gene technology chapter 8. overview dna cloning restriction enzymes gel electrophoresis and...
TRANSCRIPT
![Page 1: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/1.jpg)
GENE TECHNOLOGY
Chapter 8
![Page 2: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/2.jpg)
Overview
DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal Cloning Applications of Gene Technology
Medical Environmental Agricultural
Ethical Issues
![Page 3: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/3.jpg)
Overview: The DNA Toolbox
Sequencing of the human genome was completed by 2007
DNA sequencing has depended on advances in technology, starting with making recombinant DNA
In recombinant DNA, nucleotide sequences from two different sources, often two species, are combined in vitro into the same DNA molecule
![Page 4: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/4.jpg)
Methods for making recombinant DNA are central to genetic engineering, the direct manipulation of genes for practical purposes
DNA technology has revolutionized biotechnology, the manipulation of organisms or their genetic components to make useful products
An example of DNA technology is the microarray, a measurement of gene expression of thousands of different genes
![Page 5: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/5.jpg)
Fig. 20-1
![Page 6: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/6.jpg)
DNA cloning yields multiple copies of a gene or other DNA segment To work directly with specific genes, scientists
prepare gene-sized pieces of DNA in identical copies, a process called DNA cloning
![Page 7: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/7.jpg)
DNA Cloning and Its Applications: A Preview
Most methods for cloning pieces of DNA in the laboratory share general features, such as the use of bacteria and their plasmids
Plasmids are small circular extra-chromosomal DNA molecules that replicate separately (autonomously) from the bacterial chromosome
Cloned genes are useful for making copies of a particular gene and producing a protein product
![Page 8: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/8.jpg)
Gene cloning involves using bacteria to make multiple copies of a gene
Foreign DNA is inserted into a plasmid, and the recombinant plasmid is inserted into a bacterial cell
Reproduction in the bacterial cell results in cloning of the plasmid including the foreign DNA
This results in the production of multiple copies of a single gene
![Page 9: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/9.jpg)
Fig. 20-2a
DNA of chromosome
Cell containing geneof interest
Gene inserted intoplasmid
Plasmid put intobacterial cell
RecombinantDNA (plasmid)
Recombinantbacterium
Bacterialchromosome
Bacterium
Gene ofinterest
Plasmid
2
1
2
![Page 10: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/10.jpg)
Fig. 20-2b
Host cell grown in cultureto form a clone of cellscontaining the “cloned”gene of interest
Gene ofInterest
Protein expressedby gene of interest
Basic research andvarious applications
Copies of gene Protein harvested
Basicresearchon gene
Basicresearchon protein
4
Recombinantbacterium
Gene for pest resistance inserted into plants
Gene used to alter bacteria for cleaning up toxic waste
Protein dissolvesblood clots in heartattack therapy
Human growth hor-mone treats stuntedgrowth
3
![Page 11: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/11.jpg)
Fig. 20-2
DNA of chromosome
Cell containing geneof interest
Gene inserted intoplasmid
Plasmid put intobacterial cell
RecombinantDNA (plasmid)
Recombinantbacterium
Bacterialchromosome
Bacterium
Gene ofinterest
Host cell grown in cultureto form a clone of cellscontaining the “cloned”gene of interest
Plasmid
Gene ofInterest
Protein expressedby gene of interest
Basic research andvarious applications
Copies of gene Protein harvested
Basicresearchon gene
Basicresearchon protein
Gene for pest resistance inserted into plants
Gene used to alter bacteria for cleaning up toxic waste
Protein dissolvesblood clots in heartattack therapy
Human growth hor-mone treats stuntedgrowth
2
4
1
3
![Page 12: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/12.jpg)
Using Restriction Enzymes to Make Recombinant DNA Bacterial restriction enzymes cut DNA
molecules at specific DNA sequences called restriction sites
A restriction enzyme usually makes many cuts, yielding restriction fragments
The most useful restriction enzymes cut DNA in a staggered way, producing fragments with “sticky ends” that bond with complementary sticky ends of other fragments
DNA ligase is an enzyme that seals the bonds between restriction fragments
![Page 13: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/13.jpg)
Fig. 20-3-1Restriction site
DNA
Sticky end
Restriction enzymecuts sugar-phosphatebackbones.
53
35
1
![Page 14: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/14.jpg)
Fig. 20-3-2Restriction site
DNA
Sticky end
Restriction enzymecuts sugar-phosphatebackbones.
53
35
1
DNA fragment addedfrom another moleculecut by same enzyme.Base pairing occurs.
2
One possible combination
![Page 15: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/15.jpg)
Fig. 20-3-3Restriction site
DNA
Sticky end
Restriction enzymecuts sugar-phosphatebackbones.
53
35
1
One possible combination
Recombinant DNA molecule
DNA ligaseseals strands.
3
DNA fragment addedfrom another moleculecut by same enzyme.Base pairing occurs.
2
![Page 16: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/16.jpg)
Fig. 20-UN5
![Page 17: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/17.jpg)
Fig. 20-UN6
![Page 18: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/18.jpg)
Animation
Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at http://get.adobe.com/flashplayer.
![Page 19: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/19.jpg)
Cloning a Eukaryotic Gene in a Bacterial Plasmid
In gene cloning, the original plasmid is called a cloning vector
A cloning vector is a DNA molecule that can carry foreign DNA into a host cell and replicate there
![Page 20: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/20.jpg)
Producing Clones of Cells Carrying Recombinant Plasmids
Several steps are required to clone the hummingbird β-globin gene in a bacterial plasmid
![Page 21: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/21.jpg)
Fig. 20-4-1
Bacterial cell
Bacterial plasmid
lacZ gene
Hummingbird cell
Gene of interest
Hummingbird DNA fragments
Restrictionsite
Stickyends
ampR gene
TECHNIQUE
![Page 22: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/22.jpg)
Fig. 20-4-2
Bacterial cell
Bacterial plasmid
lacZ gene
Hummingbird cell
Gene of interest
Hummingbird DNA fragments
Restrictionsite
Stickyends
ampR gene
TECHNIQUE
Recombinant plasmids
Nonrecombinant plasmid
![Page 23: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/23.jpg)
Fig. 20-4-3
Bacterial cell
Bacterial plasmid
lacZ gene
Hummingbird cell
Gene of interest
Hummingbird DNA fragments
Restrictionsite
Stickyends
ampR gene
TECHNIQUE
Recombinant plasmids
Nonrecombinant plasmid
Bacteria carryingplasmids
![Page 24: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/24.jpg)
Fig. 20-4-4
Bacterial cell
Bacterial plasmid
lacZ gene
Hummingbird cell
Gene of interest
Hummingbird DNA fragments
Restrictionsite
Stickyends
ampR gene
TECHNIQUE
Recombinant plasmids
Nonrecombinant plasmid
Bacteria carryingplasmids
RESULTS
Colony carrying non-recombinant plasmidwith intact lacZ gene
One of manybacterialclones
Colony carrying recombinant plasmid with disrupted lacZ gene
![Page 25: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/25.jpg)
Fig. 20-UN4
G
Aardvark DNA
Plasmid
53
3TCCATGAATTCTAAAGCGCTTATGAATTCACGGC5AGGTACTTAAGATTTCGCGAATACTTAAGTGCCG
ACTT
AAAG
T TC
![Page 26: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/26.jpg)
Fig. 20-UN7
![Page 27: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/27.jpg)
1. The hummingbird genomic DNA and a bacterial plasmid are isolated
2. Both are digested with the same restriction enzyme
3. The fragments are mixed, and DNA ligase is added to bond the fragment sticky ends
4. Some recombinant plasmids now contain hummingbird DNA
5. The DNA mixture is added to bacteria that have been genetically engineered to accept it
6. The bacteria are plated on a type of agar that selects for the bacteria with recombinant plasmids
7. This results in the cloning of many hummingbird DNA fragments, including the β-globin gene
![Page 28: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/28.jpg)
Animation
Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at http://get.adobe.com/flashplayer.
![Page 29: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/29.jpg)
Animation
Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at http://get.adobe.com/flashplayer.
![Page 30: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/30.jpg)
Storing Cloned Genes in DNA Libraries
A genomic library that is made using bacteria is the collection of recombinant vector clones produced by cloning DNA fragments from an entire genome
A genomic library that is made using bacteriophages is stored as a collection of phage clones
![Page 31: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/31.jpg)
Fig. 20-5a
Bacterial clones
Recombinantplasmids
Recombinantphage DNA
or
Foreign genomecut up withrestrictionenzyme
(a) Plasmid library (b) Phage library
Phageclones
![Page 32: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/32.jpg)
A bacterial artificial chromosome (BAC) is a large plasmid that has been trimmed down and can carry a large DNA insert
BACs are another type of vector used in DNA library construction
![Page 33: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/33.jpg)
Fig. 20-5b
(c) A library of bacterial artificial chromosome (BAC) clones
Large plasmidLarge insertwith many genes
BACclone
![Page 34: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/34.jpg)
A complementary DNA (cDNA) library is made by cloning DNA made in vitro by reverse transcription of all the mRNA produced by a particular cell
A cDNA library represents only part of the genome—only the subset of genes transcribed into mRNA in the original cells
![Page 35: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/35.jpg)
Fig. 20-5
Bacterial clones
Recombinantplasmids
Recombinantphage DNA
or
Foreign genomecut up withrestrictionenzyme
(a) Plasmid library (b) Phage library (c) A library of bacterial artificial chromosome (BAC) clones
Phageclones
Large plasmidLarge insertwith many genes
BACclone
![Page 36: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/36.jpg)
Fig. 20-6-1
DNA innucleus
mRNAs in cytoplasm
![Page 37: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/37.jpg)
Fig. 20-6-2
DNA innucleus
mRNAs in cytoplasm
ReversetranscriptasePoly-A tail
DNAstrand
Primer
mRNA
![Page 38: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/38.jpg)
Fig. 20-6-3
DNA innucleus
mRNAs in cytoplasm
ReversetranscriptasePoly-A tail
DNAstrand
Primer
mRNA
DegradedmRNA
![Page 39: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/39.jpg)
Fig. 20-6-4
DNA innucleus
mRNAs in cytoplasm
ReversetranscriptasePoly-A tail
DNAstrand
Primer
mRNA
DegradedmRNA
DNA polymerase
![Page 40: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/40.jpg)
Fig. 20-6-5
DNA innucleus
mRNAs in cytoplasm
ReversetranscriptasePoly-A tail
DNAstrand
Primer
mRNA
DegradedmRNA
DNA polymerase
cDNA
![Page 41: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/41.jpg)
Animation
Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at http://get.adobe.com/flashplayer.
![Page 42: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/42.jpg)
Screening a Library for Clones Carrying a Gene of Interest
A clone carrying the gene of interest can be identified with a nucleic acid probe having a sequence complementary to the gene
This process is called nucleic acid hybridization
![Page 43: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/43.jpg)
A probe can be synthesized that is complementary to the gene of interest
For example, if the desired gene is
– Then we would synthesize this probe (Why??)
G5 3… …G GC C CT TTAA A
C3 5C CG G GA AATT T
![Page 44: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/44.jpg)
The DNA probe can be used to screen a large number of clones simultaneously for the gene of interest
Once identified, the clone carrying the gene of interest can be cultured
![Page 45: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/45.jpg)
Fig. 20-7
ProbeDNA
Radioactivelylabeled probe
molecules
Film
Nylon membrane
Multiwell platesholding libraryclones
Location ofDNA with thecomplementarysequence
Gene ofinterest
Single-strandedDNA from cell
Nylonmembrane
TECHNIQUE
•
![Page 46: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/46.jpg)
Expressing Cloned Eukaryotic Genes
After a gene has been cloned, its protein product can be produced in larger amounts for research
Cloned genes can be expressed as protein in either bacterial or eukaryotic cells
![Page 47: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/47.jpg)
Bacterial Expression Systems
Several technical difficulties hinder expression of cloned eukaryotic genes in bacterial host cells
To overcome differences in promoters and other DNA control sequences, scientists usually employ an expression vector, a cloning vector that contains a highly active prokaryotic promoter
![Page 48: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/48.jpg)
Eukaryotic Cloning and Expression Systems
The use of cultured eukaryotic cells as host cells and yeast artificial chromosomes (YACs) as vectors helps avoid gene expression problems
YACs behave normally in mitosis and can carry more DNA than a plasmid
Eukaryotic hosts can provide the post-translational modifications that many proteins require
![Page 49: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/49.jpg)
One method of introducing recombinant DNA into eukaryotic cells is electroporation, applying a brief electrical pulse to create temporary holes in plasma membranes
Alternatively, scientists can inject DNA into cells using microscopically thin needles
Once inside the cell, the DNA is incorporated into the cell’s DNA by natural genetic recombination
![Page 50: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/50.jpg)
Amplifying DNA in Vitro: The Polymerase Chain Reaction (PCR) The polymerase chain reaction, PCR,
can produce many copies of a specific target segment of DNA
A three-step cycle—heating, cooling, and replication—brings about a chain reaction that produces an exponentially growing population of identical DNA molecules
![Page 51: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/51.jpg)
Fig. 20-8a
5
Genomic DNA
TECHNIQUETargetsequence
3
3 5
![Page 52: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/52.jpg)
Fig. 20-8b
Cycle 1yields
2molecules
Denaturation
Annealing
Extension
Primers
Newnucleo-tides
3 5
3
2
5 31
![Page 53: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/53.jpg)
Fig. 20-8c
Cycle 2yields
4molecules
![Page 54: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/54.jpg)
Fig. 20-8d
Cycle 3yields 8
molecules;2 molecules
(in whiteboxes)
match targetsequence
![Page 55: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/55.jpg)
Fig. 20-85
Genomic DNA
TECHNIQUE
Cycle 1yields
2molecules
Denaturation
Annealing
Extension
Cycle 2yields
4molecules
Cycle 3yields 8
molecules;2 molecules
(in whiteboxes)
match targetsequence
Targetsequence
Primers
Newnucleo-tides
3
3
3
3
5
5
51
2
3
![Page 56: GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal](https://reader035.vdocuments.site/reader035/viewer/2022062801/56649e395503460f94b2ade5/html5/thumbnails/56.jpg)
Animation
Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at http://get.adobe.com/flashplayer.