generating transgenic banana (cv. sukali ndizi) resistant ... · like other banana cultivars,...
TRANSCRIPT
Generating Transgenic Banana (cv. Sukali Ndizi) Resistant to Fusarium Wilt
By
Betty Magambo
Bachelor of Biomedical Laboratory Technology (Hons)
A thesis submitted for the degree of Master of Applied Science in the Science
and Engineering Faculty at the Queensland University of Technology
2012
ii
STATEMENT OF ORIGINAL AUTHORSHIP
I, Betty Magambo, do hereby declare that “Generating Transgenic Banana (cv. Sukali Ndizi)
Resistant to Fusarium Wilt” is original and has not been submitted to any other University or
Institution for degree award. This thesis contains only my work except where a reference has
been made.
Date ..............29 November 2012
Signature.........Betty Magambo
Name...............Betty Magambo
iii
DEDICATION
This work is dedicated to the memory of my daughter Belinda Kabasinguzi. You left good
fingerprints of grace on my life and you haven’t been forgotten. I extend this to all those you
loved especially Steven Magambo, Carol Magambo, Henry Bengo, Rebecca Nakacwa and your
best friend Melisa .
iv
ACKNOWLEDGEMENT
My sincere gratitude goes to all those who have been supportive and helped me complete this
work. Special thanks go to my associate supervisors Professor Wilberforce Tushemereirwe and
Professor James Dale whose involvement in the Biofortification project opened a need for
capacity building. I thank them for the financial support and the laboratories facilities and
supplies that made this work possible. My appreciation goes to Dr. Geofrey Arinaitwe for the
advice, guidance and all the supervision of the practical work. I am very grateful to my principal
supervisor Dr. Harjeet Khanna for technical supervision, gene constructs, for the help in
preparation of this thesis and for tirelessly navigating me through the complex University
procedures considering the fact that I was an external student. I greatly appreciate Dr. Namanya
Priver for reading this thesis and the guidance she provided on presentation of my thesis. Many
thanks go to Sefasi Abel and Tendo Sali who within their busy schedules, found time to offer
advice about analysis of data and help me make sense out of it.
I appreciate the technical support accorded to me by all the staff of the National Biotechnology
Centre especially Pamela Lamwaka, Clara Samukoya, Sarah Nayiti, Abu Muwonge, Moses
Tindamanyire, Basheija Henry, Tony Tazuba, Bonny Oloka, Ruth Mbabazi, Moses Matovu,
Francis Ndizeye, Ivan Kabita and Doreen Amumpire. You made this work progress faster.
Financial support for this work was provided by the Bill and Melinda gates Foundation through
Queensland University of Technology and the National Banana Research Program of the
National Agricultural Research Organization, for which I am very grateful to them.
Above all, let me express gratitude to my family, my Mum, Caroline Magambo and Steven
Magambo, you all have been so supportive and encouraging. Not forgetting my friends Prossy
Namuwulya and Esther Nakimuli whose motivation has always been rewarding. Lastly, I thank
the almighty God for the wisdom and health that has enabled me to navigate to the end of this
landmark.
v
vi
TABLE OF CONTENTS
STATEMENT OF ORIGINAL AUTHORSHIP ................................................. ii
DEDICATION ...................................................................................................... iii
ACKNOWLEDGEMENT .................................................................................... iv
ABSTRACT ......................................................................................................... xiii
CHAPTER ONE .................................................................................................... 1
INTRODUCTION ...................................................................................................................... 1
1.1 Back ground .......................................................................................................................... 1
1.2 Problem statement and justification ...................................................................................... 4
1.3. Aim ...................................................................................................................................... 5
1.4. Objectives ............................................................................................................................ 5
CHAPTER TWO ................................................................................................... 6
LITERATURE REVIEW ........................................................................................................... 6
2.1 Fusarium wilt of banana ....................................................................................................... 6
2.1.1 Origin ............................................................................................................................. 6
2.1.2 Life cycle and disease symptoms ................................................................................... 6
2.1.3 Management of Fusarium wilt in banana ....................................................................... 7
2.1.4 Assessment of Fusarium wilt resistance ........................................................................ 8
2.2 Plant disease response and related transgenic approaches .................................................. 10
2.2.1 Responses for secondary barriers ................................................................................. 11
2.2.2 Responses for fungal inhibition ................................................................................... 11
2.2.3 Responses for innate defence ....................................................................................... 12
2.2.4 Cell death response ...................................................................................................... 13
2.3 Programmed Cell Death ...................................................................................................... 16
2.3.1 Programmed cell death in animals ............................................................................... 17
2.3.2 Regulators of programmed cell death in animals......................................................... 17
2.3.3 The concept of programmed cell death in plants ......................................................... 19
2.3.4 Regulators of programmed cell death in plants ........................................................... 20
2.3.5 Use of PCD inhibition genes in transgenic plants ....................................................... 22
vii
CHAPTER THREE ............................................................................................. 23
METHODOLOGY ................................................................................................................... 23
3.1 Summary overview ............................................................................................................. 23
3.2. Binary plant expression vector and banana ECS ............................................................... 23
3.3 Bacterial manipulations and Agrobacterium-mediated transformation .............................. 24
3.3.1 Preparation of chemically competent E. coli cells ....................................................... 24
3.3.2 Transformation of E. coli ............................................................................................. 24
3.3.3 Plasmid purification ..................................................................................................... 24
3.3.4 Transformation of Agrobacterium tumefaciens strain AGL1 ...................................... 25
3.3.5 Transformation of embryogenic cell suspensions of Sukali Ndizi .............................. 26
3.3.6 Selection, regeneration and acclimatization of transgenics ......................................... 26
3.4 Molecular characterization ................................................................................................. 27
3.4.1 DNA extraction ............................................................................................................ 27
3.4.2 PCR analysis ................................................................................................................ 27
3.4.3 RNA extraction and RT-PCR analysis ........................................................................ 28
3.4.4 Southern blot analysis .................................................................................................. 28
3.4.4.1 Probe labeling ........................................................................................................... 29
3.4.4.2 DNA electrophoresis and gel processing .................................................................. 29
3.4.4.3 DNA transfer ............................................................................................................. 29
3.4.4.4 Hybridization ............................................................................................................ 30
3.4.4.5 Membrane washes and DNA detection ..................................................................... 30
3.5 Pathogenicity tests .............................................................................................................. 30
3.5.1 Preparation of Foc inoculum ........................................................................................ 30
3.5.2 Infection of plants ........................................................................................................ 31
3.5.3 Disease assessment ...................................................................................................... 31
3.5.4 Statistical analysis ........................................................................................................ 33
CHAPTER FOUR ................................................................................................ 35
RESULTS ................................................................................................................................. 35
4.1 Regeneration of Sukali Ndizi cell suspensions transformed with pYC11 .......................... 35
4.2. Molecular characterization of transgenic plants ................................................................ 36
4.2.1. DNA analysis of regenerants ...................................................................................... 36
viii
4.2.2. RT-PCR analysis ......................................................................................................... 36
4.2.3. Southern blot analysis ................................................................................................. 37
4.3 Pathogenicity of Foc race 1 isolate ..................................................................................... 38
4.4 Determination of Foc race 1 inoculum for consistent infection. ........................................ 39
3.5 Evaluating the reaction of transgenics to Foc race 1 infection ........................................... 41
CHAPTER FIVE ................................................................................................. 46
DISCUSSIONS, CONCLUSIONS AND RECOMMENDATION .......................................... 46
5.1 General discussions ............................................................................................................. 46
5.2 Transformation of Sukali Ndizi banana cultivar ................................................................. 46
5.3 Foc susceptibility in Sukali Ndizi ....................................................................................... 48
5.4 Inoculum preparation and host infection ............................................................................ 48
5. 5 Response of transgenic plants to Foc race 1 infection ....................................................... 49
5.6 Apoptosis as a source of resistance ..................................................................................... 49
5. 7 Comparison with other studies using apoptosis approach ................................................. 51
5. 8 Conclusions and recommendations ................................................................................... 51
Appendix 1 ............................................................................................................ 52
Bacterial culture media, extraction and electrophoresis buffers ............................................... 52
Appendix 2 ............................................................................................................ 53
Cell culture and regeneration media ......................................................................................... 53
Appendix 3 ............................................................................................................ 55
Media stock solutions ............................................................................................................... 55
Appendix 4 ............................................................................................................ 57
Southern analysis buffers and stocks ........................................................................................ 57
REFERENCES ..................................................................................................... 58
ix
LIST OF FIGURES
Figure 1: Enhanced disease resistance in transgenic plants .......................................................... 11
Figure 2: Activation of programmed cell death during C. elegans development. ........................ 18
Figure 3: Linear map of the T-DNA region of pYC11 binary plant expression vector used in this
study. ............................................................................................................................................. 23
Figure 4: Selection and regeneration of cells transformed with Mced9 ....................................... 35
Figure 5: Representative PCR of transgenic Sukali Ndizi lines transformed with pYC11 .......... 36
Figure 6: RT-PCR of selected transgenic Sukali Ndizi lines transformed with pYC11. .............. 37
Figure 7: Probe labeling and Southern analysis of selected transgenic lines. .............................. 38
Figure 8: Representative picture showing internal and external symptoms of plants. ................. 39
Figure 9: External symptoms of Sukali Ndizi infected with Foc race 1 treatments. .................... 40
Figure 10: Levels of disease severity shown by the Mced9 transgenic lines after Foc race1
infection. ....................................................................................................................................... 43
Figure 11: Transgenic lines 27, 72 and 83 showed tolerance to Foc race 1 ................................. 44
Figure 12: Transgenic lines 12, 55 and 96 showed mild corm discoloration after infection ........ 45
x
LIST OF TABLES
Table 1: Primers used in screening transgenic plants by PCR ...................................................... 28
Table 2: Scale values for the different disease symptoms ............................................................ 33
Table 3: Interpretation of the Disease Severity Index scales ........................................................ 34
Table 4: Disease severity of Foc race 1 on tissue cultured plants ................................................ 38
Table 5: Disease severity index (DSI) of control plants infected with different inoculum
concentrations ............................................................................................................................... 40
Table 6: Disease severity index (DSI) of transgenic lines 13 weeks after Foc race 1 infection ... 42
xi
LIST OF ABBREVIATIONS
ATP adenosine-5’-triphosphate
BAP 6-benzylaminopurine
QUT Queensland University of Technology
CaMV Caulifower mosaic virus
cDNA Complementary DNA
CTAB Cetyl trimethyl ammonium bromide
DH2O Distilled water
DIG Digoxigenin
DMSO Dimethylsulphoxide
DSI Disease severity index
DNA Deoxyribonucleic acid
dNTPs Deoxyribonucleoside triphosphates
2, 4-D 2, 4-dichlorophenoxyacetic acid
ECS Embryogenic cell suspension
EDTA Ethylenediaminetetraacetic acid
Foc Fusarium oxysporum cubense
LB Luria-Bertani
LSI Leaf symptom index
NAA α-naphthalene acetic acid
nptII neomycin phosphotransferase
PCR Polymerase chain reaction
PDA Potato dextrose agar
PVP Polyvinylpyrrolidone
RDI Rhizome discolouration index
xii
RNA Ribonucleic acid
RNase Ribonuclease
RT-PCR Reverse transcription PCR
SDS Sodium dodecyl sulphate
TAE Tris acetate EDTA
TE Tris:EDTA
Tris Tris(hydroxymethyl)aminomethane
Ubi Ubiquitin
UV Ultra violet
YMA Yeast mannitol agar
YMB Yeast mannitol broth
Units:
ºC Degrees Celsius
g Gram(s)
bp Base pairs
Kb Kilo base pairs
L Litre(s)
M Molar
m Metre(s)
MW Molecular weight
OD Optical density
Rpm Revolutions per minute
V Volt(s)
xiii
ABSTRACT
Banana is one of the world’s most popular fruit crops and Sukali Ndizi is the most popular
dessert banana in the East African region. Like other banana cultivars, Sukali Ndizi is threatened
by several constraints, of which the Fusarium wilt disease is the most destructive. Fusarium wilt
is caused by a soil-borne fungus, Fusarium oxysporum f.sp. cubense (Foc). No effective control
strategy currently exists for this disease and although disease resistance exists in some banana
cultivars, introducing resistance into commercial cultivars by conventional breeding is difficult
because of low fertility. Considering that conventional breeding generates hybrids with
additional undesirable traits, transformation is the most suitable way of introducing resistance in
the banana genome. The success of this strategy depends on the availability of genes for genetic
transformation. Recently, a novel strategy involving the expression of anti-apoptosis genes in
plants was shown to result in resistance against several necrotrophic fungi, including Foc race 1
in banana cultivar Lady Finger. This thesis explores the potential of a plant-codon optimised
nematode anti-apoptosis gene (Mced9) to provide resistance against Foc race 1 in dessert banana
cultivar Sukali Ndizi.
Agrobacterium-mediated transformation was used to transform embryogenic cell suspension of
Sukali Ndizi with plant expression vector pYC11, harbouring maize ubiquitin promoter driven
Mced9 gene and nptII as a plant selection marker. A total of 42 independently transformed lines
were regenerated and characterized. The transgenic lines were multiplied, infected and evaluated
for resistance to Foc race 1 in a small pot bioassay. The pathogenicity of the Ugandan Foc race 1
isolate used for infection was pre-determined and the spore concentration was standardised for
consistent infection and symptom development. This process involved challenging tissue culture
plants of Sukali Ndizi, a Foc race 1 susceptible cultivar and Nakinyika, an East African Highland
cultivar known to be resistant to Foc race 1, with Fusarium inoculum and observing external and
internal disease symptom development.
Rhizome discolouration symptoms were the best indicators of Fusarium wilt with yellowing
being an early sign of disease. Three transgenic lines were found to show significantly less
disease severities compared to the wild-type control plants after 13 weeks of infection, indicating
that Mced9 has the potential to provide tolerance to Fusarium wilt in Sukali Ndizi.
CHAPTER ONE
INTRODUCTION
1.1 Back ground
Banana (Musa spp.) is the fourth most important global food commodity after rice, wheat and
maize (Arias, Dankers, Liu, & Pilkauskas, 2003). All edible bananas belong to the genus Musa
and are derived from one or two of the diploid species M. acuminata (A) and the wild M.
balbisiana (B) (Simmonds, 1966). They are classified in the groups AA, AAA, AAB and ABB
according to the relative participation of the respective genomes in the genotype. Earliest
domestication of banana is thought to have occurred in South East Asia and Indochina where the
greatest level of diversity of Musa species has been observed and this occurred in several stages
over a wide period of time (Simmonds, 1962).
Banana is grown in over 120 countries worldwide (Thangavelu & Mustaffa, 2012) covering
about 10 million hectares, with an annual world production estimated at 127 million tonnes.
Uganda ranks as the second largest producer of banana in the world after India although most of
what is produced is consumed locally. For most African countries that face hunger problems, the
crop provides round the year harvest, a factor that is important in dealing with food security.
Banana as a food is a good source of carbohydrates and provides elements like potassium,
magnesium, phosphorous, calcium and vitamins such as B6 and C (Debabandya, Sabyasachi, &
Namrata, 2010; Marriott & Lancastern, 1983). It provides 25% of the energy requirements for an
estimate of 70 million people of which East Africa alone accounts for 20 million people
(Sharrock & Frison, 1999).
Banana is threatened by several biotic and abiotic constraints and all banana improvement
programs worldwide are focusing on these problems (Arvanitoyannis, Mavromatis, Garyfalia, &
Michaela, 2008). The low yield in banana producing areas is greatly attributed to declining soil
fertility characterized by poor soil quality and soil nutrient depletion as a result of continued
banana cultivation without addition of fertilizers. The major biotic factors responsible for banana
yield reduction are fungal, bacterial and viral diseases all of which contribute to serious yield
2
losses and usually shorten the life of the plantation on the farm (H. Stover & Simmonds, 1987).
There are essentially three fungal diseases that are of serious economic importance to banana
production and these are Black Sigatoka, Yellow Sigatoka and Fusarium wilt, (J. C. Robinson,
1996). Black Sigatoka is caused by Mycosphaerella fijiensis and causes necrosis of the leaves,
leading to reduction in the photosynthetic leaf area. Reduction in photosynthesis leads to
incomplete filling of the fingers, reduced bunch weight and premature or uneven ripening which
ultimately causes yield loses of 33 to 76% (Jones, 2000). Yellow Sigatoka is similar to Black
Sigatoka but is caused by Mycosphaerella musicola and is less damaging. Yellow Sigatoka is
characterized by the presence of pale yellow specks on the upper leaf surface as opposed to
Black Sigatoka disease which has black specks that appear on the lower leaf surface (Chillet,
Abadie, Hubert, Chilin-Charles, & Bellaire, 2009). Fusarium wilt is considered the most
damaging given that it can survive in the soil in a dormant state for very many years (Ploetz &
Pegg, 2000). Economically, the infected plant may not produce any bunch and if present, the size
is greatly reduced with very few fingers that are succinct and acidic (Thangavelu & Mustaffa,
2012). The wilt was also the cause of destruction to several plantations of Gros Michel in
Central America during the first half of the 20th Century (Jones, 2000).
Fusarium wilt is a soil borne fungal disease caused by Fusarium oxysporum. Different host
plants are attacked by special forms or races of the fungus and Fusarium oxysporum f.sp.
Cubense (Foc) is responsible for the disease that causes vascular disruption of nutrient transport
in banana (R. H. Stover, 1962). Systemic foliage and wilting symptoms which lead to collapse of
the crown and pseudostem eventually result in death of the plant. The fungus has four races, of
which only race 1 has been found in Uganda (Kangire, Rutherford, & Gold, 2001). Initially, the
incidence of the disease was highest in low altitude areas which are characterised by high
minimum mean temperatures throughout the year as compared to the highland areas (Kangire,
Rutherford, & Gold, 1999). Another Fusarium like wilt has also been found at altitudes 1300
meters above sea level (Kangire, Karamura, Gold, & Rutherford, 2000).
Management of this disease is through on-farm practices that reduce crop loss and prevent
pathogen spread. However, there is no means of controlling Fusarium wilt once the plant is
attacked since the fungus is found in the soil. Therefore breeding for resistance is the most
3
reliable method of managing the wilt. Conventionally bred varieties, like Cavendish, FHIA 21
and FHIA 25 have been generated with good bunch weights such as a maximum bunch weight of
52 kgs observed from FHIA 25 (Tushemereirwe, Kangire, Kubiriba, Nakyanzi, & Gold, 2004).
However, conventional breeding for improvement of disease resistance tends to generate hybrids
with inferior fruit quality compared to the highly preferred parents. Furthermore, breeding of
banana is limited by high sterility of most edible cultivars, high polyploidy levels, as well as the
long maturity time which make the breeding process very tedious (Vuylsteke, Swennen, & Ortiz,
1993). Genetic transformation is one way to maintain the genetic diversity of cultivars that
farmers find useful since the technique maintains the original traits while adding desired
additional trait(s) that might even be absent in Musa genome (Sági, Remy, & Swennen, 1997).
Genetic transformation therefore has potential of improving resistance against Fusarium wilt in
cultivated varieties without significantly changing the highly preferred fruit quality. However,
the challenge still remains on being able to identify suitable genes that can integrate resistance
into edible bananas.
Extensive studies on various plant responses and plant-pathogen interactions have resulted in the
identification of genes that are important for pathogen resistance (Collinge, Jorgensen, Lund, &
Lyngkjaer, 2010; Punja, 2001). These genes include antimicrobial peptides that are toxic to
pathogens, genes that increase structural defences and gene products that directly hinder
pathogen growth (Brogden, 2005; Dickman et al., 2001). Another set of genes are R genes
(Dowell & Woffenden, 2003) which can directly or indirectly trigger important plant defence
responses like the hypersensitive responses and later cause pathogen death (Rommens &
Kishore, 2000). Such R genes eventually provide tolerance or resistance to disease (Ping,
Rogers, & Roossinck, 2004) . Another set of animal derived genes known as the anti-apoptosis
genes that are able to control plant diseases have also been used (Dickman, et al., 2001).
In Uganda, Fusarium wilt attacks Sukali Ndizi (AAB) together with other cultivars like Kisubi
(ABB), Kayinja (ABB) and Bogoya (Gros Michel) causing losses up to 100% in some farms.
Sukali Ndizi is the most preferred dessert banana cultivar which is also used for juice
preparation. It is characterized by having a compact bunch, short fruit fingers which are very
sweet when ripe. Sukali Ndizi is a widely distributed cultivar and is gaining importance in both
4
local and export markets (Asten, Florent, & Apio, 2008; IDEA, 2001; Tushemereirwe et al.,
2001).
1.2 Problem statement and justification
Fusarium wilt is one of the major banana diseases that have contributed to the reduction of
banana production. In Uganda, it is a major factor that has lowered plantation longevity mainly
for dessert bananas and production cannot meet the demand of the increasing population (IPGRI,
1998). Several cultural and chemical methods employed have failed to contain the spread of the
disease (Herbert & Marx, 1990) since Fusarium wilt can persist in the soil for over 30 years
rendering these methods impractical. Cultivars resistant to Fusarium wilt exist and several have
been conventionally bred through various breeding programmes (Z. D. Beer, 1997; Matos,
Cordeiro, Trindade, & Ferreira, 1999), However improvement through conventional breeding
generates hybrids with inferior fruit quality and this makes them unacceptable to consumers.
Through genetic transformation techniques there is potential to provide disease resistance while
maintaining the original traits of the cultivars.
Several genes with antimicrobial properties have so far been transformed into banana for
Fusarium wilt resistance. Transformation with the genes for the ferrodoxin like protein (flp) (Mei
et al., 2011 ), the rice thaumatin-like protein (tlp) (Mahdavi, Sariah, & Maziah, 2012) and the
defensins PHDef1 and PHDef2 (Ghag, Shekhawat, & Ganapathi, 2012) exhibited a reduction in
disease severity when susceptible cultivars were challenged with Foc race 4 or Foc race 1. In
spite of all this progress, there is still no known Fusarium wilt resistant cultivar that is
commercially available.
Understanding the plant defence responses and progression of disease after infection is an
important guide to selecting the vital genes that can confer resistance in both the glass house and
field conditions. It has been observed that internally, banana roots that are infected with Foc race
1 display properties similar to those that occur during apoptosis in animals (Paul et al., 2011 ).
Anti-apoptosis genes that are able to control plant diseases have been identified. The human Bcl-
2, nematode ced9 and baculovirus op-iap genes control S. sclerotiorum in transgenic tobacco
5
(Dickman, et al., 2001) while Bcl-xL and ced9 were able to increase tolerance of tomato to
cucumber mosaic virus (Ping, et al., 2004). The ced9 has also shown protective advantages
against abiotic stresses like tolerance to U.V in tobacco (Dickman, et al., 2001; Mitsuhara,
Malik, Miura, & Ohashi, 1999) and to cold stress in tomatoes (Ping et al., 2004). Although the
mechanism of these genes in plants is not so clear, cell death occurs in response to elicitor from
pathogenic micro–organisms or the stress subjected during infection. Nematode ced9 gene has
been shown to confer Foc race 1 tolerance in banana cultivar Lady Finger (Paul, et al., 2011 ). A
plant codon optimized version of ced9 (Mced9) is therefore expected to confer Foc race 1
resistance to Sukali Ndizi an important dessert banana cultivar from East Africa.
1.3. Aim
To evaluate transgenic lines of banana cultivar Sukali Ndizi expressing a plant codon optimised
nematode gene Mced9 as a potential approach towards developing resistance to Foc race 1
1.4. Objectives
- Generate and characterize transgenic lines of Sukali Ndizi
- Determine the pathogenicity of Foc race 1 using tissue cultured plantlets of Sukali Ndizi
- Determine Foc race 1 inoculum spore concentration for consistent infection
- Assess the response of Mced9 transgenics to Foc race 1 infection
6
CHAPTER TWO
LITERATURE REVIEW
2.1 Fusarium wilt of banana
2.1.1 Origin
Fusarium wilt in banana is caused by a soil borne fungus Fusarium oxysporum f. sp. cubense
(Ploetz & Pegg, 2000). Fusarium wilt of banana was first reported in Australia in 1874 (R. H.
Stover, 1962) but is now wide spread and exists in all major countries where bananas are grown.
There are four races based on the cultivars they affect. Race 1 is pathogenic to cultivars like Gros
Michel (AAA) and Lady Finger (AAB), Race 2 affects Bluggoe (ABB) and all cultivars
genetically related to it, Race 3 attacks Heliconia spp. which is a close relative of banana while
Race 4 (tropical Race 4, TR4 and subtropical race 4, ST4) attacks Cavendish cultivars and all
cultivars susceptible to Race 1 and Race 2 (Ploetz & Pegg, 2000). ST4 attacks Cavendish
bananas previously exposed to cold winter temperature and has been reported in South Africa,
Australia, Taiwan and the Canary Islands (Ploetz, 2009). TR4 infects Cavendish bananas in the
tropical regions of Southeast Asia and Australia (Bentley, Pegg, Moore, Davis, & Buddenhagen,
1998; Ploetz, 1994). Foc has also been categorized by the vegetative compatibility groups (VCG)
in which isolates that have the same alleles at the loci that controls heterokaryon fall under the
same VCG (Ploetz & Pegg, 2000).
2.1.2 Life cycle and disease symptoms
Fusarium wilt in banana causes vascular disruption of water and nutrient movement which
eventually leads to collapse of the crown and pseudostem (Jeger et al., 1995). The pathogen
enters the plant through the root tips or the natural wounds in the lateral root base (Chunyu et al.,
2011), moves through the xylem vessels and colonizes the rhizome. At this stage there is internal
discolouration of the vascular system (J. C. Robinson, 1996). Further spread of the conidia is
prevented by sieve cells so the spores germinate, grow and spread again until the entire xylem
system is blocked (Jeger, et al., 1995). When the plant finally dies, the fungus forms
chlamydospores which are immobile and dormant and are released back to the soil when the
plant has decayed (Jones, 2000; Pei et al., 2005). The pathogen is spreads mainly through
vegetative propagation of infected rhizomes. The pathogen can also spread as spores in soil or
running water (Jones, 2000).
7
The symptoms include yellowing of the leaf margins of the oldest leaves and/or lengthwise
splitting of the lower leaf sheath. The leaves may wilt and buckle at their petiole base and, later,
younger leaves collapse and hang dead around the pseudostem (Moore, Bentley, Pegg, & D R
Jones, 1995). Internally, brown streaks develop on and within older leaf sheaths and these are
followed by large portions of the xylem turning brick red to brown. The disease symptoms have
not been observed in or on the banana fruit although it reduces the bunch and fruit size
(Thangavelu & Mustaffa, 2012)
2.1.3 Management of Fusarium wilt in banana
At present, several approaches have been combined for the management of Fusarium wilt.
Fusarium outbreak in new farms is prevented by use of pathogen-free rhizomes in pathogen free
soil or use of tissue cultured propagative material (Moore, et al., 1995). On-farm management of
the disease is done to reduce the inoculum load by destroying infected plants. This practice helps
extend the productive life of the plantation even after infection. Chemical control through use of
fungicides and fumigants has been used but it is economically impracticable, does not provide
adequate control and is not environmentally safe (Pei, et al., 2005; H. Stover & Simmonds,
1987).
Biological control through endophytes and botanical extracts has been proposed as methods that
can be integrated with other management strategies to control Fusarium wilt in banana.
Endophytes are able to control disease through different modes of action like production of
biochemical markers and enzymes, production of antibiotics, activation of defence related
enzymes, promotion of growth hormones and competition for space (Thangavelu & Mustaffa,
2012). Biological markers like peroxidase, polyphenoloxidase and phenylalanine ammonia lyase
are associated with defence mechanisms like liginification, formation of phytoalexins and
production of inhibitory metabolites which hamper pathogenic fungi. Colonisation of bananas
with different endophytes has resulted in suppression of Fusarium wilt severity and delay in
symptom advancement after Foc race 4 infection (Thangavelu & Mustaffa, 2012; Ting, Maha, &
Tee, 2012). It has also been demonstrated that pre-colonization of banana roots with non-
pathogenic Fusarium oxysporum reduces Fusarium oxysporum f.sp. cubense colonization under
glass house conditions (Forsyth, Smith, & Aitken, 2006; Ting, et al., 2012) and provides
8
protection from other invading pathogens like nematodes in banana roots (Paparu, Dubois,
Coyne, & Viljoen, 2009). Some plant extracts exhibit antifungal activity and are able to reduce
mycelium growth under both green house and field tests (Akila et al., 2011).
Unfortunately, all these strategies are not long lasting and have not been able to totally contain
the spread of the disease. Furthermore, there is no means of controlling Fusarium wilt once a
plant is attacked. In addition the spores can survive in the soil for over 30 years making re-
infection possible in a new plantation (Ploetz & Pegg, 2000). Breeding for disease resistance can
be an effective way of managing Fusarium wilt since resistant cultivars do exist in wild types and
existing hybrids (Jeger, et al., 1995) but in case of banana, sterility of commercial cultivars
becomes a limitation . Currently, the hope for developing Foc resistance is through genetic
engineering and several strategies are being tried by different banana breeding teams around the
world.
2.1.4 Assessment of Fusarium wilt resistance
It is generally agreed that use of resistant cultivars is the only sustainable way of managing plant
diseases (Collinge, et al., 2010; Punja, 2001). Fusarium wilt resistance can be generated through
genetic engineering but the ability to quickly and correctly differentiate between susceptible and
resistant plants is very important. The use of bioassays to relate the level of antimicrobial
enzymes or stress related compounds to severity of field evaluations in naturally infected fields
have for long been relied on since laboratory studies have previously given varying results
(Hwang & Ko, 2004; Waite, 1977). The inconsistency of laboratory results has been attributed to
the fact that plants are sometimes subjected to unrealistic inoculum levels. Laboratory assays
also depend on tissue culture generated plants and their responses to infection lack natural
defences due to the elimination of useful endophytes during micropropagation. In addition this
renders them highly susceptible when introduced in the field (M. Smith et al., 1998). Field
evaluations are more reliable but they are time consuming and expensive and this necessitates
development of a quick, reliable and consistent small plant bioassay. Molecular markers have
also been linked to Fusarium wilt resistance in several crops (Mutlu, Boyaci, Gocmen, & Abak,
2008; Sharma, P, Kahl, & Muehlbauer, 2004; Simons et al., 1998) and recently, SCARS markers
that are specifically associated with Foc race 4 resistance have been identified in banana (Wang
9
et al., 2012). Identification of markers linked to Foc race 1 will further hasten the selection of
resistant cultivars and also reduce the costs involved in screening large numbers.
2.1.4.1 Infection assays
Several methods have been used to screen for resistance to Fusarium wilt in tissue culture
banana. Most of these methods either use a closed pot system or a hydroponic solution. It is
known that some factors like the age of plantlets, the inoculation method used, presence or
absence of endophytes and fungal virulence or spore type used can affect the susceptibility of
plants and hence the reliability of results (d. Z. C. Beer, Steven-Ellis, & Husselman, 1999;
Mohamed, Mak, Liew, & Ho, 1999; L. J. Smith, Smith, Tree, OKeefe, & Galea, 2008;
Sreeramanan, Maziah, Sariah, Puad, & Xavier, 2006; Wu, Yi, & peng, 2010). Plants that are (10
- 15cm high) give consistent infection compared to those that are less than 10cm (Mohamed, et
al., 1999).
In various studies different infection methods have been used for screening banana plants with
Fusarium wilt. When spore suspensions were used, wounded plant roots were immersed in
spores suspended in liquid media at a concentration of 5x106 spores ml-1 for 5 minutes (Wei-
ming, Chun-mei, Yi-Wei, Yu-lin, & Jiang-Hui, 2011), 2x108 spores ml-1 suspension for 1 hour
(Mahdavi, et al., 2012) or roots were infected with 1000 ml of spore suspension at a
concentration of 1.5x105 spores ml-1 (Pei, et al., 2005). When using substrate, the fungus was
allowed to colonise the substrate for days and later applied onto the plant roots. Substrate
inoculum with millet or sorghum was found to be better than using spore suspensions since it
favours spore multiplication and survival that is important for infection (L. J. Smith, et al., 2008).
The culture media from which the spores for substrate inoculation are derived can also determine
how infection occurs. For example spore suspension from carnation leaf agar (CLA) was found
to be more infective than those from potato dextrose agar (Smith, et al., 2008). This is because
CLA provides growth of all the different conidial types microconidia, macroconidia and
chlamydospores while PDA favours microconidia and a few macroconidia (L. J. Smith, et al.,
2008).
10
2.1.4.2 Disease scoring
For disease assessment, it is important to determine the disease symptoms which can be strongly
associated with susceptibility or resistance. Foc infection in plants starts in the elongation zones
of root hairs and both susceptible and resistant cultivars are usually affected. Infection studies
show that once the root hairs are infected, the hypheal network begins to grow through the
epidermal cell. The hyphae invades dermis and cortex cells via pores (Chunyu, et al., 2011).
However in the resistant plants, complete occlusion of the vessels close to the hyphae occurs
(Nasir, Pittaway, pegg, & Lisle, 2003) while delay in formation of tyloses and quick breakdown
of gels occurs in the susceptible plants (Hardly & Beckman, 1981). The association of rhizome
infection and foliage symptoms in confirming resistance or susceptibility is not always correlated
(Paul, et al., 2011 ) so this further confirms that rhizome discolouration is the best indicator of
disease severity (Nasir, et al., 2003).
2.2 Plant disease response and related transgenic approaches
Plants are continuously exposed to pathogens but this does not always result in disease. A proper
understanding of the defence responses involved guides the possible strategies that can be
employed for generating transgenic resistance. The resistance put forth can be attributed to
several factors which plants use to bring about resistance. The major requirement for resistance
is the plant’s ability to rapidly detect the presence of pathogen which in turn leads to quick
induction of defence responses before the pathogen gains entry or establishes itself (Dixon,
Harrison, & Lamb, 1994). Natural plant resistance can also be attributed to several plant derived
signalling molecules and inducers of resistance which act on a wide range of pathogens
(Collinge, et al., 2010). Such inducers include phytoalexins, glycans, and lipopolysaccharides,
ethylene inducers like xylanase, serine protease, elicitins and sphingolipids.
Genetic engineering to enhance antifungal resistance through over-expression of genes that code
for anti-fungal proteins or other diseases has emerged as a very promising strategy and has been
tested in many crop plants (Grover & Gowthaman, 2003). However, the crops closest to
commercial release are still under field trials with many genes still at evaluation stage (Collinge,
et al., 2010; Greenberg & Yao, 2004). The different strategies which have been engineered to
11
express gene products which can counter attack plant fungal diseases are depicted in Fig. 1 and
are described briefly here.
Figure 1: Enhanced disease resistance in transgenic plants Gene products expressed to counter attack fungal virulence products (Punja 2001).
2.2.1 Responses for secondary barriers
These responses are responsible for increasing secondary barriers to prevent pathogen
penetration and also help the plant strengthen the extracellular matrix. Such responses are
responsible for increased synthesis of phenolic compounds which lead to accumulation of lignin
in the cell wall and production of glycoproteins (Punja, 2001).
2.2.2 Responses for fungal inhibition
This category of responses results in inhibition and digestion of fungal cell wall. The approaches
used involve genes for antifungal activity and genes that prevent fungi from gaining entry in to
12
the plant. Such digesting enzymes include chitinase, glucanase and polygalacturonase (Antony &
Ignacimuthu, 2012; Luca, Adele, Juan, Demetrius, & Felice, 2006). Chitinases which are known
to catalyze chitin hydrolysis have been broadly studied and used in many crops. Wheat derived
Chil194 in tomato conferred resistance to Fusarium oxysporum f.sp. lycopersici, bean chitinase
in tobacco offered resistance to Rhizoctonia solani and chitinase II in barley protected against
Fusarium graminearum (Girhepuje & Shinde, 2011). Other crops that have been modified with
chitinase include apple, alfalfa, carrot, melon, wheat, rice, squash, onion and peanut. In most of
these crops, chitinases were responsible for the reduction in disease severity (Punja, 2001).
2.2.3 Responses for innate defence
These responses enhance the innate plant defence mechanisms by affecting pathogen growth or
neutralizing its products. This is through the use of defensins, phytoalexins, proteinase inhibitors,
pathogen related proteins (PR) or antimicrobial peptides (Punja, 2001). Organisms naturally
defend themselves against pathogenic microorganisms by use of peptides or small proteins like
defensins, lectins and ribosome inactivating proteins (RIP) which inhibit protein synthesis
(Brogden, 2005; Zasloff, 2002). A lot of research has been done to evaluate the different types of
antifungal transgenes in the field (Rommens & Kishore, 2000).
Phytoalexins are plant antibiotics which work on the pathogen by puncturing the cell wall,
disrupting metabolism or preventing reproduction. Phytoalexins have offered varying responses
as far as resistance is concerned. Some crops are protected while others are not (Punja, 2001).
The stilbene synthase genes which control a group of secondary metabolites to produce
phytoalexins have been the most common phytoalexin transgene used (Punja, 2001).
Phytoalexins have been used for generating transgenics in crops like grape, potato, strawberry
and tobacco.
Thionins are antimicrobial proteins that work by causing pore formation on the fungus. The
pores are made after the thionins have bound to phospholipids of the fungal membrane which
eventually causes cell death. Thi2 in Arabidopsis reduced the development and establishment of
Fusarium oxysporum. Thionins have been used in crops like barley, potato and rice. Cecropin A
in rice is responsible for the observed decrease in rice blast fungus, Polygalacturonase inhibiting
13
proteins (PGIP) are a group of plant glycoproteins which inhibit fungal enzymes responsible for
digesting the plant cell walls. In beans, resistance to Colletotrichum lindemuthianum was
proportional to the level of PGIPs activity (Punja, 2001).
Pathogenesis related proteins are induced by pathogens and can be categorized into five classes
PR-1 to PR-5. In Tobacco, PR1A was able to increase resistance to Peronospora tabacina, a
pathogen responsible for the blue mold disease. Osmotin and Thaumatin- like proteins (TLP) are
PR-5 proteins which have also shown antifungal activity to Phytophthora infestans and
Rhizoctonia solani in potato and rice respectively (Punja, 2001). Genes for pathogen related
proteins have been used in several other crops like cotton, barley, wheat, grape, peanut and
sorghum (Collinge, et al., 2010).
2.2.4 Cell death response
The most durable and broad spectrum responses are those that evoke programmed cell death.
These responses include the hypersensitive response (HR) which causes localized cell death and
activates responses in tissues near the site of infection (De-Pinto, Locato, & De-Gara, 2012),
production of reactive oxygen species and the systemic acquired response (SAR) which provides
protection against future infections (Greenberg & Yao, 2004). In this way, plants resist infection
by activating a very effective arsenal of inducible responses upon recognition of the attacking
pathogen. The hypersensitive response can also be initiated through expression of the resistance
genes that recognize and initiate downstream signalling and attenuation of other responses
(Punja, 2001).
2.2.4.1 Resistance genes
Plants are able to recognize pathogens by use of specific receptors or resistance genes (R genes).
Depending on the domains of the nucleus binding site (NBS) present, the R gene products have
been categorized as those with serine threonine protein kinases (PK), trans-membrane domain
(TM) or the Leucine-rich repeats (LRR) (Das, 2010). Although those with the leucine- rich
repeats are the only ones limited to disease resistance (Das, 2010), few of these genes have been
represented in the recently identified Musa genome (Angélique et al., 2012). Products of R genes
interact with an avirulence gene (Avr), resulting in signalling of other responses (Greenberg &
Yao, 2004). Salicylic acid, jasmonate and ethylene are the key signal molecules that mediate
14
expression of the R gene mediated response. Many R genes have been introduced into
susceptible plants to confer disease resistance. Studies on some of the identified plant receptors
that are responsible for pathogen recognition have shown that inactivation or over-expression
results in susceptibility or resistance respectively.
Over-expression of receptor OsBAK1 increased resistance to blast fungus in transgenic rice
while the Arabidopsis EF-Tu receptor in solanaceous plants confers broad spectrum resistance
against various bacterial genera (Andrea, Frederic, & Nurnberger, 2010). The Rpg1 gene in
barley was engineered for resistance to rust stem while mlo controls E. graminis in the same
crop. Ve1 and Ve2 genes from tomato target many Verticillium species in many crops (Dowell
and Woffenden, 2003). R gene (Rpi-blb1) from a close relative of potato offers resistance to
Phytophthora infestans in transgenic potatoes and Rps1-k in soybean (Andrea, et al., 2010).
The major limitation of the R gene approach is that they only recognize a limited range of
pathogens and protection is provided only to a given race or strain. Protection in this case can
easily be lost by a single mutation in the Avr gene of the pathogen (Mc Dowell and Woffenden,
2003). However, recent insight shows that there can be downstream signalling to mediate broad
spectrum resistance if the R gene is introduced together with the corresponding Avr gene
controlled by a pathogen-inducible promoter (Dowell and Woffenden, 2003). Pyramiding of
multiple R genes in a single plant can also be another way of providing resistance to a range of
pathogens (Andrea, et al., 2010).
2.2.4.2 Hypersensitive response
The hypersensitive response (HR) causes pathogen death by sacrificial death of cells localized at
the site of infection in order to avoid spread of the pathogen to healthy plant tissues. HR is
triggered in plants when a plant resistance gene product recognizes a specific pathogen gene
product (Avr) gene. Generally, the HR is accompanied by several defence responses like
production of antimicrobial compounds, rapid cross-linking of cell-wall proteins and production
of active oxygen species which eventually causes death and resistance to pathogen (Dixon, et al.,
1994).
In the first phase of the response, pathogen recognition causes change in the membrane potential
and ion permeability of the plasma membrane. The recognition of pathogen allows the influx of
15
calcium and hydrogen ions and the exit of potassium ions. This movement triggers the HR
leading to cell death and formation of local lesions which have antimicrobial compounds
(Agrios, 2004) In another phase, the cell undergoing HR produces reactive oxygen species
(ROS) which causes cell damage to the pathogen or also acts as a signal to induce other
biochemical responses within plant cells. Internally, HR is expressed by the morphological
change in the mitochondria structure, gradual vacuolization of the cytoplasm and dysfunction of
the membrane (Greenberg & Yao, 2004). Pathogen mimicry by use of other avirulent microbes
can trigger the hypersensitive response in the plant, a prerequisite for other defence responses
and also the systemic acquired resistance. This priming in the long run can protect a plant against
future infections of a broad spectrum of pathogens. (Greenberg & Yao, 2004; Khurana, Pandey,
Sarkar, & Chanemougasoundharam, 2005).
2.2.4.3 Systemic acquired resistance
Some R genes have been associated with SAR, for example Cpr6 and Ssi1genes are known to
control the action of other responses (Rommens & Kishore, 2000). Npr1 which encodes a
transcriptional regulator offers broad spectrum resistance to diseases in Arabidopsis. Chemicals
like salicylic acid and jasmonate are also key inducers of systemic acquired resistance (SAR)
(Delaney et al., 1994). Salicylic acid and jasmonate are chemicals which are able to induce
production of pathogen related proteins even in the absence of pathogen.
2.2.5 Genetic resistance to Fusarium wilt in banana
Strengthening of the cell wall is an important response in providing tolerance to plants. In
banana, interruption of fungal infection in the roots is attributed to the production of gels and
tyloses through expression of cell wall strengthening genes (D. B. Van et al., 2007). Other genes
whose product neutralize or digest fungal cell wall are up-regulated during infection and have
been linked to Fusarium wilt tolerance in banana (D. B. Van, et al., 2007; Xiaoli, Dongru,
Hongbin, & Jinfa, 2007). In one of these studies, quantitative PCR showed that endochitinases
(PR-1) and pectin acetyl esterase (PAE) were quickly up-regulated following infection as
compared to PR-3 and Catalase 2 in tolerant Cavendish (D. B. Van, et al., 2007). These high
levels in turn resulted in high levels of phenolics as observed from infected roots of such
cultivars. PR-1 is involved in antifungal activity while PAE modifies pectin for cell wall
16
strengthening. MpGlu from plantain is also up-regulated during Foc infection while high levels
of peroxidases have been found in Foc resistant hybrids (Xiaoli, et al., 2007).
Like any other necrotrophic fungi, Foc is unable to exist in living plant cells but instead induces
cell death in the plant tissues during invasion, a phenomenon that still can’t be explained
(Shlezinger et al., 2011). Even without a clear understanding of the mode of action, several genes
have been transformed into banana for Fusarium wilt resistance and some have registered
promising results against various races. The human lysosome gene (Pei, et al., 2005) and a plant
ferrodoxin like protein (Pflp) which belongs to the protein ferredoxinis-1 family and involved in
metabolic pathways like photosynthesis and lipid synthesis (Mei, et al., 2011 ) have been used
for Foc race 4 resistance. The Pflp gene also provided protection against banana Xanthomonas
wilt and this resistance is attributed to increased production of reactive oxygen species and
activation of the hypersensitive response (Namukwaya et al., 2012). Through particle
bombardment, the rice thaumatin-like protein (tlp) gene has been used against Foc race 4.
Thaumatin-like proteins are group five pathogenisis related proteins (PR-5) that are naturally
induced in plants during development, stress or pathogen attack (Mahdavi, et al., 2012).
However, proper understanding of the plant defence responses as well as progression of disease
after infection is important to guide the selection of vital genes that can be utilised to generate
transgenic resistance in both the laboratory and in the field.
2.3 Programmed Cell Death
Programmed cell death can be considered as an evolutionary process in which cells are directed
to commit suicide with the ultimate aim of protecting the organisms. In unicellular organisms,
programmed cell death (PCD) is an altruistic way of selecting cells that are best suited for the
environment (De-Pinto, et al., 2012). In multicellular organisms where PCD has been well
studied, homeostasis is maintained when cells receive signals that are aimed at killing unwanted
cells especially those that are damaged, diseased or those that pose harm to the entire organism
such as cancerous cells (Fuchs & Steller, 2011). This takes place in some stages during normal
development, when organisms face environmental stresses, or after pathogen attack (Khurana, et
al., 2005). This gene-directed cell suicide process is also known as programmed cell death.
17
2.3.1 Programmed cell death in animals
In animals, there are distinct morphological steps that are exhibited before death finally takes
place. This form of death which is also known as apoptosis is demonstrated by loss of cell to cell
attachment, cell shrinkage, nucleus condensation due to chromatin breakdown, formation of lytic
bodies and cleavage of DNA into fragments (Gunawardena, Sault, Donnelly, Greenwood, &
Dengler, 2005). Unlike in plants, caspases are released to activate apoptosis, a highly developed
immune response is present and PCD products are actively digested by phagocytic macrophages
(Dickman, 2004; Reape & McCabe, 2008).
2.3.2 Regulators of programmed cell death in animals
2.3.2.1 Caspases
In animals, caspases are usually activated in the early stages of programmed cell death. Caspases
(Cysteine- dependent aspirate- specific proteases) belong to a group of animal proteases which
are required for aspartic acid cleavage of cellular components like the cytoskeleton and nuclear
proteins (Collazo, Chacon, & Borras, 2006). Caspases also activate degrading enzymes like
DNases which digest DNA during apoptosis. Caspases are activated by two pathways. One
occurs inside the cell (intrinsic pathway) and the other takes place outside the cell (extrinsic
pathway). The intrinsic pathway involves the mitochondria and is initiated by signals like
oxidative stress which causes increased permeability of the mitochondria allowing the release of
cytochrome C. The cytochrome C associates with procaspase-9 and the Apoptosis activating
factor 1 (Apaf-1) to activate caspase-3. For the extrinsic pathway, a death receptor interacts with
its ligand on the surface of the plasma membrane and this sets-off other caspases in a cascade of
activation to initiate cell death.
2.3.2.2 The Bcl-2 family genes
This group of regulators have the pro-apoptosis and the anti-apoptosis genes. Usually these genes
work by either dimerizing with other Bcl-2 family proteins, interacting with proteins to control
the mitochondrial homeostasis or opening up ion channels in the mitochondria (K. S. Robinson,
Clements, Williams, Berger, & Frankel, 2011). Pro-apoptosis genes include Bad, Bak Bax and
Bid while the Bcl-2 and Bcl-xL act as the anti- apoptosis genes in mammals.
18
At the genetic level, three functionally conserved genes control apoptosis in C. elegans namely,
Eg-l, Ced3, Ced4 and Ced9. Ced3 and Ced4 genes control cell death while the anti-apoptotic
Ced9 gene encodes a protein that prevents cells from undergoing programmed cell death during
embryogenesis and development (Conradt & Xue, 2005). The Ced9 gene functions by negatively
regulating the activities ofCed3 and Ced4 genes (Pradeep & David, 2004). For PCD to occur, the
product of the Death initiator gene (Eg-l) binds to CED9 protein leading to its dissociation with
the adaptor protein CED4. The CED4 adaptor protein as well as the positive regulator of CED3
is then free to bind to CED3. When CED3 is activated, cell death processes are trigged (Figure
2). On the other hand, when cells need protection, CED3 is not activated due to the interaction of
CED9 and CED4 (Conradt & Xue, 2005). Mammalian counterparts with similar functions have
been identified i.e. caspases, APAF-1 and Bcl-2, respectively (Hengartner & Horvitz, 1994).
Figure 2: Activation of programmed cell death during C. elegans development. A: Genetic pathway of genes in healthy cells and cells that are destined to die. B: Simplified model for the molecular interactions occurring during the activation of programmed cell death (Jagasia et. al., 2005)
19
2.3.3 The concept of programmed cell death in plants
Although PCD is not well understood in plants, there is strong evidence to suggest its existence
despite the fact that it exhibits several differences as compared with animal PCD (Nishawar,
Mahboob, & Khurshid, 2008). However, similarities do exit which show apoptotic like hall
marks as seen in animals (Bridget et al., 2011). For example using TUNEL and electrophoresis,
DNA fragmentation was detected in cowpea leaf cells and tobacco infected with Uromyces
vignae and Tobacco Mosaic Virus respectively (Collazo, et al., 2006). In addition, morphological
hallmarks like cell shrinkage, chromatin condensation and DNA fragmentation occur in plants as
well. However, plants lack true caspases and, depend on the chloroplast and vacuole organelles
for providing degradation enzymes and cellular debris is recycled by degradation to low
molecular weight compounds which are latter taken up by neighbouring cells (Conradt & Xue,
2005). There are several kinds of cell death processes that occur in plants. Programmed cell
death occurs to allow for proper growth and development, and it also occurs in response to
environmental conditions or in response to pathogen attack.
2.3.3.1 PCD for growth and development
Plant physiological processes during growth and development are controlled by PCD (Pennell &
Lambet 1997 and Dickman, 2004). These processes are usually well timed and triggered by
internal factors. These include senescence of leaves to control transpiration, development of
tracheary elements for support, timely death of petals after fertilization, somatic as well as
zygotic embryogenesis and sex determination (Dickman, 2004; Pennell & Lambet, 1997;
Trobacher, 2009). In many cases, cells die to allow proper formation of organ shapes. The
occurrence of the unique perforations in the leaves of Monstera oblique and Aponogeton
madagascariensis plants (E N Lord Christina, Arunika, & Gunawardena, 2011) during
development is also a PCD phenomenon which serves to reduce effective leaf size for heat
transfer and camouflage for herbivores (E N Lord Christina, et al., 2011; Pennell & Lambet,
1997).
2.3.3.2 Environmental induction of PCD
PCD can also occur in plant cells that are exposed to extreme environmental conditions. Such
abiotic stresses include heat shock, water logging, pollutant, exposure to toxins or UV light.
These pressures can easily lead to oxidative stress which initiates cell death. However, external
20
stresses can also induce cell death with for purposes of favouring plant development. For
example, plants deal with external stresses like seed dormancy to allow germination (E N Lord
Christina, et al., 2011). Heat shock treatment at 55°C for 20 minutes to the leaves of the naturally
perforated Aponogeton madagascariensis plant increases cell death as seen by fluorescein
diacetate staining and micrography (E N Lord Christina, et al., 2011).
2.3.3.3 Pathogen induced PCD
Originally, it was proposed that PCD due to pathogen attack occurs to remove entry points of
pathogens by destroying the already infected cells and prevent further spread of disease to
healthy cells. However, it was later observed that PCD takes place not only in plants where the
pathogen establishes itself but also in plants where the defence responses manage to control
disease (Khurana, et al., 2005). Therefore the occurrence of PCD in response to pathogen
infections serves not only to amplify disease defence responses, but can also promote the
aggressiveness and dissemination of some pathogens causing unwanted PCD (Greenberg & Yao,
2004). Therefore, the exact role and regulation of PCD during plant–pathogen interactions needs
understanding. In resistant plants, cell death results from the hypersensitive response which is
localized to the point of injury but can induce the lasting SAR responses (Dickman, et al., 2001).
Necrotrophic pathogens can also directly cause disease by triggering PCD in healthy tissues
(Coffeen & Wolpert, 2004). This kind of cell death has to be well controlled to avoid detrimental
effects. This shows that in necrotrophic pathogens, disease resistance can be achieved through
inhibition of apoptosis while induction of apoptosis is responsible for the resistance achieved by
biotrophs (Khurana, et al., 2005). For example the Apoptosis AtMYB30 gene in Arabidopsis has
been found to confer resistance via the HR associated PCD in response to bacterial pathogens
while the animal anti apoptosis genes Bcl-2, ced9 or Op-IAP are responsible for tolerance to
Sclerotinia sclerotiorum in transgenic tobacco (Dickman, et al., 2001; Khurana, et al., 2005).
2.3.4 Regulators of programmed cell death in plants
2.3.4.1 Caspase like proteins
Even though plants lack true caspases, caspase- like activity has been demonstrated and there are
caspase-like proteins (CLP) that have been identified (D. W. G. Van & Woltering, 2005). For
instance in soybean, PCD triggered by P. syringae pv. glucinea was successfully inhibited by
21
cystatin which is an endogenous caspase inhibitor gene (Khurana, et al., 2005). Metacaspases
and legumins which are found in fungi and protozoa do occur in plants as well.
2.3.4.2 Vacuole processing enzymes
The plant vacuole is an organelle that is believed to play a key role in disease responses.
Depending on the type of pathogen present, the vacuole responses can either be destructive or
non destructive to the vacuole. Destruction occurs after products of lytic activity like the
hydrolytic enzymes are released. In the non destructive pathway, the vacuole fuses with the
plasma membrane to release compounds with antimicrobial activity or the fusion with the plasma
membrane triggers the hypersensitive responses (Hara-Nishimura & Hatsugai, 2011). In several
studies, the proteases known as the Vacuole processing enzymes (VPE) have been associated
with important functions like maturation of seed storage enzymes, maturation of vacuolar
enzymes, mediating the vacuolar collapse to release its contents and activation of caspase 1
activity in tobacco (Hatsugai et al., 2004) and Arabidopsis (Kuroyanagi, Yamada, Hatsugai, &
Hara, 2005). VPE are also known to work as regulators and executors during PCD via the HR
(Hatsugai, et al., 2004).
2.3.4.3 Reactive oxygen species
Just like in animals, the mitochondria an organelle vital for cellular metabolism also plays an
important role in PCD (Theresa & Paul, 2010). Reactive oxygen species (ROS) which are
products of cell aerobic respiration in the mitochondria have been identified as plant regulators
of PCD (E N lord Christina & Arunika, 2012). They act as signals and effectors molecules that
are triggered by abiotic stresses or through the HR response (Dixon, et al., 1994). The ROS
causes damage to biological molecules and structures. Naturally the vacuole has antioxidants like
flavonoids which protect plants to some extent from this effect.
2.3.4.4 BAG family genes
Recently, the Bcl anthanogene (BAG) family genes which were initially found in mammals and
yeast have also been found in plants. These BAG genes have several cellular functions as co-
chaperones for proliferation, development and cell death. In humans, these genes control
tumourigenisis, apoptosis, cell cycle progression and stress responses. BAG genes are believed
to work by acting as adaptor proteins and forming complexes with signalling molecules and
chaperones (Kabbage & Dickman, 2008). In Arabidopsis, the Bag7 gene plays a role in
22
cytoprotection during heat and cold stresses (Williams, Kabbage, Britt, & Dickman, 2010) while
transgenic tobacco with AtBag4 showed tolerance to abiotic stresses like cold, heat and drought.
This protection has been attributed to AtBag4 inhibiting PCD (Kabbage & Dickman, 2008).
2.3.5 Use of PCD inhibition genes in transgenic plants
Several animal derived genes and genes of the Bcl-2 family have been able to complement one
another when used in different organisms including plants (Dickman, et al., 2001). For example,
baculovirus derived p35 and inhibitor of apoptosis (IAP) genes inhibit apoptosis in human,
human derived IAP can control cell death in flies that have IAP defects while animal anti-
apoptosis genes (human Bcl-2, nematode ced9 and baculovirus op-iap) were all able to control S.
sclerotiorum in transgenic tobacco (Dickman, et al., 2001). In another study, Bcl-xL and ced9
genes increased tolerance of tomato to cucumber mosaic virus (Ping, et al., 2004). Such findings
confirm that generally eukaryotes have conserved mechanisms as far as PCD is concerned. Bcl-
xL and ced9 have also been shown to protect banana cells from Agrobacterium-induced
programmed cell death (Khanna et. al. 2007).
23
CHAPTER THREE
METHODOLOGY
3.1 Summary overview
The research work was conducted at the National Agricultural Research Laboratories, Kawanda,
Uganda. Banana cultivars, Sukali Ndizi (susceptible to Foc race l) and Nakinyika (resistant to
Foc race 1) were used as controls. Embryogenic cell suspensions (ECS) of Sukali Ndizi were
transformed with a plant codon-optimised nematode anti-apoptosis gene Mced9. The
transformants were selected on kanamycin and molecular characterisation of putative transgenics
was done using PCR, RT-PCR and Southern blotting.
Using a pot-based small plant bioassay, 30 transgenic lines (5- 10 clones each) were infected
with Foc race 1. Five non-infected and five infected untransformed plants were used as controls.
The plants were kept in the glass house and observed for the development of disease. Scoring for
external disease symptoms was done after 2, 6, 8 and 13 weeks and for internal symptoms after
13 weeks when the plants were split open.
3.2. Binary plant expression vector and banana ECS
Binary vector pYC11 was cloned and provided by Queensland University of Technology,
Australia. The T-DNA region had two gene cassettes (Fig. 3) cloned between the left and right
borders. The Mced9 gene was driven by constitutive maize ubiquitin promoter and the nptII
selectable marker gene was driven by CaMV35S promoter.
_ _
Figure 3: Linear map of the T-DNA region of pYC11 binary plant expression vector used in this study. LB is the left boarder, RB is the right boarder.
Embryogenic cell suspensions (ECS) used in the study were initiated from male flowers of
Sukali Ndizi and maintained at the National Agricultural Research Laboratories, Uganda as per
35SPoly A CaMV35S Ubi nptII Mced9 nos LB RB
24
published protocol (Namanya, Magambo, Mutumba, & Tushemereirwe, 2004). To increase ECS
competence and transformation efficiency, ECSs were sub-cultured 4 days prior to
transformation.
3.3 Bacterial manipulations and Agrobacterium-mediated transformation
3.3.1 Preparation of chemically competent E. coli cells
E. coli strain JM109 cells were inoculated in 5 ml of LB medium (Appendix 1) and incubated at
370C, with shaking. Once optimal growth was reached (O.D 600 nm = 0.5-0.7), the cells were
centrifuged at 6000 rpm, 40C for 10 minutes. The pellet was gently re-suspended in 200mM of
chilled calcium chloride and incubated on ice for 30 minutes. The centrifugation step was
repeated and cells were re-suspended in 5ml of 80mM calcium chloride. Cells were left on ice
for 1 hour before they were used for transformation.
3.3.2 Transformation of E. coli
Binary vector pYC11 was transformed into competent E. coli JM109 cells using heat shock
method. Plasmid DNA (100ng) was added to the competent cells, the tube was gently swirled
and tapped for thorough mixing and incubated on ice for 30 minutes. The cells were heat-
shocked at 420C in a water bath for 30 seconds then quickly returned on ice for 2 minutes. 500μl
of pre-warmed LB media was then added and culture was incubated for 2 hours at 370C, shaking.
100μl of the culture was then plated on selective LB medium containing 100μg ml-1 of
kanamycin and incubated overnight at 370C. A single bacterial colony was picked next day and
cultured overnight in 5 ml of LB medium containing 100μg ml-1 kanamycin and incubated at
370C, with shaking. This culture was used for plasmid purification and restriction digestion to
confirm presence of pYC11.
3.3.3 Plasmid purification
Plasmid DNA was isolated using the alkali lysis method (Sambrook & Russell, 2001). Media
used are described in Appendix 1. A single bacterial colony of JM109/pYC11 was incubated in
10 ml of selective LB medium overnight at 370C, with shaking. 1.5 ml aliquot of the overnight
culture was centrifuged at 12,000 rpm for 2 minute. The pellet was suspended in 100 µl of
solution I using gentle vortexing. 200 µl of freshly prepared Solution II was added and the
contents and mixed rapidly by inverting the tube. The lysate was incubated on ice for 5 minutes
25
before 150 µl of ice cold solution III was added, mixed gently and the tube returned to ice for 10
minutes. The lysate was then centrifuged at 12,000 rpm for 5 minutes at 40C and supernatant was
pipetted into a fresh eppendorf tube. An equal volume of phenol: chloroform solution was added
and the eppendorf was centrifuged at 12,000 rpm for 2 minutes at room temperature. An equal
volume of chloroform: isoamyl alcohol (24:1) was added to the collected aqueous layer in a fresh
tube and the tube was centrifuged at 12,000 rpm for 2 minutes at 40C. For precipitation of the
DNA, the aqueous layer was collected into a new tube and 2 volumes of ethanol and 0.1 volumes
of sodium acetate (3M) was added to the mixture and incubated for 2 hours at -200C. The DNA
was recovered after centrifugation at 12,000 rpm for 10 minutes at 40C and washed with 70%
ethanol. The pellet was air dried and re-suspended in 30 µl of sterile water and 5 µl of the isolate
was checked by electrophoresis on a 1% agarose gel after restriction digestion.
3.3.4 Transformation of Agrobacterium tumefaciens strain AGL1
A single colony of Agrobacterium tumefaciens strain AGL1 cells was inoculated in 50 ml of
YMB media (Appendix 1) and incubated for 2 days at 28°C, while shaking. The cells were
centrifuged at 6000 rpm for 5 minutes and the supernatant discarded. The pellet was re-
suspended in 10 ml of ice-cold distilled water and centrifuged for 5 minutes at 6000 rpm, 4°C.
The pellet was then re-suspended in 10 ml 0.15 M CaCl2 and centrifuged at 5000 rpm for 5
minutes. The supernatant was discarded and pellet re-suspended in 1 ml of chilled 20mM CaCl2.
100µl aliquot of these competent cells was then used for transformation with pYC11.
Binary vector pYC11 (100ng) was added to 100 μl of competent AGL1 cells. The mix was
incubated on ice for 30 minutes, flash frozen in liquid nitrogen for 1 minute and thawed for 2
minutes at 37°C. 500μl of LB medium was added and the culture was incubated at 28°C for 4
hours with gentle shaking at 200 rpm. 100μl of the culture was plated on YMA medium
containing 250μg ml-1 carbenicillin, 25μg ml-1 rifampicin, and 100μg ml-1 kanamycin and
incubated for 3 days at 28º C. A plate streaked with non transformed AGL1 cells on selection
was included as a negative control while a plate with untransformed AGL1 on plain YMA was
used to check for viability of the competent AGL1. After 3 days of incubation at 28°C, single
colonies were picked and grown in YMB in preparation for transformation of banana cells.
26
3.3.5 Transformation of embryogenic cell suspensions of Sukali Ndizi
Agrobacterium-mediated transformation of Sukali Ndizi was carried out as described in Khanna
et al., 2004 with minor modifications as described below. A single confirmed colony of
AGL1/pYC11 was inoculated in 10 ml of YMB media containing 250μg ml-1 carbenicilin, 25μg
ml-1 rifampicin, and 100μg ml-1 kanamycin and incubated for 3 days at 28°C, with shaking at 200
rpm. 5ml of this culture was incubated in 20 ml of LB with antibiotics, overnight at 280C, with
shaking. On the day of transformation the bacterial culture was centrifuged at 5000 rpm for 10
minutes and the pellet re-suspended in TMA1 containing 200μM acetosyringone (AS). The
bacterial was induced for 3 hours with shaking at 25ºC and 70 rpm and the O.D 600 nm was
adjusted to 0.6. 500l of settled cell volume (scv) of ECS, pre-cultured for four days was re-
suspended in 20 ml of pre-warmed (42oC) ECS culture media and heat-shocked for 5 minutes at
45°C. 10 ml of pre-induced Agrobacterium culture was then added to the heat-shocked ECS and
0.02% pluronic acid was added as surfactant. The mix was centrifuged for 5 minutes at 900 rpm
and then left to shake at room temperature for 4 hours at 70 rpm. The cells were incubated on
semi-solid TMA1 media to co-culture (Appendix 1) for 3 days at 22°C in the dark.
3.3.6 Selection, regeneration and acclimatization of transgenics
After 3 days of co-cultivation in the dark, infected ECS were washed 3 times with liquid MA2
medium supplemented with 200μg ml-1 Timentin® and plated on glass filter paper. The filter
discs were transferred to semi-solid MA3 media supplemented with 200μg ml-1 Timentin and
50μg ml-1 kanamycin and kept at 25oC in the dark. The cells on glass filters were sub-cultured on
fresh media every 14 days. After 3 months of selection, embryos were transferred to semi-solid
media RD1 supplemented with 200μg ml-1 Timentin and 100μg ml-1 kanamycin for one month
to allow embryo development and maturation. Mature embryos were transferred to germination
medium MA4 supplemented with 200μg ml-1 Timentin and 100μg ml-1 kanamycin. Germinated
shoots were transferred to MS media supplemented with 200μg ml-1 Timentin and 200μg ml-1
kanamycin to enable root formation. Well rooted plantlets were put on multiplication media and
at this stage leaf samples were collected and analysed by PCR for presence of transgenes. Plants
that tested positive for transgene were further multiplied with subcultured every month to get 10
clones for every line. For every line generated, one clone was maintained as a mother plant in
culture and the rest were rooted. Rooted plants were washed free of medium then weaned into
27
plastic cups containing sterilised soil. These plants were transferred to the glass house and kept
in the humid chamber for 2 weeks and then transferred to bigger pots of 200 mm diameter and
left for 2 months to grow before Foc bioassays were carried out.
3.4 Molecular characterization
3.4.1 DNA extraction
Total genomic DNA was extracted from leaf tissue using the modified CTAB protocol (Grover &
Gowthaman, 2003). Approximately 1 gram leaf tissue was ground in liquid nitrogen and incubated
in 700 µl of extraction buffer (2% CTAB, 200 mM Tris-HCl [pH 8], 0.14 M NaCl, 0.1%
mercaptoethanol, 20 mM EDTA) at 65°C for 30 minutes. Total DNA was extracted using 700 µl
of chloroform-isoamylalcohol (24:1) v/v and precipitated using an equal volume of isopropanol.
Following a wash with 1 ml of 70% cold ethanol, the DNA was treated with RNase A, re-
extracted, re-precipitated, washed and re-suspended in sterile water. The DNA was quantified
and used for PCR and Southern analysis.
3.4.2 PCR analysis
DNA from putative transgenic plantlets was analyzed using PCR to detect the presence of Mced9
and nptII gene sequences. All PCR reactions were performed in eppendorf Master Cycler (EP-
AG 5341 012727, H Hamburg, Germany). The PCR reaction contained 50 ng of plant DNA, 1.2
mM MgCl2, 0.4 μM of each of the primer pairs, 1x PCR buffer, 0.24 mM dNTPs and 0.02 Unit
Taq per reaction of 20 μl. The reaction mixture was subjected to an initial denaturation step of
95oC for 2 minutes followed by 30 cycles of 94oC for 30 seconds; annealing temperatures of
55oC for 30 seconds; 72oC for 2 minutes and a final extension step of 72oC for 5 minutes.
Plasmid vectors were included as positive control while water and untransformed plant DNA
was used as negative controls. The PCR products were run on 1% agarose and gel pictures
captured with gel documentation system.
28
Table 1: Primers used in screening transgenic plants by PCR
Primer name Primer sequence Annealing
temp. ( oC)
Size (bp)
mCed9-midF 5’ GGAAAGAACATAATAGATCTTGGGATG 3’
55
291 Nos-Rev 5’ TGATAATCATCGCAAGACCGGCAACAGGAT 3’
NPTII F 5’ TGATTGAACAAGATGGATTGCACGC 3’
55
620 NPTII Rev 5’ GATGAATCCAGAAAAGCGGCCAT 3’
3.4.3 RNA extraction and RT-PCR analysis
Selected transgenic lines that tested positive for the Mced9 and nptII transgenes using PCR were
tested by reverse transcriptase PCR (RT-PCR) to detect the presence of transcripts. 100mg leaf
tissue was ground to fine powder using liquid nitrogen and used to extract total RNA using the
Qiagen RNeasy kit (Qiagen, 2010). Extracted RNA was treated with DNase to avoid DNA
contamination. A volume equivalent of 1µg RNA was used as template to synthesize cDNA in a
20µl reaction using the RNA to cDNA EcoDry TM premix protocol. Next step was performed
using 100ng of synthesised cDNA. The reaction contained 1.2 mM MgCl2, 0.4 μM of each of the
primer pairs (Table 1), 1x PCR buffer, 0.24 mM dNTPs and 0.02 Unit Taq per reaction of 20 μl.
The reaction mixture was subjected to an initial denaturation step of 95oC for 2 minutes followed
by 35 cycles of 94oC for 30 seconds; annealing temperatures of 59oC for 30 seconds; 72oC for 2
minutes and a final extension step of 72oC for 5 minutes. Plasmid DNA was included as positive
control while water and untransformed plant DNA were used as negative controls. The products
were run on 1% agarose and gel pictures captured with gel documentation system.
3.4.4 Southern blot analysis
To determine the copy number of Mced9 in the genome of the transgenic lines, southern blot
analysis was performed. The PCR DIG probe synthesis kit, the positively charged nylon
membrane, hybridization buffer, blocking reagent, Anti-DIG-AP antibody, the DIG labelled
molecular weight marker and the chemiluminescent films used were procured from Roche and
manufacturer’s instructions were followed for doing Southern blot analysis.
29
3.4.4.1 Probe labeling
DIG-labelled probe (specific for Mced9) was prepared using the PCR DIG probe synthesis kit.
50 µl PCR reactions had 5 µl dNTP mix, 1 µl of Taq polymerase, 1 µl of plasmid DNA and 0.5
µM of forward and reverse primers each. The reaction mixture was subjected to an initial
denaturation step of 95oC for 2 minutes followed by 30 cycles of 94oC for 30 seconds; annealing
temperatures of 55oC for 30seconds; 72oC for 2 minutes and a final extension step of 72oC for 5
minutes.
3.4.4.2 DNA electrophoresis and gel processing
10µg of plant genomic DNA from 6 selected transgenic lines and an untransformed line and
10pg of positive control plasmid DNA (pYC11) was used for Southern blotting. The 30 µg
restriction digest reaction contained 10 µg of genomic DNA, 1 µl EcoR1 restriction enzyme and
1x of the EcoR1 buffer. The digest mix was incubated overnight at 37°C. The digested DNA was
run on a 0.8% agarose gel in 1 X TAE buffer at 60 V for 4 hours. The quality of restriction was
determined after staining the gel in ethidium bromide for 10 minutes and visualizing under UV.
Uniform smearing of DNA confirmed complete restriction. The gel was rinsed in water and
processed at room temperature by depurinating at 35 strokes per minute for 15 minutes, rinsed
with sterile water then denatured at 35 strokes per minute for 20 minutes. The gel was again
rinsed in sterile water, neutralised twice at 35 strokes per minute for 15 minutes with three
changes of buffer. After the final rinse in water, the gel was equilibrated in 2 X SSC buffer for 5
minutes before blotting.
3.4.4.3 DNA transfer
Transfer of DNA fragments from the gel to a positively charged nylon membrane was done by
downward capillary. The transfer pyramid was constructed by stacking tissue paper towels in a
dish followed by 3mm Whatman® paper and then the nylon membrane. The gel was then placed
on the membrane with the underside of the gel in contact with the membrane ensuring that there
are no air bubbles between the membrane and the gel. A paper bridge was used to transfer the 20
X SSC capillary buffer in a tray (Southern, 1975). The set up was left for 8 hours to allow DNA
blotting on the membrane.
30
3.4.4.4 Hybridization
DNA was fixed on the membrane using UV cross-linking and the membrane was rinsed in 2 X
SSC buffer before hybridization. 50 ml Hybridization buffer with 30 µgml-1 of t-RNA was pre-
warmed at 42°C. The membrane was pre-hybridized in 30 ml of the pre-warmed hybridisation
buffer at 42°C, 7 rev/ minute for 1 hour. After 1 hour incubation, the pre-hybridisation buffer
was replaced with 20 ml of hybridization buffer with t-RNA containing the Mced9 probe
denatured at 100°C for 10 minutes then quickly snap-cooled on ice. The hybridization was then
done overnight at 42°C.
3.4.4.5 Membrane washes and DNA detection
The membrane was washed as per manufacturer’s instructions and incubated with antibody
(Anti-DIG-AP) diluted at 1:10 in buffer 2 for 30 minutes at 30 strokes/ minute. The membrane
was washed twice in buffer 1 (with Tween20) for 30 minutes at 45 strokes/ minute and
equilibrated with buffer 3 for 2 minutes. For detection, the membrane was placed on cling film
and 15 drops of CPD star were added onto the membrane. After spreading of the solution, the
membrane was wrapped in the cling film and incubated at room temperature for 5 minutes. The
membrane was exposed to Lumi-chemiluminescent film for 10 minutes in dark before it was
developed.
3.5 Pathogenicity tests
3.5.1 Preparation of Foc inoculum
An isolate of Foc race 1 was obtained from NARO, Uganda pathology department. The isolate
had been collected from a diseased Sukali Ndizi plant at Kawanda and stored as stabs at 4°C. To
prepare the Foc race 1 inoculum, a culture of fungus was first made on full strength PDA (Potato
dextrose agar) media supplemented with 200μg ml-1 ampicilin and incubated for 7 days at 27ºC.
Millet grain (Echinochloa esculenta) was rinsed in tap water to remove dust and debris. The
washed millet grain was soaked overnight to soften the grains and rinsed with distilled water.
Approximately 250 g of the millet were placed in clear autoclave bags and steamed at 121ºC for
1 hour. The millet was left to cool before inoculation. Five PDA agar stabs of 1 mm3 were taken
from a uniformly growing fungal culture using a sterile blade and inoculated into the prepared
31
sterile millet grain. The cultures were incubated at room temperature (23-25ºC) and mixed daily
for 10 days to ensure even distribution of the growing fungus.
For quantifying different spore concentrations, Foc race 1 was grown on full strength PDA and
incubated for 7 days at 27° C. Mycelium of grown Foc race 1 was first harvested by scraping
using a sterile blade and placed in a falcon tube with 20 ml of sterile water. The contents were
mixed vigorously and filtered through a sterile nylon mesh to separate the mycelium from the
spores. The spores in the filtrate were washed twice in 20 ml of water, centrifuged at 1000 rpm
and suspended in 1ml of sterile water. The conidia concentration in the suspension was
determined with a haemocytometer and concentration adjusted to 2 x 104 spores ml-1 and 2 x 10 6
spores ml-1. For millet inoculation, 50 ml of each spore concentration was added to 250 g of
sterile millet and 5 agar stabs were also used for this experiment.
3.5.2 Infection of plants
Well rooted and hardened plants maintained for two months in the glasshouse were used
infection. 300 mm diameter pots were half-filled with sterile soil and 250 g of the millet
inoculum was added before placing the plant and covering the pot with soil. For the experiment
to determine inoculum for consistent infection, 10 plants of Sukali Ndizi and 5 plants of
Nakinyika plants were infected with 250 g of infected millet of each treatment. Transgenic plants
were infected with inoculums that had millet cultured with 5 mycelial agar stabs. The plants were
watered regularly and monitored for the development of the foliar symptoms in the glasshouse.
3.5.3 Disease assessment
Assessment of the Fusarium wilt external symptoms was made by visual observation and scoring
the percentage of infection according to each symptom (Table 2). This was based on a modified
version of the method described by (Mohamed, et al., 1999). A 5-point scale was used for wilting
and yellowing while a 3-point scale was used for stem cracking. These point scale values
determined the Leaf symptom index (LSI) of the cultivar or line.
For the internal symptoms, plants were carefully removed from the pots and the pseudostem was
removed, leaving behind the corm and the root region. The plants were washed to remove soil
from the roots then split longitudinally through the corm. Scores for corm infection intensity
were made and an 8-point scale was used to compare the level of discolouration and to get the
32
corm discolouration index (RDI). The LSI and RDI were used to obtain the disease severity
index (DSI) that was used to determine susceptibility or resistance levels of the cultivar.
33
Table 2: Scale values for the different disease symptoms Scale Yellowing Wilting Stem splitting Corm discolouration
1 No yellowing No wilting No cracking No discolouration
2 Slight yellowing of
the lower leaves
Slight wilting Slight cracking Discolouration at root
and corm junction
3 Yellowing of most
of the lower leaves
(Advanced)
Advanced
(50%)
Advanced Discolouration of 5%
stellar region
4 Yellowing of all
the leaves
(Extensive)
Extensive
(90%)
6- 20% stellar region
discolouration
5 Entire foliage is
brown (Dead plant)
Entire foliage
is brown
21- 50% discolouration
6 More than 50%
discolouration
7 Discolouration of entire
corm
8 Dead plant
3.5.4 Statistical analysis
For pathogenicity test experiments, the Disease Severity Index of each cultivar and transgenic
line was computed from the LSI and the RDI according to (Mohammed et al., 1999).
DSI = . .
34
Table 3: Interpretation of the Disease Severity Index scales
DSI Scales for LSI DSI Scales for RDI Interpretation
1 1 Resistant
Between 1.1 and 2 Between 1.1 and 3 Tolerant
Between 2.1 and 3 Between 3.1 and 5 Susceptible
Between 3.1 and 4 Between 5.1 and 8 Highly Susceptible
The data generated for the transgenic lines was analyzed using DSI values and ANOVA using
the Genstat software. Significance was determined using Dunnett’s test (p < 0.05).
35
CHAPTER FOUR
RESULTS
4.1 Regeneration of Sukali Ndizi cell suspensions transformed with pYC11
Embryogenic cell suspensions transformed with pYC11 were successfully selected on
kanamycin using MA3, RD1 and MA4 media for embryo initiation, development and shoot
regeneration, respectively. Within three weeks selection against the transformed cells was
evident with the untransformed cells turning brown and dying. Transformed cells resistant to
kanamycin developed into small white embryos which increased in size over two months.
Creamy-white immature embryos matured on RDI media and started germinating within 3 weeks
when transferred to MA4 media. A total of 84 mature embryos germinated and 69 shoots
regenerated into plants (Fig. 4).
Figure 4: Selection and regeneration of cells transformed with Mced9 A: Cells on selection media (MA3). B: Developed embryos on selection media (MA3). C: Mature embryos on selection media (RD1) D: Developed shoots on multiplication medium.
36
4.2. Molecular characterization of transgenic plants
4.2.1. DNA analysis of regenerants Total genomic DNA was extracted from the 69 putative transgenic plants as described in section
3.4.1. In case of the lines that were positively transformed, primers specific for nptII amplified
the expected product size of 620 bp and primers specific for Mced9 produced a band of the
expected product size of 291 bp (Figure 5). A total of 42 lines tested positive for both nptII and
Mced9 transgenes.
Figure 5: Representative PCR of transgenic Sukali Ndizi lines transformed with pYC11 A and B: Amplification of nptII C and D: Amplification of Mced9, Lanes 4-37and 39- 99 are test plants; + is plasmid DNA control, - is non-transformed control plant, W: water control, M: Hyper ladder I molecular marker for A and B gels, Hyper ladder II molecular marker for C and D gels.
4.2.2. RT-PCR analysis
Total RNA was extracted from leaf tissues of selected lines using the RNeasy mini kit (Qiagen,
2010). In case of all the lines that were positively transformed, primers specific for Mced9
37
produced a band of the expected product size of 291 bp (Figure 6). All lines tested positive for
Mced9 transgene transcription.
Figure 6: RT-PCR of selected transgenic Sukali Ndizi lines transformed with pYC11. Lanes 5- 96 are test plants +: Plasmid DNA, - : Non-transformed control plant, W: Water control, Hypper ladder II molecular marker.
4.2.3. Southern blot analysis
A total of six transgenic lines that showed tolerance to Foc race 1 in the small plant bioassays
were selected for southern analysis to determine the copy number of the transgene. Lines 83 had
one copy, 55 and 96 had two while 12 had three copies. Signal for sample 27 and 72 could not be
picked up on the blot, probably for technical reasons.
38
Figure 7: Probe labeling and Southern analysis of selected transgenic lines. A: Mced9 DIG labeled probe. M) Molecular weight marker. 1. Labeled Mced9 2. Unlabelled Mced9 3. Water control. B: Southern analysis of transgenic lines: M) DIG labeled marker. – is untransformed plant. + is plasmid pYC11. 12, 27, 55, 72, 83, 96 are transgenic lines.
4.3 Pathogenicity of Foc race 1 isolate
Tissue culture derived wild type plants of both Sukali Ndizi (27 susceptible) and Nakinyika (10
Resistant) were evaluated for disease response to a Foc race 1 isolate. The plants were infected
with Foc race 1 inoculum from agar stabs as described in section 3.5.2. Table 1 shows the
computed DSI values for the yellowing, wilting, stem cracking and corm discolouration, 8 weeks
after infection. The DSI values for stem cracking at 2.0 indicated Sukali Ndizi tolerance while
wilting, yellowing and corm discolouration indicated severe and highly severe responses
respectively (Table 3 and Table 4). Nakinyika was resistant for both stem cracking and corm
discolouration. Foc 1 isolate was considered pathogenic to Sukali Ndizi based on wilting,
yellowing and corm discolouration symptoms.
Table 4: Disease severity of Foc race 1 on tissue cultured plants
Cultivar DSI (Sukali Ndizi) DSI (Nakinyika)
Yellowing 2.6 Susceptible 1.5 Tolerant
Wilting 2.7 Susceptible 1.5 Tolerant
Stem cracking 2.0 Tolerant 1.0 Resistant
Corm discolouration 5.7 Highly susceptible 1.0 Resistant
39
4.4 Determination of Foc race 1 inoculum for consistent infection.
A total of 30 plants of Sukali Ndizi and 15 Nakinyika were infected with 250 g of millet pre-
infected with 3 different concentrations of fungus i.e. 5 agar stabs, 50ml of fungal suspension
containing 2 x 10 4 and 2 x 106 spores ml-1. In each treatment, ten Sukali Ndizi and five
Nakinyika plants were infected and observed for eight weeks. Sukali Ndizi leaves showed
yellowing two weeks after infection as compared to Nakinyika which yellowed after 4 weeks.
After 2 weeks, Sukali Ndizi plants infected with 2 x 106 spores ml-1 and 5 agar stabs looked
similar in yellowing. The wilting in Sukali Ndizi after 4 weeks’ treatment with 2 x 106 spores ml-
1 and 5 agar stabs showed no differences (Figure 9). For the wilting and corm discolouration
symptoms, all the treatments showed the same level of responses in Sukali Ndizi after 8 weeks.
However DSI values obtained in Sukali Ndizi from treatment 2 x 104 spores ml-1 were lower in
all cases. Furthermore, in treatment 2 based on the corm discolouration, Nakinyika a cultivar
known to be resistant instead showed tolerance (Table 5). Therefore, 5 agar stabs were selected
for all subsequent infection experiments.
Figure 8: Representative picture showing internal and external symptoms of plants. Tissue culture derived plants at 8 weeks after infection. Plants 1, 2, 3 and 4 are Sukali Ndizi cultivar and Control plants are Nakinyika cultivar.
40
Table 5: Disease severity index (DSI) of control plants infected with different inoculum concentrations
CULTIVAR SYMPTOM Treatment 1 2 x10 4 spores ml-1
Treatment 2 2 x 106 spores ml-1
Treatment 3 5 agar stabs
Sukali Ndizi Yellowing
2.9 Susceptible
3.9 Highly susceptible
3.1 Highly susceptible
Wilting
1.4 Tolerant
2.2 Tolerant
2.5 Tolerant
Corm discolouration
5.2 Highly susceptible
6.4 Highly susceptible
5.4 Highly susceptible
Nakinyika Yellowing
2.0 Tolerant
1.0 Resistant
1.4 Tolerant
Wilting 1.4 Tolerant
1.2 Tolerant
1.6 Tolerant
Corm discolouration
1.0 Resistant
1.4 Tolerant
1.0 Resistant
Figure 9: External symptoms of Sukali Ndizi infected with Foc race 1 treatments. A: Plants before infection B: Symptoms observed two weeks after infection with 5 agar stab treatment. C: Symptoms observed two weeks after infection with 2 x 106 spores ml-1 treatment D: Symptoms observed four weeks after infection with 5 agar stab treatment E: Symptoms observed four weeks after infection with 2 x 106 spores ml-1 treatment F: Symptoms observed four weeks after infection with 2 x 104 spores ml-1 treatment.
41
3.5 Evaluating the reaction of transgenics to Foc race 1 infection
A total of 28 transgenic lines of Sukali Ndizi with 10 replicates each were inoculated with 250g
of millet infected with Foc 1 using 5 agar stabs. Scores for external symptoms were recorded
after 6, 8 weeks and 13 weeks. External symptoms started showing six weeks after infection and
they intensified with increase in the duration of exposure to the fungus (p < 0.001). The lines
showed a significant difference in the level of susceptibility to Foc 1 infection for all the
symptoms i.e. yellowing (p < 0.001), wilting (p < 0.001) and corm discolouration (p < 0.001).
When all the mean symptom scores were subjected to Dunnett’s test, six lines were significantly
different from the infected control plants basing on the corm discolouration (p < 0.001) as shown
in Table 6.
42
Table 6: Disease severity index (DSI) of transgenic lines 13 weeks after Foc race 1 infection
Transgenic line #
# of clones
Mean Symptom Scores
Yellowing Wilting Corm discoloration
# of infected plants
4 8 4.5 4.6 7.5 8 5 7 3 3.1 6.3 7 6 6 4.2 4 6 4 8 10 3.8 3.9 6.5 8 9 6 3 3.2 5.5 6
11 10 3.6 3.9 6.6 10 12 6 2 2.5* 3.1* 2 14 7 2.7 2.7 5.7 6 21 7 3.9 3.9 7.1 7 27 7 1.5* 1.8* 2.3* 1 28 8 4.5 4.8 7.6 8 30 10 3.4 3.5 6.5 9 31 8 2.5 3.1 5.4 6 33 6 2.8 3.3 6.2 6 37 5 1.2* 2.0* 4.4 5 39 8 3.8 3.6 6.5 8 46 5 3.3 3.7 6.3 5 48 7 4 4.1 7.1 7 53 8 3.8 3.9 6.6 7 55 7 2.3 2.4 3.7* 2 61 7 3.4 3.7 6 6 65 8 4.4 4.9 6.1 8 66 9 3.6 3.8 6.4 9 72 7 1.9* 2.1* 2.4* 1 80 7 4.9 4.9 6 7 83 9 1.8* 2.1* 2.4* 3 96 6 2 2.5 3.5* 3 99 7 2.6 2.7 6.3 7
Infected Control
5 4.6 4.8 7.6 5
* Denotes the mean scores that were significantly different from the infected control plants. Based on the degree of corm discolouration, the transgenic lines were placed into three categories of disease severity. Based on the mean symptom score, lines 27, 72 and 83 were classified as tolerant, 12, 37, 55 and 96 as susceptible while the rest as highly susceptible to Foc race 1 infection (Figure 10).
43
Figure 10: Levels of disease severity shown by the Mced9 transgenic lines after Foc race1 infection. For each given transgenic line, the total number of replicates that were severely infected (N > 3)
was determined. Four lines had 2 or less replicates, two lines had 3 replicates while the rest had
more than 5 replicates with severe corm discoloration symptoms (Table 6).
0
1
2
3
4
5
6
7
8
27
72
83
12
96
55
37
31 9
14 6
61
80
65
33 5
46
99
66 8
30
39
11
53
21
48 4
28
Infected
Control
Response ofMced9 transgenic lines to Foc Race 1 infection
Based on Mean Sympton Score
44
Figure 11: Transgenic lines 27, 72 and 83 showed tolerance to Foc race 1
45
Figure 12: Transgenic lines 12, 55 and 96 showed mild corm discoloration after infection
46
CHAPTER FIVE
DISCUSSIONS, CONCLUSIONS AND RECOMMENDATION
5.1 General discussions
In the recent years, in-vitro assays utilising organic extracts with different inhibitory metabolites
have been assessed for control of fungal development or suppression of fungus in several plants
including banana (Al-hetar, Zainal, Sariah, & Wong, 2011; Pei, et al., 2005; D. B. Van, et al.,
2007). In the quest towards generating resistance to Fusarium wilt in banana, genetic engineering
strategies are being employed since conventional means have the drawback of introducing
undesirable traits (Sági, et al., 1997). Genes that target the pathogen itself or neutralise the
pathogen derived metabolites are being exploited for providing resistance to Foc in susceptible
cultivars. Two lines of a susceptible cultivar transformed with a plant ferrodoxin like protein
(flp) gene resulted in 14.2 % and 20.8 % disease severities compared to the wild type which had
41.6 % after Foc 4 infection (Mei, et al., 2011 ). Similarly, transgenic Pisang Nangka cultivar
with the rice thaumatin-like protein (tlp) had disease incidence of 29.4 % compared to the control
plant which had 89.1 % after 4 weeks of infection (Mahdavi, et al., 2012). Although these genes
showed lower disease severities compared to the control plants, the necrotrophic nature of
Fusarium oxysporum demands a better resistance strategy would also prevent the fungus from
killing the plant cells after infection. Such a strategy will provide more sustainable Fusarium wilt
resistance. Anti-apoptosis genes that are able to prevent cell death after infection have shown
promising protection in tomatoes, tobacco and banana when challenged with various pathogens
(Dickman, et al., 2001; Paul, et al., 2011 ; Ping, et al., 2004). In the present study, the effect of
Foc race 1 infection on transgenic Sukali Ndizi banana containing the anti-apoptosis gene Mced9
has been evaluated.
5.2 Transformation of Sukali Ndizi banana cultivar
Previously, recalcitrance to transformation hindered attempts towards introducing novel traits in
banana (Ganapathi et al., 2001). However, the transformation and regeneration frequencies of
several banana cultivars have been improved over the years and the problems are now
encountered only with some specific cultivars (Arinaitwe, 2008; Khanna, Doug, Jennifer, &
47
James, 2004). Transformation of Sukali Ndizi cell suspensions using the Agrobacterium-
mediated methods has been successfully done for other traits like resistance to bacterial wilt
disease (Leena, Henry, Jaindra, & Wilberforce, 2010) and stimulation of the cell cycle
(Talengera, Beemster, Tushemereirwe, & Kunert, 2012). In this study, transformation of Sukali
Ndizi with a nematode anti-apoptosis gene Mced9 was successfully achieved and a total of 42
independent transgenic lines were obtained. Following the transformation and regeneration
processes, the presence of Mced9 in putative regenerants was confirmed by PCR analyses. Over
90% of randomly selected putative transgenic lines contained Mced9 gene, indicating that the
antibiotic selection process was efficient. Prior to assessment of transgenics in the green house, it
was important to find out whether Mced9 was expressed and integrated in the genome of these
transgenic lines. Transgene expression patterns is commonly analysed using reverse transcription
PCR (RT-PCR) analyses or using a more robust gene expression analysis by quantitative PCR
(qPCR) (Claire, Annaı¨ck, & Be´ne´dicte, 2004). Selected PCR positive lines were analysed by
RT-PCR to detect presence of transcripts. All the lines analysed showed presence of transcript.
In general, for stable transgene expression, transgenic lines with a single copy are preferred
(Vibha, Olin, & David, 1999). Several studies have shown that transgenics generated using
Agrobacterium-mediated transformation system have lower transgene insertions with high
frequencies of single transgene copy. Transgene integration patterns are commonly assessed by
southern blot analysis. In these analyses, the number of bands or signals in a given transgenic
line represents the number of transgene insertions whereas the intensities of the observed bands
or signals represent transgene copy numbers. Differences in banding patterns show differences in
transgenic lines. To detect the integration patterns of Mced9 gene in these transgenic lines,
genomic DNA from selected lines were subjected to southern blot analysis. Out of the six
selected lines analysed, one line had integrations at 3 sites, two lines had two and one line had a
single integration site and two lines didn’t show any signal (Figure 6). Although line 27 showed
presence of transcript (Figure 6), signal for this line was not detected in Southern blots, probably
because of technical reasons. However, because of the low clarity of the southern blot obtained
in this study, it cannot be confidently used to draw confirmatory conclusions on the integration
profile.
48
5.3 Foc susceptibility in Sukali Ndizi Different infection methods have been used for screening banana plants with Fusarium wilt.
These include immersion of roots in spore suspensions of known concentrations or use of a
substrate like Fumonisin. The present study used millet grain which favours spore multiplication
and survival of the fungus (L. J. Smith, et al., 2008). It has previously been confirmed that East
African highland banana cultivars (a group to which Nakinyika belongs) are resistant to Foc race
1 while Sukali Ndizi is susceptible under field conditions (Kangire, Tushemereirwe, &
Nowankunda, 1999). When these two cultivars were infected, the Foc race 1 isolate used in this
study was able to infect both cultivars. However, the corm symptoms were the best indicators for
Fusarium infection since Sukali Ndizi was highly reactive even at low spore concentrations
while Nakinyika showed only mild symptoms even at the concentration of 2 x 106 spores ml-1
(Table 4 and Table 5). Both susceptible and resistant plants usually get infected by Foc and show
foliar symptoms but complete obstruction of hypheal development is believed to occur only in
the resistant plants (Nasir, et al., 2003). Occlusion of hypheal development prevents fungal
spread and this later allows the plant to eliminate the fungus using other plant defence responses.
5.4 Inoculum preparation and host infection Infection using different forms of Foc race1 inocula with Sukali Ndizi and Nakinyika proved that
consistency was obtained when agar stabs are used to infect millet grain as compared to the spore
suspensions. In other studies with other cultivars, infections have been achieved with spore
suspensions (Mahdavi, et al., 2012; Pei, et al., 2005; Wei-ming, et al., 2011). However, there are
differences in the proportion of different spore types (macroconidia, microconidia and
chlamydospores) that different fungal isolates produce even when they belong to the same race
(Groenewald, Berg, Marasas, & Viljoen, 2006). The proportion of spore types present in the
infection culture affects the virulence of the fungus. The agar stabs contain mycelium along with
the spores which could be a reason for better infection since the mycelium is responsible for
nutrient absorption, quick colonisation and hence quick multiplication of the fungus. Although
we did not establish the number of spores contained in the 5 agar stabs, the spore concentration
present at the time of infection had also changed in all the treatments. This change was due to
proliferation of fungus after colonisation of the millet grain. In order to establish the actual
concentration of the fungal inoculum a plant receives on infection, the number of spores per
gram of millet grain can be determined.
49
5. 5 Response of transgenic plants to Foc race 1 infection After regeneration and preliminary PCR analyses, selected lines were multiplied, up to 10 clones,
and transferred to the green house. All plants, both transgenic and controls were exposed to
similar growth and infection conditions (Section 3.5.2.). Data analysis, which included
yellowing, wilting and corm discolouration, showed variable Foc disease responses among the
tested transgenic lines. The evaluated transgenic lines were categorized according to how they
responded to the fungal infection as tolerant, affected susceptible or highly susceptible. Lines
27, 72, and 83 showed tolerance, lines 12, 37, 55 and 96 showed some susceptibility whereas the
rest of the lines were as susceptible as the wild type controls (Figure 10). When the transgenic
plants were compared statistically with the infected non-transgenic plants, lines 12, 27 55, 72, 83
and 96 were significantly better than the control plants (p < 0.001) (Table 6). Similar
observations have been previously reported in tobacco expressing ced9 with the level of
resistance displayed ranging from highly tolerant to completely resistant after S. sclerotiorum
infection (Dickman, et al., 2001).
For pathogenicity studies, the number of infected clones of a given line can also be considered
indicative of the level of susceptibility. Lines with less than 3 infected clones are better
indicators of resistance than those with more clones showing infection. Four lines had only 1 or
2 clones that showed severe corm damage after Foc race 1 infection (Table 6). Of these lines,
two (line 27 and 72) were only mildly affected by Foc race 1 infection. Since all the infected
transgenic lines were PCR checked, the variable response levels among these transgenic lines
could be due to variable expression and stability which is reported to be caused by environmental
effects, promoter methylation, inter-loci interactions and gene silencing (Marenkova, Loginova,
& Deineko, 2012). The lines generated as part of this study were evaluated for a single growth
cycle and the performance of these genes in ratoon crops could not be assessed because of time
constraints. For assessing long term transgene expression stability, these lines need to be
evaluated in the field for at least up to the 5th ratoon crop.
5.6 Apoptosis as a source of resistance Apoptosis is an energy dependant type of death in which cells are directed to die in order to
allow proper development and functioning. This gene regulated process has key morphological
50
features in animals which occur before the cell is destroyed (Collazo, et al., 2006). The main
activators of this process are the caspases which interact with the Bcl-2 family proteins via either
the intrinstic or extrinsic pathways. The Bcl-2 family proteins are evolutionary conserved in
eukaryotes and have both the pro-apoptosis (Bad, Bak Bax and Bid) and anti-apoptotic (Bcl-2
and Bcl-xL) genes in animals. The anti-apoptosis genes check the apoptosis process to prevent
unnecessary killing of required cells. In C. elegans, apoptosis is regulated by four genes Eg-l,
Ced3, Ced4 and Ced9. The Ced9 anti-apoptosis gene works by preventing cells from undergoing
programmed cell death during embryogenesis and development (Conradt & Xue, 2005).
Programmed cell death occurs in plants although it exhibits several differences as compared to
that in animals where most of advanced studies have been conducted. Plants also display the key
morphological hallmarks of apoptosis although they lack true caspases and depend on vacuole
enzymes for eliminating apoptotic remains (Bridget, et al., 2011). Animal derived anti-apoptosis
genes have shown promising protection in plants when challenged with various pathogens. The
human Bcl-2, nematode Ced9 and baculovirus op-iap were all able to control S. sclerotiorum in
transgenic tobacco (Dickman, et al., 2001), while the human Bcl-xL and nematode Ced9 genes
increased tolerance of tomato to cucumber mosaic virus (Ping, et al., 2004). Such findings
suggest that the products of these anti-apoptosis genes interact with the natural homologues
present in plants. Furthermore, some plant Pathogen Related (PR) genes and R genes in plants
have been found to be closely related to mammalian Apaf-1 and the nematode ced4 which genes
are known to be regulators of programmed cell death. Recently, it has also been found that the
products of these genes (Apaf-1, ced4 and plant R gene) also share amino-terminal effector
domains which could further show homology (E N lord Christina & Arunika, 2012). Even if
anti-apoptosis genes have so far not yet been identified in plants, some Bcl-2 associated
anthanogenes (BAG) have been found (Juqiang, Cixin, & Hong, 2003). In Arabidopsis, eight
BAG genes have been identified and the AtBAG6 gene is associated with reduced disease
development in B. cinerea (Kabbage & Dickman, 2008). Other orthologous sequences of PCD
suppressors that could be involved in providing tolerance include Bax inhibitor 1 (BI-1) and
defender against apoptotic death (DAD) (Xiaojie et al., 2011). It is therefore possible that plant
protection via cell death inhibition in naturally resistant plants occurs through BAG genes or Bax
51
inhibitors which interfere with the products of R genes and pathogenesis related proteins to
eventually prevent death of cells.
5. 7 Comparison with other studies using apoptosis approach
Unlike other studies where the anti-apoptosis genes caused morphological alterations in some of
the transgenic lines, all the plants in this study remained normal. Some studies have reported that
some plants had stunted growth or altered leaf shape (Dickman, et al., 2001; Paul, et al., 2011 ).
However, some of the transgenic ced9 tobacco plants that had moderate gene expression and
high pathogen resistance maintained the normal morphology after challenge with S. sclerotiorum
(Dickman, et al., 2001). This could mean that the negative gene effects increase with higher gene
expression levels or higher protein accumulation.
5. 8 Conclusions and recommendations
The results obtained in this study demonstrated that the Sukali Ndizi cultivar can be successfully
transformed using Agrobacterium tumefaciens and male flower derived embryogenic cell
suspensions. Modified C. elegans Mced9 gene driven by maize ubiquitin promoter expressed in
the transgenics generated and provided significant protection to at least three transgenic Sukali
Ndizi lines against Fusarium wilt. These lines can now be multiplied and evaluated in a disease
screening trial in the field with reference cultivars for resistance and tolerance included.
Although this study used a plant codon optimised synthetic gene of nematode origin
successfully, using genes of plant origin would be preferable for purposes of public acceptance
(Enoch, Justus, & Jose, 2011). The BAG genes, that are functionally very closely associated with
the animal anti-apoptosis genes have been identified and isolated from Arabidopsis and rice and
are now being used in a parallel study at QUT for developing Foc resistance. With the recent
completion of the banana genome, sequence homologues of the genes involved in programmed
cell death can also be isolated from banana (Angélique, et al., 2012) with the aim of generating
Fusarium wilt tolerant banana cisgenics.
52
Appendices
Appendix 1
Bacterial culture media, extraction and electrophoresis buffers
A) LB medium (Litre)
10 g Bacto-tryptone, 5 g Yeast extract 10 g NaCl, 15 g Bacto agar, pH 7.0
B) Yeast mannitol medium (Litre)
10 g Mannitol, , 0.4 g Yeast extract, 0.1 g K2HPO4 , 0.4 g KH2PO4 , 0.1 g NaCl , 0.2 g
MgSO4.3H2O, 5 g Bacto agar, pH 6.8
C) TAE electrophoresis buffer (1litre 50x stock)
242 g Trisma base, 57.1 ml Glacial acetic acid, 0.5 M EDTA (pH 8.0).
D) CTAB Buffer (DNA):
2 % CTAB, 2 M NaCl, 25 mM EDTA, pH 8, 100 mM Tris-HCl, pH 8, 2%
Polyvinylpyrrolidone (PVP MW 40000).
E) TE buffer
10 mM Tris-HCl, pH 8.0, 1 mM EDTA
F) Loading dye (6X): 0.25 % (w/v) bromophenol blue, 50 % TE, 50% glycerol
G) Solution I 50 mM glucose, 10 mM EDTA (pH 8.0), 25 mM Tris HCl
H) Solution II 0.2 N NaOH, 1 % SDS
I) Solution III 60 ml Potassium acetate solution, 11.5 ml Glacial acetic acid, 28.5 ml H2O
53
Appendix 2
Cell culture and regeneration media
A) MA2 cell suspension media
Compound Amount (g/L)
MS Basal Salts 4.300
MS vitamins 0.103
Biotin 0.001
2,4-D 0.001
Glutamine 0.990
Malt Extract 0.1
Sucrose 30.00
pH 5.3
B) TMA1 media
Compound Concentration (g/L)
MS Macro 1/10 strength MS Micro Full strength MS vitamins Full strength Fe complex Full strength Biotin 0.001 Malt extract 0.100 Glutamine 0.100 Proline 0.230 Myo-Inositol 0.100 (only in semi-solid co-culture media) Citric acid 0.060 (only in semi-solid co-culture media) Ascobic acid 0.060 PVP 10 g in semi-solid co-culture media, 5 g liquid medium L- cysteine 0.400 IAA 0.001 NAA 0.001 2,4-D 0.004 Glucose 10.00
Sucrose 30 g in semi-solid co-culture media, 85.5 g liquid media)
Gelrite 6g in solid co-culture media
54
C) MA3 Embryo development medium
Compound Concentration (g l-1) SH Basal salts powder 3.2 ( Cat #S6765 Sigma) MS vitamins Full strength Biotin 0.001 Proline 0.230 Glutamine 0.100 Malt extract 0.100 Ascobic acid 0.060 PVP 10 10.00 Myo- inositol 0.100 Citric acid 0.060 L- cysteine 0.400 NAA 0.0002 Zeatin 0.00005 Kinetin 0.0001 2ip 0.0002 Sucrose 45.00 Lactose 10.00 Gelrite 2.4 pH 5.3
D) MA4 Embryo germination media
Compound Concentration (g l-1) MS Salts Full strength MS vitamins Full strength BAP 0.00005 IAA 0.00005 Sucrose 30 Phytagel 2.4 pH 5.8
55
Appendix 3
Media stock solutions A) MS Macronutrients
Components Amount (mg l-1)
MgSO4.7H2O 370
KH2PO4 170
KNO3 1900
NH4NO3 1650
CaCl2.2H2O 440
B) MS Micro nutrients
Components Amount (mg l-1)
H3BO3 6.2
MnSO4.4H2O 22.3
ZnSO4.7H2O 8.6
Na2MoO4.2H2O 0.25
CuSO4.5H2O 0.025
CoCl2.6H2O 0.025
KI 0.83
C) MS Iron complex (100X)
Components Amount (mg l-1)
FeSO4.7H2O 27.8
Na2EDTA.2H2O 37.3
56
D) MS Vitamins
Components Amount (mg l-1)
Thiamine HCl 0.1
Pyridoxine HCl 0.5
Nicotinic acid 0.5
Glycine 2
Myo-inositol 100
57
Appendix 4
Southern analysis buffers and stocks
A) Depurination buffer
0.25 M HCl
B) Denaturation buffer
1.5 M NaCl
C) Neutralization buffer
1 M Tris-HCl (pH 7.2), 0.373 g EDTA
D) 20 X SSC buffer
3 M NaCl, 0.3 M Na-citrate pH 7.0.
E) 2 X washing solution
2 X SSC solution, 0.1% SDS
F) Buffer 1
100 mM Maleic acid, 150 mM NaCl, pH 7.5
G) Buffer 2
Buffer 1, 1 % blocking buffer
H) Buffer 3
100 mM Tris-HCl, p H 9.5, 100 mM NaCl
58
REFERENCES
Agrios, G N. (2004). Plant Pathology (5th ed.). London: Academic Press.
Akila, R, Rajendran, L, Harish, S, Saveetha, K, Raguchander, T, & Samiyappan, R. (2011). Combined application of botanical formulations and biocontrol agents for the management of Fusarium oxysporum f.sp. cubense (Foc) causing Fusarium wilt in banana. Biological Control, 57, 175-183.
Al-hetar, M.Y, Zainal, M.A Abidin, Sariah, M, & Wong, M.Y. ( 2011). Antifungal Activity of Chitosan against Fusarium oxysporum f.sp . cubense. Journal of Applied Polymer Science, 120, 2434-2439.
Andrea, A G, Frederic, B, & Nurnberger, T. (2010). Biotechnological concepts for improving plant innate immunity. Current opinions in Biotechnology, 21, 204-210.
Angélique, D’Hont, France, Denoeud, Jean-Marc, Aury, Franc-Christophe, Baurens, Françoise, Carreel, Olivier, Garsmeur, . . . Jim, Leebens-Mack. (2012). The banana (Musa acuminata) genome and the evolution of monocotyledonous plants. Nature. doi: 10.1038/nature11241
Antony, Ceasar S, & Ignacimuthu, S. (2012). Genetic engineering of crop plants for fungal resistance: role of antifungal genes. Biotechnology letters, 34, Issue 6, pp 995-1002(6), 995-1002.
Arias, P, Dankers, C, Liu, P, & Pilkauskas, P. (2003). The world banana economy 1985-2002 (pp. 7-12). FAO Rome.
Arinaitwe, G. (2008). Improved Agrobacterium - mediated Transformation Methods for Banana and Plantain. (Unpublished doctoral dissertation) Catholic University of Leuven, Belgium.
Arvanitoyannis, S Ioannis, Mavromatis, G Athanassios, Garyfalia, Grammatikaki-Avgeli, & Michaela, Sakellariou. (2008). Banana: cultivars, biotechnological approaches and genetic transformation. International Journal of Food Science and Technology 48, 1871-1879.
Asten, P J A Van, Florent, D, & Apio, S. (2008). Opportunities and constraints for dried dessert banana export in Uganda. Paper presented at the International banana conference, Mombasa Kenya.
Beer, de Z C, Steven-Ellis, A, & Husselman, J H. (1999). Preliminary assessment of Cavendish banana clones for resistance/tolerance to Fusarium wilt. In Banana Fusarium wilt management: Towards sustainable cultivation. Paper presented at the Proceedings of the International workshop on the banana Fusarium wilt disease, Genting Highlands Resort Malaysia.
59
Beer, Z D. (1997). Fusarium tolerance and horticultural characteristics of some FHIA hybrids. Studio Novell, Sandton, South Africa: Banana growers association of South Africa year Book 2.
Bentley, S, Pegg, K G, Moore, N Y, Davis, R D, & Buddenhagen, I W. (1998). Genetic variation among vegetative compatibility groups of Fusarium oxysporum f.sp. cubense analysed by DNA fingerprinting. Phytopathology, 88, 1283-1288.
Bridget, Hogg V, Joanna, Kacprzyk, Elizabeth, Molony M, Conor, O’Reilly, Thomas, Gallagher F, Patrick, Gallois, & Paul, McCabe F. (2011). An in vivo root hair assay for determining rates of apoptotic-like programmed cell death in plants. Plant methods, 7(45), 2-9.
Brogden, K A. (2005). Antimicrobial peptides: Pore formers or metabolic inhibitors in bacteria? Nature Reviews Microbiology, 3(3), 238-250.
Chillet, M, Abadie, C, Hubert, O, Chilin-Charles, Y, & Bellaire, L de Lapeyre de. (2009). Sigatoka disease reduces the greenlife of bananas. Crop Protection, 28, 41-45.
Christina, E N lord, & Arunika, H L A N Gunawardena. (2012). Programmed cell death in C. elegans, mammals and plants. European Journal of Cell Biology, 91(8), 603-613.
Christina, E N Lord, Arunika, H L, & Gunawardena, A N. (2011). Environmentally induced programmed cell death in leaf rotoplasts of Aponogeton madagascariensis. Planta 233, 407-421.
Chunyu, Li, Shi, Chen, Cunwu, Zuo, Qingming, Sun, Qian, Ye, Ganjun, Yi, & Bingzhi, Huang. (2011). The use of GFP-transformed isolates to study infection of banana with Fusarium oxysporum f.sp. cubense race 4. European Journal Plant Pathology 131, 327-340.
Claire, Gachon, Annaı¨ck, Mingam, & Be´ne´dicte, Charrier. (2004). Real-time PCR: what relevance to plant studies? Journal of Experimental Botany, 55(402), 1445-1454.
Coffeen, WC, & Wolpert, TJ. (2004). Purification and characterization of serine proteases that exhibit caspase-like activity and are associated with programmed cell death in Avena sativa. The Plant Cell 16, 857-873.
Collazo, Cyrelys, Chacon, Osmani, & Borras, Olando. (2006). Programmed cell death in plants resembles apoptosis of animals. Biotecnologia Aplicada, 23, 1-10.
Collinge, D. B., Jorgensen, H. J., Lund, O. S., & Lyngkjaer, M. F. (2010). Engineering pathogen resistance in crop plants: current trends and future prospects. Annual Review of Phytopathology, 48, 269-291. doi: 10.1146/annurev-phyto-073009-114430
Conradt, B., & Xue, D. (2005). Programmed cell death. WormBook, 1-13. doi: 10.1895/wormbook.1.32.1
Das, Avijit. (2010). Abiotic Stress Adaptation in Plants. Division of Biochemistry, Central Rice Research Institute India: Physiological, Molecular and Genomic Foundation pp.371–383.
60
De-Pinto, M C, Locato, V, & De-Gara, L. (2012). Redox regulation in plant programmed cell death. Plant, Cell and Environment 35, 234-244.
Debabandya, M, Sabyasachi, M, & Namrata, S. (2010). Banana and its by-product utilization: an overview. Journal of Scientific and Industrial Research, 69.
Delaney, T P, Uknes, S, Vernooij, B, Fredrich, L, Weymann, K, Negrotto, D, . . . Ryals, J. (1994). A central role of salicylic acid in plant disease resistance. Science, 266, 1247-1250.
Dickman, M B. (2004). Can model plants help banana improvement through biotechnology? InfoMusa. The International Journal on Banana and Plantain, 13(2), 6-11.
Dickman, M B, Park, Y K, Oltersdorf, T, Li, W, Clemente, T, & French, R. (2001). Abrogation of disease development in plants expressing animal anti-apoptotic genes. Proceedings of the National Academy of Sciences USA, 98(12), 6957-6962.
Dixon, R A, Harrison, M J, & Lamb, C J. (1994). Early events in the activation of plant defence responses. Annual Review of Phytopathology, 32, 479-501.
Dowell, J M Mc, & Woffenden, B J. (2003). Plant disease resistance genes: recent insights and potential applications. Trends in biotechnology, 21, 178-183.
Enoch, Kikulwe M, Justus, Wesseler, & Jose, Falck-Zepeda. (2011). Attitudes, perceptions, and trust. Insights from a consumer survey regarding genetically modified banana in Uganda. Appetite 57, 401-413.
Forsyth, L M, Smith, L J, & Aitken, E A B. (2006). Identification and characterization of non-pathogenic Fusarium oxysporum capable of increasing and decreasing Fusarium wilt severity. Mycological Research, 110, 929-935.
Fuchs, Y, & Steller, H. (2011). Programmed cell death in animal development and disease. Cell 147(4), 742-758.
Ganapathi, R, Higgs, N S, Balin-Kurti, P J, Arntzen, C J, May, G D, & Van, J M. (2001). Agrobacterium-mediated transformation of embryogenic cell suspensions of the banana cultivar Rasthali ( AAB ). Plant Cell Reports 20, 157-162.
Ghag, B Siddhesh, Shekhawat, K Upendra Singh, & Ganapathi, R Thumballi. (2012). Petunia Floral Defensins with Unique Prodomains as Novel Candidates for Development of Fusarium Wilt Resistance in Transgenic Banana Plants. PloS one 7(6), e39557.
Girhepuje, P V, & Shinde, G B. (2011). Transgenic tomato plants expressing a wheat endochitinase gene demonstrate enhanced resistance to Fusarium oxysporum f. sp. lycopersici. Plant Cell, Tissue and Organ Culture 105(2), 243-251.
Greenberg, J T, & Yao, N. (2004). The role and regulation of programmed cell death in plant-pathogen interactions. Cell Microbiology, 6(3), 201-211. doi: 361
61
Groenewald, S, Berg, N van den, Marasas, W F O, & Viljoen, A. (2006). Biological, physiological and pathogenic variation in a genetically homogenous population of Fusarium oxysporum f.sp. cubense. Australasian Plant Pathology, 35, 401-409.
Grover, A, & Gowthaman, R. (2003). Strategies for development of fungus- resistant transgenic plants. Current Science, 84, 330-340.
Gunawardena, A H, Sault, K, Donnelly, P, Greenwood, J S, & Dengler, N G. (2005). Programmed cell death and leaf morphogenesis in Monstera oblique (Araceae). Planta, 601-618.
Hara-Nishimura, I, & Hatsugai, N. (2011). The role of vacuole in plant cell death. Cell Death and Differentiation, 18, 1298-1304.
Hardly, W E Mac, & Beckman, C H. (1981). Vacular wilt Fusarium infection and pathogenesis: Pennsylvania state University Press. Pennsylvania.
Hatsugai, N, Kuroyanagi, M, Yamada, K, Meshi, T, suda, S, & Kondo, M. (2004). A plant vacuolar protease, VPE, mediates virus-induced hypersentive cell death Science, 305, 855-858.
Hengartner, M O, & Horvitz, H R. (1994). Activation of C. elegans cell death protein CED-9 by an amino-acid substitution in a domain conserved in Bcl-2. Nature, 369, 318-320.
Herbert, J A, & Marx, D. (1990). Short-term control of panama disease of banana in South Africa. Phytophylactica, 22, 339-340.
Hwang, S C, & Ko, W H. (2004). Cavendish banana cultivars resistant to Fusarium wilt acquired through somaclonal variation in Taiwan. Plant Diseases, 88, 580-588.
IDEA. (2001). ADC commercialisation bulletin No. 8. IDEA/Apple banana. .
IPGRI. (1998). Banana Research Network for East and Southern Africa (BARNESA) Strengthening banana research in Eastern Africa: 5 year plan 1998-2003: Plant International Plant Genetic Resources Institute.
Jeger, M J, Eden, S Green, Tresh, J M, Johanson, A, Waller, J M, & Brown, A E. (1995). Banana Diseases: In Banana and Plantains (Ed. S Gowen): Chapman and Hall London.
Jones, D R. (2000). Introduction to banana abacá, and enset in diseases of banana. Wallingford Oxon UK New York: CABI Publishing.
Juqiang, Yan, Cixin, He, & Hong, Zhang. (2003). The BAG-family proteins in Arabidopsis thaliana. Plant Science 165, 1-7.
Kabbage, M, & Dickman, M B. (2008). The BAG proteins: a ubiquitous family of chaperone regulators. Cellular and Molecular Life Sciences, 65 1390-1402.
62
Kangire, A, Karamura, E B, Gold, C, & Rutherford, M A. (2000). Fusarium Wilt of Banana in Uganda, with special emphasis on wilt-like symptoms observed on East African highland cooking cultivars (MUSA SPP.AAA). Acta Horticultural, 540-443.
Kangire, A, Rutherford, M A, & Gold, C S. (1999). Distribution of fusarium wilt and the populations of fusarium oxysporum f.sp. cubense on bananas in Uganda. Paper presented at the Banana fusarium wilt management: Towards sustainable cultivation, Genting Highlands Resort, Malaysia.
Kangire, A, Rutherford, M A, & Gold, C S. (2001). Distribution of Fusarium wilt and the population of Fusarium oxysporum f.sp. cubense on bananas in Uganda. Banana Fusarium Wilt Management: Towards Sustainable Cultivation. Proceedings of International Workshop on the Banana Fusarium Wilt Disease, 152-161.
Kangire, A, Tushemereirwe, W K, & Nowankunda, K. (1999). Reaction of local and exotic bananas to Fusarium in Uganda and yeild of IMTP cultivars under feild conditions. Paper presented at the Banana Fusarium management: Towards sustainable cultivation. , Genting Highlands Resort, Malaysia.
Khanna, Harjeet, Doug, Becker, Jennifer, Kleidon, & James, Dale. (2004). Centrifugation Assisted Agrobacterium tumefaciens-mediated Transformation ( CAAT ) of embryogenic cell suspensions of banana ( Musa spp . Cavendish AAA and Lady finger AAB ). Development, 239-252.
Khurana, S M P, Pandey, S K, Sarkar, D, & Chanemougasoundharam, A. (2005). Apoptosis in plant disease response: A close encounter of the pathogen kind. Current Science, 88, 5-10.
Kuroyanagi, K, Yamada, K, Hatsugai, N, & Hara, I Nishimura. (2005). VPE is essential for mycotoxin-induced cell death in Arabidopsis thaliana. J. Biol. Chem, 280, 32914-32920.
Leena, Tripathi, Henry, Mwaka, Jaindra, Nath Tripathi, & Wilberforce, Tushemereirwe Kateera. (2010). Expression of sweet pepper Hrap gene in banana enhances resistance to Xanthomonas Campestris pv. musacearum. Molecular Plant Pathology, 11(6), 721-131.
Luca, Federicia, Adele, Di Matteob, Juan, Fernandez-Recioc, Demetrius, Tsernogloub, & Felice, Cervone. (2006). Polygalacturonase inhibiting proteins: players in plant innate immunity. Trends in Plant Science 11(2), 65-70.
Mahdavi, F, Sariah, M, & Maziah, M. (2012). Expression of Rice Thaumatin-Like Protein Gene in transgenic banana plants enhances resistance to Fusarium Wilt. Applied Biochemisty and Biotechnology, 166, 1008-1019.
Marenkova, T V, Loginova, D B, & Deineko, E V. (2012). Mosaic Patterns of Transgene Expression in Plants. Russian Journal of Genetics 48(3), 293–306.
Marriott, J, & Lancastern, P A. (1983). Bananas and Plantains Handbook of Tropical Foods. New York USA: Marcel Dekker.
63
Matos, A P De, Cordeiro, Z J M, Trindade, A V, & Ferreira, D M N. (1999). Research on Fusarium wilt of banana in Brazil. Achievements and current status. In Banana Fusarium wilt management: Towards sustainable cultivation Proceedings of the International workshop of banana Fusarium wilt disease. Genting Highlands resort, Malaysia.
Mei, Kuen Yip, Sin, Wan Lee, Kuei, Ching Su, Yi-Hsien, Lin, Chen, Tai Yang, & Teng, Yung Feng. (2011 ). An easy and efficient protocol in the production of pflp transgenic banana against Fusarium wilt. Plant Biotechnology Reports, 5, 245-254.
Mitsuhara, I, Malik, K A, Miura, M, & Ohashi, Y. (1999). Animal cell-death suppressors Bcl-x(L) and Ced-9 inhibit cell death in tobacco plants. Current Biology, 9(14), 775-778. doi: S0960-9822(99)80341-8 [pii]
Mohamed, A A, Mak, C, Liew, K W, & Ho, Y W. (1999). Early evaluation of banana plants at nursery stage for Fusarium wilt. In Banana Fusarium wilt management: Towards sustainable cultivation. In A B Molina, N H Nik Masdek & K W Liew (Eds.), Proceedings of the International workshop on banana Fusarium wilt disease. Genting Highlands Resort Malaysia.
Moore, N Y, Bentley, S, Pegg, K G, & D R Jones. (1995). Fusarium wilt of banana. Musa disease fact sheet International network for the improvement of banana and plantain (Vol. 5, pp. 4). Montpellier France.
Mutlu, N, Boyaci, F H, Gocmen, M, & Abak, K. (2008). Development of SRAP, SRAP-RGA, RAPD and SCAR markers linked with a Fusarium wilt resistance gene in egg plant. Theoretical and Applied Genetics, 117(8), 1303-1312. doi: 10.1007/s00122-008-0864-6
Namanya, Priver, Magambo, S M, Mutumba, G, & Tushemereirwe, W. (2004). Somatic embryogenesis from immature male inflorescences of East African Highland Banana CV "Nakyetengu". African crop science journal, 12(1), 43-49.
Namukwaya, B, J, L Tripathi, Tripathi, J N, Arinaitwe, G, Mukasa, S B, & Tushemereirwe, W K. (2012). Transgenic banana expressing Pflp gene confers enhanced resistance to Xanthomonas wilt disease. Transgenic Research 21, 855-865.
Nasir, N, Pittaway, P A, pegg, K G, & Lisle, A T. (2003). A foliar rating system for comparing the resistance of banana cultivars grown as tissue-cultured plantlets in the laboratory to Fusarium wilt. Australasian Plant Pathology, 32, 521-526.
Nishawar, J, Mahboob, H, & Khurshid, I A. (2008). Programmed cell death or apoptosis: do animals and plants share anything in common. Biotechnology and Molecular Biology Reviews, 3(5), 111-126.
Paparu, P, Dubois, T, Coyne, D, & Viljoen, A. (2009). Dual inoculation of Fusarium oxysporum endophytes in banana: effect on plant colonization, growth and control of the root burrowing nematode and the banana weevil. Biocontrol Science and Technology, 19, 639-655.
64
Paul, Jean-Yves, Becker, K Douglas, Dickman, B Martin, Harding, M Robert, Khanna, K Harjeet, & Dale, L James. (2011 ). Apoptosis-related genes confer resistance to Fusarium wilt in transgenic ‘Lady Finger’ bananas. Plant Biotechnology Journal, 9, 1141-1148.
Pei, Xin-Wu, Chen, Shi-Kai, Wen, Rui-Ming, Ye, Shang, Huang, Jia-Qin, Zhang, Yong-Qiang, . . . Jia, Shi-Rong. (2005). Creation of Transgenic Bananas Expressing Human Lysozyme Gene for Panama Wilt Resistance. Journal of Integrative Plant Biology, 47, 971-977.
Pennell, R I, & Lambet, C. (1997). Programmed cell death in plants. Plant cells, 9, 1157-1168.
Ping, Xu, Rogers, Stephanie J, & Roossinck, Marilyn J. (2004). Expression of anti-apoptotic genes bcl-xL and ced-9 in tomato enhances tolerance to viral-induced necrosis and abiotic stress. Plant Biology Division, the Samuel Roberts Noble Foundation, Ardmore, OK 73401. (pp. 15805-15810): Communicated by George Bruening. University of California Davis CA.
Ploetz, R C. (1994). Panama disease: return of the first banana menace. International Journal of Pest Management, 40, 326-336.
Ploetz, R C. (2009). Fusarium wilt: the banana disease that refuses to go away Proceedings of International ISHS/ProMusa Banana Symposium (pp. 1-8). Guangzhou, China.
Ploetz, R C, & Pegg, K.G. (2000). Fusarium wilt in Jones, D.R, (ed.) CABI Wallingford UK.
Pradeep, Joshi, & David, M Eisenmann. (2004). The Caenorhabditis elegans pvl-5 Gene protects Hypodermal cells from ced-3-Dependent, ced-4-independent cell death. Genetics 167, 673-685.
Punja, Z K. (2001). Genetic engineering of plants to enhance resistance to fungal pathogens - a review of progress and future prospects. Canadian Journal Plant Pathology, 23, 216-235.
Qiagen. (2010). Qiagen RNeasy kit mini Handbook. 51-57.
Reape, TJ, & McCabe, PF. (2008). Apoptotic-like programmed cell death in plants. New Phytologist, 180(1), 13-26.
Robinson, J C. (1996). Bananas and Plantains. Wallingford UK: CAB International.
Robinson, K S, Clements, A, Williams, A C, Berger, C N, & Frankel, G. (2011). Bax inhibitor 1 in apoptosis and disease. Oncogene, 30, 2391-2400.
Rommens, Caius M, & Kishore, Ganesh M. (2000). Exploiting the full potential of disease- resistance genes for agricultural use. Current opinion in Biotechnology, 11, 120-125.
Sági, L, Remy, S, & Swennen, R. (1997). Laboratory of Tropical Crop Improvement, : KUL.
Sambrook, J, & Russell, D W (Eds.). (2001). Molecular Cloning: A Laboratory Manual. (3rd ed.). New York,: Cold Spring Harbor Laboratory Press.
65
Sharma, K D, P, P Winter, Kahl, G, & Muehlbauer, F J. (2004). Molecular mapping of Fusarium oxysporum f. sp. ciceris race 3 resistance gene in chickpea. Theoretical Applied Genetics, 108, 1243-1248.
Sharrock, S, & Frison, E. (1999). Musa production around the world trends, varieties and regional importance (pp. 42-47). Montpelleier France: INIBAP.
Shlezinger, N, Minz, A, Gur, Y, Hatam, I, Dagdas, Y F, Talbot, N J, & Sharon, A. (2011). Anti-apoptotic machinery protects the necrotrophic fungus Botrytis cinerea from host-induced apoptotic-like cell death during plant infection. . PLoS Pathogens 7(8), e1002185.
Simmonds, N W (Ed.). (1962). The evolution of the bananas. (Vol. 170): Longmans.
Simmonds, N W (Ed.). (1966). Bananas. London UK and New York USA: Longman.
Simons, G, Groenendijk, J, Wijbrandi, J, Reijans, M, Groenen, J, Diergaarde, P, . . . Vos, P. (1998). Dissection of the Fusarium I2 gene cluster in tomato reveals six homologs and one active gene copy. Plant Cell, 10, 1055-1068.
Smith, L J, Smith, M K, Tree, D, OKeefe, D, & Galea, V J. (2008). Development of a small-plant bioassay to assess banana grown from tissue culture for consistent infection by Fusarium oxysporum f.sp. cubense. Australasian Plant Pathology, 2(37), 171-179.
Smith, M, Whiley, A, Searle, C, Langdon, P, Schaffer, B, & Pegg, K. (1998). Mico propropagated bananas are more susceptible to Fusarium wilt than plants grown from conventional material. Australian Journal of Agricultural Research, 49, 1133-1139.
Southern, E M. (1975). Detection of specific sequences among DNA fragments Separated by gel electrophoresis. Journal of Molecular Biolology, 98, 503 - 517.
Sreeramanan, Subramaniam, Maziah, M., Sariah, M., Puad, M.P., & Xavier, R. (2006). Bioassay method for testing Fusarium wilt disease tolerance in transgenic banana. Scientia Horticulturae 108, 378-389.
Stover, H, & Simmonds, N W. (1987). Bananas (Third edition ed.). UK: Longmans.
Stover, R H. (1962). Fusarium Wilt (Panama Disease) of Bananas and Other Musa Species: Kew Surrey Commonwealth Mycological Institute.
Talengera, David, Beemster, Gerrit T. S, Tushemereirwe, Wilberforce K, & Kunert, Karl. (2012). Isolation and characterisation of a banana CycD2;1 gene and its over-expression enhances root growth. African Journal of Biotechnology 11(45), 10328-10339.
Thangavelu, R, & Mustaffa, M M. (2012). Current Advances in the Fusarium Wilt Disease Management in Banana with Emphasis on Biological Control. Plant Pathology, 273-298.
Theresa, Reape J, & Paul, McCabe F. (2010). Apoptotic-like regulation of programmed cell death in plants. Apoptosis, 15, 249-256.
66
Ting, A S Y, Maha, S W, & Tee, C S. (2012). Evaluating the feasibility of induced host resistance by endophytic isolate Penicillium citrinum BTF08 as a control mechanism for Fusarium wilt in banana plantlets. Biological Control, 61, 155-159.
Trobacher, P Christopher. (2009). Ethylene and programmed cell death in plants. Botany 87, 757–769.
Tushemereirwe, W K, Kangire, A, Kubiriba, J, Nakyanzi, M, & Gold, C S. (2004). Diseases threatening banana biodiversity in Uganda. African Crop Scientific Journal, 19-26.
Tushemereirwe, W K, Karamura, D A, Sali, H, Bwamiki, D, Kashaija, I, Nankinga, C, . . . Sebuliba, R (Eds.). (2001). Bananas (Musa spp.) In Agriculture in Uganda (Vol. 11): The Netherlands Fountain Publishers.
Van, Den Berg, Berger, D K, I Hein, Birch, P R, Wingfield, M J, & Viljoen, A. (2007). Tolerance in banana to Fusarium wilt is associated with early up- regulation of cell wall strengthening genes in the roots. Molecular Plant Pathology, 8(3), 333-341.
Van, Doorn W G, & Woltering, E J. (2005). Many ways to exit? Cell death categories in plants. Trends in Plant Science, 10, 117-122.
Vibha, Srivastava, Olin, D Anderson, & David, W Ow. (1999). Single-copy transgenic wheat generated through the resolution of complex integration patterns. Proceedings of the National Academy of Sciences, 96, 1117-11121.
Vuylsteke, D, Swennen, R, & Ortiz, R. (1993). Development and early evaluation of Black Sigatoka- resistant tetraploid hybrids of plantain (Musa spp. AAB Group). Euphytica, 65, 33-42.
Waite, B H. (1977). Inoculation studies and natural infection of banana varieties with race 1 and 2 of Fusarium oxysporum f.sp. cubense. Plant disease Reporter, 61, 15-19.
Wang, W, Hu, Y, Sun, D, Staehelin, C, Xin, D, & Xie, J. (2012). Identification and evaluation of two diagnostic markers linked to Fusarium wilt resistance (race 4) in banana (Musa spp.). Molecular Biology Reports, 39(1), 451-459. doi: 10.1007/s11033-011-0758-6
Wei-ming, Li, Chun-mei, Qian, Yi-Wei, Mo, Yu-lin, Hu, & Jiang-Hui, Xie. (2011). Tolerance of banana for Fusarium wilt is associated with early H 2 O 2 accumulation in the roots. Journal of Biotechnology 10, 55, 11378-11387.
Williams, B, Kabbage, M, Britt, R, & Dickman, M B. (2010). AtBAG7, an Arabidopsis Bcl-2-associated athanogene, resides in the endoplasmic reticulum and is involved in the unfolded protein response. Proceedings of National Academy of Sciences U S A 107(13), 6088-6093.
Wu, Y L, Yi, G J, & peng, X. (2010). Rapid screening of Musa species for resistance to Fusarium wilt in an in vitro bioassay. European J plant pathology, 128, 409-415.
67
Xiaojie, Wang, Chunlei, Tang, Jongchang, Zhang, Jin-Rong, Xu, Bo, Liu, Jie, LV, . . . Zhensheng, Kang. (2011). TaDAD2, a negative regulator of programmed cell death, Is Important for the Interaction between wheat and the stripe rust fungus. Molecular Plant-Microbe Interactions, 24 (1), 79-90.
Xiaoli, Jin, Dongru, Feng, Hongbin, Wang, & Jinfa, Wang. (2007). A novel tissue-specific plantain β-1,3-glucanase gene that is regulated in response to infection by Fusarium oxysporum f.sp. cubense. Biotechnology Letters, 29, 1431-1437.
Zasloff, M. (2002). Antimicrobial peptides of multicellular organisms. Nature, 415, 389-395.