. 1586.

199. Rajasimha, H.K., Chinnery, P.F., and Samuels, D.C., Selection against pathogenic mtDNA mutations in a stem cell population leads to the loss of the 3243A-->G mutation in blood. Am J Hum Genet, 2008. 82(2): p. 333-43.

200. White, S.L., Shanske, S., McGill, J.J., Mountain, H., Geraghty, M.T., DiMauro, S., Dahl, H.H.M., and Thorburn, D.R., Mitochondrial DNA mutations at nucleotide 8993 show a lack of tissue- or age-related variation. J Inherit Metab Dis, 1999. 22(8): p. 899-914.

201. Brown, D.T., Samuels, D.C., Michael, E.M., Turnbull, D.M., and Chinnery, P.F., Random Genetic Drift Determines the Level of Mutant mtDNA in Human Primary Oocytes. Am J Hum Genet, 2001. 68(2): p. 533-536.

202. Wonnapinij, P., Chinnery, P.F., and Samuels, D.C., The distribution of mitochondrial DNA heteroplasmy due to random genetic drift. Am J Hum Genet, 2008. 83(5): p. 582-93.

203. Steffann, J., Gigarel, N., Corcos, J., Bonnière, M., Encha-Razavi, F., Sinico, M., Prevot, S., Dumez, Y., Yamgnane, A., Frydman, R., Munnich, A., and Bonnefont, J.P., Stability of the m.8993T→G mtDNA mutation load during human embryofetal development has implications for the feasibility of prenatal diagnosis in NARP syndrome. J Med Genet, 2007. 44(10): p. 664-669.

204. Blok, R.B., Gook, D.A., Thorburn, D.R., and Dahl, H.H., Skewed segregation of the mtDNA nt 8993 (T-->G) mutation in human oocytes. Am J Hum Genet, 1997. 60(6): p. 1495-1501.

205. Steffann, J., Frydman, N., Gigarel, N., Burlet, P., Ray, P.F., Fanchin, R., Feyereisen, E., Kerbrat, V., Tachdjian, G., Bonnefont, J.-P., Frydman, R., and Munnich, A., Analysis of mtDNA variant segregation during early human embryonic development: a tool for successful NARP preimplantation diagnosis. J Med Genet, 2006. 43(3): p. 244-247.

206. He, Y., Wu, J., Dressman, D.C., Iacobuzio-Donahue, C., Markowitz, S.D., Velculescu, V.E., Diaz, L.A., Kinzler, K.W., Vogelstein, B., and Papadopoulos, N., Heteroplasmic mitochondrial DNA mutations in normal and tumour cells. Nature, 2010. 464(7288): p. 610-4.

207. Payne, B.A.I., Wilson, I.J., Yu-Wai-Man, P., Coxhead, J., Deehan, D., Horvath, R., Taylor, R.W., Samuels, D.C., Santibanez-Koref, M., and Chinnery, P.F., Universal heteroplasmy of human mitochondrial DNA. Hum Mol Genet, 2012: p. 10.1093/hmg/dds435.

208. Samuels, D.C., Li, C., Li, B., Song, Z., Torstenson, E., Boyd Clay, H., Rokas, A., Thornton-Wells, T.A., Moore, J.H., Hughes, T.M., Hoffman, R.D., Haines, J.L., Murdock, D.G., Mortlock, D.P., and Williams, S.M., Recurrent Tissue-Specific mtDNA Mutations Are Common in Humans. PLoS Genetics, 2013. 9(11): p. e1003929.

209. Li, M., Schönberg, A., Schaefer, M., Schroeder, R., Nasidze, I., and Stoneking, M., Detecting Heteroplasmy from High-Throughput Sequencing of Complete Human Mitochondrial DNA Genomes. Am J Hum Genet, 2010. 87(2): p. 237-249.

210. Ye, K., Lu, J., Ma, F., Keinan, A., and Gu, Z., Extensive pathogenicity of mitochondrial heteroplasmy in healthy human individuals. Proc Natl Acad Sci U S A, 2014. 111(29): p. 10654-10659.

101

211. Li, M., Schröder, R., Ni, S., Madea, B., and Stoneking, M., Extensive tissue-related and allele-related mtDNA heteroplasmy suggests positive selection for somatic mutations. Proc Natl Acad Sci USA, 2015. 112(8): p. 2491-6.

212. Bratic, A., Larsson, N.-G., xF, and ran, The role of mitochondria in aging. J Clin Invest, 2013. 123(3): p. 951-957.

213. Simonetti, S., Chen, X., DiMauro, S., and Schon, E.A., Accumulation of deletions in human mitochondrial DNA during normal aging: analysis by quantitative PCR. Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease, 1992. 1180(2): p. 113-122.

214. Pallotti, F., Chen, X., Bonilla, E., and Schon, E.A., Evidence that specific mtDNA point mutations may not accumulate in skeletal muscle during normal human aging. Am J Hum Genet, 1996. 59(3): p. 591-602.

215. Greaves, L.C., Elson, J.L., Nooteboom, M., Grady, J.P., Taylor, G.A., Taylor, R.W., Mathers, J.C., Kirkwood, T.B., and Turnbull, D.M., Comparison of mitochondrial mutation spectra in ageing human colonic epithelium and disease: absence of evidence for purifying selection in somatic mitochondrial DNA point mutations. PLoS Genet, 2012. 8(11): p. e1003082.

216. Kujoth, G.C., Hiona, A., Pugh, T.D., Someya, S., Panzer, K., Wohlgemuth, S.E., Hofer, T., Seo, A.Y., Sullivan, R., Jobling, W.A., Morrow, J.D., Van Remmen, H., Sedivy, J.M., Yamasoba, T., Tanokura, M., Weindruch, R., Leeuwenburgh, C., and Prolla, T.A., Mitochondrial DNA Mutations, Oxidative Stress, and Apoptosis in Mammalian Aging. Science, 2005. 309(5733): p. 481-484.

217. Trifunovic, A., Wredenberg, A., Falkenberg, M., Spelbrink, J.N., Rovio, A.T., Bruder, C.E., Bohlooly-Y, M., Gidlof, S., Oldfors, A., Wibom, R., Tornell, J., Jacobs, H.T., and Larsson, N.-G., Premature ageing in mice expressing defective mitochondrial DNA polymerase. Nature, 2004. 429(6990): p. 417-423.

218. Ahlqvist, K.J., Hämäläinen, R.H., Yatsuga, S., Uutela, M., Terzioglu, M., Götz, A., Forsström, S., Salven, P., Angers-Loustau, A., Kopra, O.H., Tyynismaa, H., Larsson, N.-G., Wartiovaara, K., Prolla, T., Trifunovic, A., and Suomalainen, A., Somatic progenitor cell vulnerability to mitochondrial DNA mutagenesis underlies progeroid phenotypes in polg mutator mice. Cell Metab, 2012. 15(1): p. 100-9.

219. Ahlqvist, K.J., Suomalainen, A., and Hämäläinen, R.H., Stem cells, mitochondria and aging. Biochimica et Biophysica Acta (BBA) - Bioenergetics, 2015. 1847(11): p. 1380-1386.

220. Polyak, K., Li, Y., Zhu, H., Lengauer, C., Willson, J.K., Markowitz, S.D., Trush, M.A., Kinzler, K.W., and Vogelstein, B., Somatic mutations of the mitochondrial genome in human colorectal tumours. Nat Genet, 1998. 20(3): p. 291-3.

221. He, L., Luo, L., Proctor, S.J., Middleton, P.G., Blakely, E.L., Taylor, R.W., and Turnbull, D.M., Somatic mitochondrial DNA mutations in adult-onset leukaemia. Leukemia, 2003. 17(12): p. 2487-2491.

222. Fliss, M.S., Usadel, H., Caballero, O.L., Wu, L., Buta, M.R., Eleff, S.M., Jen, J., and Sidransky, D., Facile detection of mitochondrial DNA mutations in tumors and bodily fluids. Science, 2000. 287(5460): p. 2017-9.

223. Kirches, E., Krause, G., Warich-Kirches, M., Weis, S., Schneider, T., Meyer-Puttlitz, B., Mawrin, C., and Dietzmann, K., High frequency of mitochondrial DNA mutations in glioblastoma multiforme identified by direct sequence comparison to blood samples. Int J Cancer, 2001. 93(4): p. 534-538.

References

102

224. Coller, H.A., Khrapko, K., Bodyak, N.D., Nekhaeva, E., Herrero-Jimenez, P., and Thilly, W.G., High frequency of homoplasmic mitochondrial DNA mutations in human tumors can be explained without selection. Nat Genet, 2001. 28(2): p. 147-50.

225. Swerdlow, R.H., Mitochondria in cybrids containing mtDNA from persons with mitochondriopathies. J Neurosci Res, 2007. 85(15): p. 3416-3428.

226. Lehtinen, S.K., Hance, N., El Meziane, A., Juhola, M.K., Juhola, K.M., Karhu, R., Spelbrink, J.N., Holt, I.J., and Jacobs, H.T., Genotypic stability, segregation and selection in heteroplasmic human cell lines containing np 3243 mutant mtDNA. Genetics, 2000. 154(1): p. 363-80.

227. Shoubridge, E.A., Segregation of mitochondrial DNAs carrying a pathogenic point mutation (tRNA(leu3243)) in cybrid cells. Biochem Biophys Res Commun, 1995. 213(1): p. 189-95.

228. Dunbar, D.R., Moonie, P.A., Jacobs, H.T., and Holt, I.J., Different cellular backgrounds confer a marked advantage to either mutant or wild-type mitochondrial genomes. Proc Natl Acad Sci USA, 1995. 92(14): p. 6562-6.

229. Sharpley, M.S., Marciniak, C., Eckel-Mahan, K., McManus, M., Crimi, M., Waymire, K., Lin, C.S., Masubuchi, S., Friend, N., Koike, M., Chalkia, D., MacGregor, G., Sassone-Corsi, P., and Wallace, D.C., Heteroplasmy of mouse mtDNA is genetically unstable and results in altered behavior and cognition. Cell, 2012. 151(2): p. 333-43.

230. Freyer, C., Cree, L.M., Mourier, A., Stewart, J.B., Koolmeister, C., Milenkovic, D., Wai, T., Floros, V.I., Hagström, E., Chatzidaki, E.E., Wiesner, R.J., Samuels, D.C., Larsson, N.-G., and Chinnery, P.F., Variation in germline mtDNA heteroplasmy is determined prenatally but modified during subsequent transmission. Nat Genet, 2012. 44(11): p. 1282-5.

231. Stewart, J.B., Freyer, C., Elson, J.L., Wredenberg, A., Cansu, Z., Trifunovic, A., and Larsson, N.-G., Strong purifying selection in transmission of mammalian mitochondrial DNA. PLoS Biol, 2008. 6(1): p. e10.

232. Fan, W., Waymire, K.G., Narula, N., Li, P., Rocher, C., Coskun, P.E., Vannan, M.A., Narula, J., Macgregor, G.R., and Wallace, D.C., A mouse model of mitochondrial disease reveals germline selection against severe mtDNA mutations. Science, 2008. 319(5865): p. 958-62.

233. Muller, H.J., The Relation of Recombination to Mutational Advance. Mutat Res, 1964. 106: p. 2-9.

234. Battersby, B.J. and Shoubridge, E.A., Selection of a mtDNA sequence variant in hepatocytes of heteroplasmic mice is not due to differences in respiratory chain function or efficiency of replication. Hum Mol Genet, 2001. 10(22): p. 2469-79.

235. Battersby, B.J., Redpath, M.E., and Shoubridge, E.A., Mitochondrial DNA segregation in hematopoietic lineages does not depend on MHC presentation of mitochondrially encoded peptides. Hum Mol Genet, 2005. 14(17): p. 2587-94.

236. Burgstaller, J.P., Johnston, I.G., Jones, N.S., Albrechtová, J., Kolbe, T., Vogl, C., Futschik, A., Mayrhofer, C., Klein, D., Sabitzer, S., Blattner, M., Gülly, C., Poulton, J., Rülicke, T., Piálek, J., Steinborn, R., and Brem, G., mtDNA Segregation in Heteroplasmic Tissues Is Common In Vivo and Modulated by Haplotype Differences and Developmental Stage. Cell Rep, 2014. 7(6): p. 2031-41.

103

237. Takeda, K., Takahashi, S., Onishi, A., Hanada, H., and Imai, H., Replicative advantage and tissue-specific segregation of RR mitochondrial DNA between C57BL/6 and RR heteroplasmic mice. Genetics, 2000. 155(2): p. 777-83.

238. Jenuth, J.P., Peterson, A.C., and Shoubridge, E.A., Tissue-specific selection for different mtDNA genotypes in heteroplasmic mice. Nat Genet, 1997. 16(1): p. 93-5.

239. Moreno-Loshuertos, R., Acín-Pérez, R., Fernández-Silva, P., Movilla, N., Pérez-Martos, A., Rodriguez de Cordoba, S., Gallardo, M.E., and Enríquez, J.A., Differences in reactive oxygen species production explain the phenotypes associated with common mouse mitochondrial DNA variants. Nat Genet, 2006. 38(11): p. 1261-8.

240. Battersby, B.J., Loredo-Osti, J.C., and Shoubridge, E.A., Nuclear genetic control of mitochondrial DNA segregation. Nat Genet, 2003. 33(2): p. 183-6.

241. Fischer Lindahl, K., Bocchieri, M., and Riblet, R., Maternally transmitted target antigen for unrestricted killing by NZB T lymphocytes. J Exp Med, 1980. 152(6): p. 1583-95.

242. Loveland, B., Wang, C.-R., Yonekawa, H., Hermel, E., and Lindahl, K.F., Maternally transmitted histocompatibility antigen of mice: A hydrophobic peptide of a mitochondrially encoded protein. Cell, 1990. 60(6): p. 971-980.

243. Wang, C.R. and Lindahl, K.F., Organization and structure of the H-2M4-M8 class I genes in the mouse major histocompatibility complex. Immunogenetics, 1993. 38(4): p. 258-71.

244. Ishikawa, K., Toyama-Sorimachi, N., Nakada, K., Morimoto, M., Imanishi, H., Yoshizaki, M., Sasawatari, S., Niikura, M., Takenaga, K., Yonekawa, H., and Hayashi, J.-I., The innate immune system in host mice targets cells with allogenic mitochondrial DNA. J Exp Med, 2010. 207(11): p. 2297-305.

245. Krücken, J., Schroetel, R.M.U., Müller, I.U., Saïdani, N., Marinovski, P., Benten, W.P.M., Stamm, O., and Wunderlich, F., Comparative analysis of the human gimap gene cluster encoding a novel GTPase family. Gene, 2004. 341: p. 291-304.

246. Poirier, G.M., Anderson, G., Huvar, A., Wagaman, P.C., Shuttleworth, J., Jenkinson, E., Jackson, M.R., Peterson, P.A., and Erlander, M.G., Immune-associated nucleotide-1 (IAN-1) is a thymic selection marker and defines a novel gene family conserved in plants. J Immunol, 1999. 163(9): p. 4960-9.

247. Reuber, T.L. and Ausubel, F.M., Isolation of Arabidopsis genes that differentiate between resistance responses mediated by the RPS2 and RPM1 disease resistance genes. Plant Cell, 1996. 8(2): p. 241-9.

248. Nitta, T., Nasreen, M., Seike, T., Goji, A., Ohigashi, I., Miyazaki, T., Ohta, T., Kanno, M., and Takahama, Y., IAN family critically regulates survival and development of T lymphocytes. PLoS Biol, 2006. 4(4): p. e103.

249. Stamm, O., Krücken, J., Schmitt-Wrede, H.-P., Benten, W.P.M., and Wunderlich, F., Human ortholog to mouse gene imap38 encoding an ER-localizable G-protein belongs to a gene family clustered on chromosome 7q32-36. Gene, 2002. 282(1-2): p. 159-67.

250. Krücken, J., Epe, M., Benten, W.P.M., Falkenroth, N., and Wunderlich, F., Malaria-suppressible expression of the anti-apoptotic triple GTPase mGIMAP8. J Cell Biochem, 2005. 96(2): p. 339-348.

251. Zenz, T., Roessner, A., Thomas, A., Fröhling, S., Döhner, H., Calabretta, B., and Dahéron, L., hIan5: the human ortholog to the rat Ian4/Iddm1/lyp is a new member of the Ian family that is

References

104

overexpressed in B-cell lymphoid malignancies. Genes Immun, 2004. 5(2): p. 109-16.

252. Sandal, T., Aumo, L., Hedin, L., Gjertsen, B.T., and Døskeland, S.O., Irod/Ian5: an inhibitor of gamma-radiation- and okadaic acid-induced apoptosis. Mol Biol Cell, 2003. 14(8): p. 3292-304.

253. MacMurray, A.J., Moralejo, D.H., Kwitek, A.E., Rutledge, E.A., Van Yserloo, B., Gohlke, P., Speros, S.J., Snyder, B., Schaefer, J., Bieg, S., Jiang, J., Ettinger, R.A., Fuller, J., Daniels, T.L., Pettersson, A., Orlebeke, K., Birren, B., Jacob, H.J., Lander, E.S., and Lernmark, A., Lymphopenia in the BB rat model of type 1 diabetes is due to a mutation in a novel immune-associated nucleotide (Ian)-related gene. Genome Res, 2002. 12(7): p. 1029-39.

254. Hornum, L., Rømer, J., and Markholst, H., The diabetes-prone BB rat carries a frameshift mutation in Ian4, a positional candidate of Iddm1. Diabetes, 2002. 51(6): p. 1972-9.

255. Cambot, M., Aresta, S., Kahn-Perlès, B., de Gunzburg, J., and Roméo, P.-H., Human immune associated nucleotide 1: a member of a new guanosine triphosphatase family expressed in resting T and B cells. Blood, 2002. 99(9): p. 3293-301.

256. Dahéron, L., Zenz, T., Siracusa, L.D., Brenner, C., and Calabretta, B., Molecular cloning of Ian4: a BCR/ABL-induced gene that encodes an outer membrane mitochondrial protein with GTP-binding activity. Nucleic Acids Res, 2001. 29(6): p. 1308-16.

257. Krücken, J., Stamm, O., Schmitt-Wrede, H.P., Mincheva, A., Lichter, P., and Wunderlich, F., Spleen-specific expression of the malaria-inducible intronless mouse gene imap38. J Biol Chem, 1999. 274(34): p. 24383-91.

258. Krücken, J., Schmitt-Wrede, H.P., Markmann-Mulisch, U., and Wunderlich, F., Novel gene expressed in spleen cells mediating acquired testosterone-resistant immunity to Plasmodium chabaudi malaria. Biochem Biophys Res Commun, 1997. 230(1): p. 167-70.

259. Wong, V.W., Saunders, A.E., Hutchings, A., Pascall, J.C., Carter, C., Bright, N.A., Walker, S.A., Ktistakis, N.T., and Butcher, G.W., The autoimmunity-related GIMAP5 GTPase is a lysosome-associated protein. Self Nonself, 2010. 1(3): p. 259-268.

260. Schwefel, D., Fröhlich, C., Eichhorst, J., Wiesner, B., Behlke, J., Aravind, L., and Daumke, O., Structural basis of oligomerization in septin-like GTPase of immunity-associated protein 2 (GIMAP2). Proc Natl Acad Sci USA, 2010. 107(47): p. 20299-304.

261. Schwefel, D., Arasu, B.S., Marino, S.F., Lamprecht, B., Köchert, K., Rosenbaum, E., Eichhorst, J., Wiesner, B., Behlke, J., Rocks, O., Mathas, S., and Daumke, O., Structural insights into the mechanism of GTPase activation in the GIMAP family. Structure, 2013. 21(4): p. 550-9.

262. Schnell, S., Démollière, C., van den Berk, P., and Jacobs, H., Gimap4 accelerates T-cell death. Blood, 2006. 108(2): p. 591-9.

263. Saunders, A., Lamb, T., Pascall, J., Hutchings, A., Dion, C., Carter, C., Hepburn, L., Langhorne, J., and Butcher, G.W., Expression of GIMAP1, a GTPase of the immunity-associated protein family, is not up-regulated in malaria. Malar J, 2009. 8: p. 53.

264. Chen, Y., Yu, M., Dai, X., Zogg, M., Wen, R., Weiler, H., and Wang, D., Critical role for Gimap5 in the survival of mouse hematopoietic stem and progenitor cells. J Exp Med, 2011: p. 10.1084/jem.20101192.

265. Pino, S.C., O'Sullivan-Murphy, B., Lidstone, E.A., Yang, C., Lipson, K.L., Jurczyk, A., diIorio, P., Brehm, M.A., Mordes, J.P., Greiner, D.L., Rossini, A.A., and Bortell, R., CHOP mediates endoplasmic reticulum

105

stress-induced apoptosis in Gimap5-deficient T cells. PLoS One, 2009. 4(5): p. e5468.

266. Dalberg, U., Markholst, H., and Hornum, L., Both Gimap5 and the diabetogenic BBDP allele of Gimap5 induce apoptosis in T cells. Int Immunol, 2007. 19(4): p. 447-53.

267. Dion, C., Carter, C., Hepburn, L., Coadwell, W.J., Morgan, G., Graham, M., Pugh, N., Anderson, G., Butcher, G.W., and Miller, J.R., Expression of the Ian family of putative GTPases during T cell development and description of an Ian with three sets of GTP/GDP-binding motifs. Int Immunol, 2005. 17(9): p. 1257-68.

268. Michalkiewicz, M., Michalkiewicz, T., Ettinger, R.A., Rutledge, E.A., Fuller, J.M., Moralejo, D.H., Van Yserloo, B., MacMurray, A.J., Kwitek, A.E., Jacob, H.J., Lander, E.S., and Lernmark, A., Transgenic rescue demonstrates involvement of the Ian5 gene in T cell development in the rat. Physiol Genomics, 2004. 19(2): p. 228-32.

269. Pandarpurkar, M., Wilson-Fritch, L., Corvera, S., Markholst, H., Hornum, L., Greiner, D.L., Mordes, J.P., Rossini, A.A., and Bortell, R., Ian4 is required for mitochondrial integrity and T cell survival. Proc Natl Acad Sci USA, 2003. 100(18): p. 10382-7.

270. Lee, Y.J., Horie, Y., Wallace, G.R., Choi, Y.S., Park, J.A., Choi, J.Y., Song, R., Kang, Y.-M., Kang, S.W., Baek, H.J., Kitaichi, N., Meguro, A., Mizuki, N., Namba, K., Ishida, S., Kim, J., Niemczyk, E., Lee, E.Y., Song, Y.W., Ohno, S., and Lee, E.B., Genome-wide association study identifies GIMAP as a novel susceptibility locus for Behçet's disease. Ann Rheum Dis, 2013. 72(9): p. 1510-1516.

271. Hellquist, A., Zucchelli, M., Kivinen, K., Saarialho-Kere, U., Koskenmies, S., Widen, E., Julkunen, H., Wong, A., Karjalainen-Lindsberg, M.-L., Skoog, T., Vendelin, J., Cunninghame-Graham, D.S., Vyse, T.J., Kere, J., and Lindgren, C.M., The human GIMAP5 gene has a common polyadenylation polymorphism increasing risk to systemic lupus erythematosus. J Med Genet, 2007. 44(5): p. 314-21.

272. Keita, M., Leblanc, C., Andrews, D., and Ramanathan, S., GIMAP5 regulates mitochondrial integrity from a distinct subcellular compartment. Biochem Biophys Res Commun, 2007. 361(2): p. 481-6.

273. Schulteis, R.D., Chu, H., Dai, X., Chen, Y., Edwards, B., Haribhai, D., Williams, C.B., Malarkannan, S., Hessner, M.J., Glisic-Milosavljevic, S., Jana, S., Kerschen, E.J., Ghosh, S., Wang, D., Kwitek, A.E., Lernmark, A., Gorski, J., and Weiler, H., Impaired survival of peripheral T cells, disrupted NK/NKT cell development, and liver failure in mice lacking Gimap5. Blood, 2008. 112(13): p. 4905-14.

274. Barnes, M.J., Aksoylar, H., Krebs, P., Bourdeau, T., Arnold, C.N., Xia, Y., Khovananth, K., Engel, I., Sovath, S., Lampe, K., Laws, E., Saunders, A., Butcher, G.W., Kronenberg, M., Steinbrecher, K., Hildeman, D., Grimes, H.L., Beutler, B., and Hoebe, K., Loss of T cell and B cell quiescence precedes the onset of microbial flora-dependent wasting disease and intestinal inflammation in Gimap5-deficient mice. J Immunol, 2010. 184(7): p. 3743-54.

275. Yano, K., Carter, C., Yoshida, N., Abe, T., Yamada, A., Nitta, T., Ishimaru, N., Takada, K., Butcher, G.W., and Takahama, Y., Gimap3 and Gimap5 cooperate to maintain T-cell numbers in the mouse. Eur J Immunol, 2014. 44(2): p. 561-72.

276. Ashrafian, H., Docherty, L., Leo, V., Towlson, C., Neilan, M., Steeples, V., Lygate, C.A., Hough, T., Townsend, S., Williams, D., Wells, S., Norris, D., Glyn-Jones, S., Land, J., Barbaric, I., Lalanne, Z., Denny, P., Szumska, D., Bhattacharya, S., Griffin, J.L., Hargreaves, I.,

References

106

Fernandez-Fuentes, N., Cheeseman, M., Watkins, H., and Dear, T.N., A mutation in the mitochondrial fission gene Dnm1l leads to cardiomyopathy. PLoS Genet, 2010. 6(6): p. e1001000.

277. Gross, N.J., Getz, G.S., and Rabinowitz, M., Apparent turnover of mitochondrial deoxyribonucleic acid and mitochondrial phospholipids in the tissues of the rat. J Biol Chem, 1969. 244(6): p. 1552-62.

278. Kisseberth, W.C., Brettingen, N.T., Lohse, J.K., and Sandgren, E.P., Ubiquitous expression of marker transgenes in mice and rats. Dev Biol, 1999. 214(1): p. 128-38.

279. Zambrowicz, B.P., Imamoto, A., Fiering, S., Herzenberg, L.A., Kerr, W.G., and Soriano, P., Disruption of overlapping transcripts in the ROSA beta geo 26 gene trap strain leads to widespread expression of beta-galactosidase in mouse embryos and hematopoietic cells. Proc Natl Acad Sci U S A, 1997. 94(8): p. 3789-94.

280. Calvo, S.E., Pagliarini, D.J., and Mootha, V.K., Upstream open reading frames cause widespread reduction of protein expression and are polymorphic among humans. Proc Natl Acad Sci U S A, 2009. 106(18): p. 7507-7512.

281. Morris, D.R. and Geballe, A.P., Upstream Open Reading Frames as Regulators of mRNA Translation. Mol Cell Biol, 2000. 20(23): p. 8635-8642.

282. Lykke-Andersen, J. and Bennett, E.J., Protecting the proteome: Eukaryotic cotranslational quality control pathways. J Cell Biol, 2014. 204(4): p. 467-476.

283. Brubaker, Sky W., Gauthier, Anna E., Mills, Eric W., Ingolia, Nicholas T., and Kagan, Jonathan C., A Bicistronic MAVS Transcript Highlights a Class of Truncated Variants in Antiviral Immunity. Cell, 2014. 156(4): p. 800-811.

284. Nemoto, Y. and De Camilli, P., Recruitment of an alternatively spliced form of synaptojanin 2 to mitochondria by the interaction with the PDZ domain of a mitochondrial outer membrane protein. EMBO J, 1999. 18(11): p. 2991-3006.

285. Rapaport, D., Finding the right organelle: Targeting signals in mitochondrial outer-membrane proteins. EMBO Reports, 2003. 4(10): p. 948-952.

286. Malena, A., Loro, E., Di Re, M., Holt, I.J., and Vergani, L., Inhibition of mitochondrial fission favours mutant over wild-type mitochondrial DNA. Hum Mol Genet, 2009. 18(18): p. 3407-16.

287. Jaattela, M., Cande, C., and Kroemer, G., Lysosomes and mitochondria in the commitment to apoptosis: a potential role for cathepsin D and AIF. Cell Death Differ, 2003. 11(2): p. 135-136.

288. Opferman, J.T., Apoptosis in the development of the immune system. Cell Death Differ, 2007. 15(2): p. 234-242.

289. Sarvothaman, S., Undi, R.B., Pasupuleti, S.R., Gutti, U., and Gutti, R.K., Apoptosis: role in myeloid cell development. Blood research, 2015. 50(2): p. 73-79.

290. Weirich, C.S., Erzberger, J.P., and Barral, Y., The septin family of GTPases: architecture and dynamics. Nat Rev Mol Cell Biol, 2008. 9(6): p. 478-89.

291. Simpson, J.C., Joggerst, B., Laketa, V., Verissimo, F., Cetin, C., Erfle, H., Bexiga, M.G., Singan, V.R., Hériché, J.-K., Neumann, B., Mateos, A., Blake, J., Bechtel, S., Benes, V., Wiemann, S., Ellenberg, J., and Pepperkok, R., Genome-wide RNAi screening identifies human proteins with a regulatory function in the early secretory pathway. Nat Cell Biol, 2012. 14(7): p. 764-74.

107

292. Pascall, J.C., Rotondo, S., Mukadam, A.S., Oxley, D., Webster, J., Walker, S.A., Piron, J., Carter, C., Ktistakis, N.T., and Butcher, G.W., The immune system GTPase GIMAP6 interacts with the Atg8 homologue GABARAPL2 and is recruited to autophagosomes. PLoS One, 2013. 8(10): p. e77782.

293. Heinonen, M.T., Kanduri, K., Lähdesmäki, H.J., Lahesmaa, R., and Henttinen, T.A., Tubulin- and actin-associating GIMAP4 is required for IFN-γ secretion during Th cell differentiation. Immunol Cell Biol, 2014: p. 10.1038/icb.2014.86.

294. Deretic, V., Saitoh, T., and Akira, S., Autophagy in infection, inflammation and immunity. Nat Rev Immunol, 2013. 13(10): p. 722-737.

295. Hoppins, S., Edlich, F., Cleland, M.M., Banerjee, S., McCaffery, J.M., Youle, R.J., and Nunnari, J., The soluble form of Bax regulates mitochondrial fusion via MFN2 homotypic complexes. Mol Cell, 2011. 41(2): p. 150-60.

296. Karbowski, M., Norris, K.L., Cleland, M.M., Jeong, S.-Y., and Youle, R.J., Role of Bax and Bak in mitochondrial morphogenesis. Nature, 2006. 443(7112): p. 658-62.

297. Maiuri, M.C., Zalckvar, E., Kimchi, A., and Kroemer, G., Self-eating and self-killing: crosstalk between autophagy and apoptosis. Nat Rev Mol Cell Biol, 2007. 8(9): p. 741-752.

298. Hanekamp, T., Thorsness, M.K., Rebbapragada, I., Fisher, E.M., Seebart, C., Darland, M.R., Coxbill, J.A., Updike, D.L., and Thorsness, P.E., Maintenance of Mitochondrial Morphology Is Linked to Maintenance of the Mitochondrial Genome in Saccharomyces cerevisiae. Genetics, 2002. 162(3): p. 1147-1156.

299. Hobbs, A.E.A., Srinivasan, M., McCaffery, J.M., and Jensen, R.E., Mmm1p, a Mitochondrial Outer Membrane Protein, Is Connected to Mitochondrial DNA (Mtdna) Nucleoids and Required for Mtdna Stability. J Cell Biol, 2001. 152(2): p. 401-410.

300. Schwefel, D. and Daumke, O., GTP-dependent scaffold formation in the GTPase of Immunity Associated Protein family. Small GTPases, 2011. 2(1): p. 27-30.

301. Takubo, K., Nagamatsu, G., Kobayashi, Chiharu I., Nakamura-Ishizu, A., Kobayashi, H., Ikeda, E., Goda, N., Rahimi, Y., Johnson, Randall S., Soga, T., Hirao, A., Suematsu, M., and Suda, T., Regulation of Glycolysis by Pdk Functions as a Metabolic Checkpoint for Cell Cycle Quiescence in Hematopoietic Stem Cells. Cell Stem Cell, 2013. 12(1): p. 49-61.

302. Simsek, T., Kocabas, F., Zheng, J., DeBerardinis, R.J., Mahmoud, A.I., Olson, E.N., Schneider, J.W., Zhang, C.C., and Sadek, H.A., The Distinct Metabolic Profile of Hematopoietic Stem Cells Reflects Their Location in a Hypoxic Niche. Cell stem cell, 2010. 7(3): p. 380-390.

303. Yu, W.-M., Liu, X., Shen, J., Jovanovic, O., Pohl, E.E., Gerson, S.L., Finkel, T., Broxmeyer, H.E., and Qu, C.-K., Metabolic Regulation by the Mitochondrial Phosphatase PTPMT1 Is Required for Hematopoietic Stem Cell Differentiation. Cell stem cell, 2013. 12(1): p. 62-74.

304. Zhang, Q., Raoof, M., Chen, Y., Sumi, Y., Sursal, T., Junger, W., Brohi, K., Itagaki, K., and Hauser, C.J., Circulating mitochondrial DAMPs cause inflammatory responses to injury. Nature, 2010. 464(7285): p. 104-107.

305. Manzanillo, P.S., Ayres, J.S., Watson, R.O., Collins, A.C., Souza, G., Rae, C.S., Schneider, D.S., Nakamura, K., Shiloh, M.U., and Cox, J.S.,

References

108

The ubiquitin ligase parkin mediates resistance to intracellular pathogens. Nature, 2013. 501(7468): p. 512-516.

306. Chopra, R., Ali, S., Srivastava, A.K., Aggarwal, S., Kumar, B., Manvati, S., Kalaiarasan, P., Jena, M., Garg, V.K., Bhattacharya, S.N., and Bamezai, R.N., Mapping of PARK2 and PACRG overlapping regulatory region reveals LD structure and functional variants in association with leprosy in unrelated indian population groups. PLoS Genet, 2013. 9(7): p. e1003578.

307. Mira, M.T., Alcais, A., Van Thuc, N., Moraes, M.O., Di Flumeri, C., Hong Thai, V., Chi Phuong, M., Thu Huong, N., Ngoc Ba, N., Xuan Khoa, P., Sarno, E.N., Alter, A., Montpetit, A., Moraes, M.E., Moraes, J.R., Dore, C., Gallant, C.J., Lepage, P., Verner, A., van de Vosse, E., Hudson, T.J., Abel, L., and Schurr, E., Susceptibility to leprosy is associated with PARK2 and PACRG. Nature, 2004. 427(6975): p. 636-640.

308. Ali, S., Vollaard, A.M., Widjaja, S., Surjadi, C., Van De Vosse, E., and Van Dissel, J.T., PARK2/PACRG polymorphisms and susceptibility to typhoid and paratyphoid fever. Clin Exp Immunol, 2006. 144(3): p. 425-431.

Genetic Studies of Tissue-Specific Mitochondrial DNA Segregation in Mammals

RESEARCH PROGRAMS UNIT MOLECULAR NEUROLOGYFACULTY OF MEDICINEDOCTORAL PROGRAMME IN BIOMEDICINEUNIVERSITY OF HELSINKI

RIIKKA JOKINEN

dissertationes scholae doctoralis ad sanitatem investigandam universitatis helsinkiensis 13/2016

13/2016

Helsinki 2016 ISSN 2342-3161 ISBN 978-951-51-1912-4

RIIK

KA

JOK

INE

N G

enetic S

tud

ies of Tissu

e-Sp

ecific M

itochon

drial D

NA

Segregation

in M

amm

als

Recent Publications in this Series

100/2015 Päivi Ylä-AnttilaPhagophore Membrane Connections and RAB24 in Autophagy101/2015 Kaisa KyöstiläIdentification of Novel Mutations and Molecular Pathways for Canine Neurodegeneration and Chondrodysplasia102/2015 Emmi JoensuuEpigenetic Alterations in Sporadic and Familial Cancers103/2015 Elina ReponenPreoperative Risk-Assessment Methods, Short-Term Outcome, and Patient Satisfaction in Elective Cranial Neurosurgery104/2015 Riina KandolinCardiac Sarcoidosis in Giant Cell Myocarditis in Finland106/2015 Karmen KappPolyphenolic and Essential Oil Composition of Mentha and Their Antimicrobial Effect107/2015 Dina PopovaNeurophysiological mechanisms of Plasticity Induced in Adult Brain1/2016 Pauliina SaurusRegulation of Podocyte Apoptosis in Diabetic Kidney Disease – Role of SHIP2, PDK1 and CDK22/2016 Sanna ToivonenDerivation of Hepatocyte Like Cells from Human Pluripotent Stem Cells3/2016 Marjaana PeltolaAMIGO-Kv2.1 Potassium Channel Complex: Identification and Association with Schizophrenia-Related Phenotypes4/2016 Niko-Petteri NykänenCellular Physiology and Cell-to-Cell Propagation of Tau in Neurodegeneration: The Impact of Late-Onset Alzheimer’s Disease Susceptibility Genes5/2016 Liisa KorkaloHidden Hunger in Adolescent Mozambican Girls: Dietary Assessment, Micronutrient Status, and Associations between Dietary Diversity and Selected Biomarkers6/2016 Teija OjalaLactobacillus crispatus and Propionibacterium freudenreichii: A Genomic and Transcriptomic View7/2016 César AraujoProstatic Acid Phosphatase as a Regulator of Endo/Exocytosis and Lysosomal Degradation8/2016 Jens VerbeerenRegulation of the Minor Spliceosome through Alternative Splicing and Nuclear Retention of the U11/U12-65K mRNA9/2016 Xiang Zhao HMGB1 (Amphoterin) and AMIGO1 in Brain Development10/2016 Tarja Pääkkönen (Jokinen)Benign Familial Juvenile Epilepsy in Lagotto Romagnolo Dogs11/2016 Nora HiivalaPatient Safety Incidents, Their Contributing and Mitigating Factors in Dentistry12/2016 Juho HeinonenIntravenous Lipid Emulsion for Treatment of Local Anaesthetic and Tricyclic Antidepressant Toxicity

genetic studies of tissue-specific mitochondrial dna

Documents