Abstract

B. ostreae is a haplosporidian parasite that primarily infects the haemocytes of the European flat oyster, O. edulis. This parasite, along with M. refringens, has caused devastating mortalities in oyster populations in Europe and has led to a serious decline in oyster production. Production of O. edulis in Europe is now 10% of what it used to be. Sensitive diagnostic techniques such as PCR assays, in situ hybridisation and monoclonal antibody immunoassays have been developed to help prevent the spread of the parasite and management practices such as reduced stocking density have been put in place to try to control progression of the disease. Acquired resistance to the parasite has also been demonstrated in oyster strains in France and Ireland, which could play an important role in managing the disease in the future. Previous work has suggested that temperature and salinity has an effect on parasite prevalence due to impacts on the parasite and/or host defence mechanisms. The current study aimed to assess the impact of temperature and salinity on parasite prevalence and infection intensity, by exposing O. edulis individuals to various temperature-salinity combinations, and obtaining parasite prevalence estimates and infection intensities using primary PCR, nested PCR and histological staining techniques. The study found that infection intensity rose by 43% in oysters kept at 20°C compared with oysters kept at 12°C (P<0.05). A 69% decrease in infection intensity was observed in oysters kept at 28‰ salinity compared with individuals kept at 34‰ (P<0.05). This has important implications in management practices as oysters could be cultured at lower salinities in an attempt to reduce the impact of the parasite, as has been done in the past with H. nelsoni Additionally, this data supports the seasonal peaks in prevalence and could be related to life cycle work carried out on Bonamia spp. in T. chilensis. The study found the

1

An investigation into the effect of temperature and salinity on the infection intensity of Bonamia ostreae in Ostrea edulis in an attempt to improve disease

management practices in light of present climate change issues

24288543

Sam Kirby

MSci Advanced Independent Research Project

May 2015

Word count: 9817

primary PCR reaction to be unreliable and, if used, should be used in conjunction with a second nested PCR reaction. However, plenty of other diagnostic techniques are available and molecular techniques could play an important role in uncovering the life cycle of B. ostreae and the mechanisms for resistance in O. edulis in the future.

Table of contents

Acknowledgements 5

1. Introduction 6

1.1 Ostrea edulis 6

1.2 Bonamia ostreae 7

1.2.1 Bonamiasis and parasite distribution 7

1.2.2 Pathology of Bonamia ostreae 9

1.2.3 The appearance of Bonamia ostreae and the decline of the European flat oyster industry 10

1.3 Diagnostic techniques and disease management 11

1.3.1 Development of diagnostic techniques 11

1.3.2 Disease management: E.U. and OIE controls 12

1.4 The effect of temperature and salinity on parasite prevalence and infection intensity 13

1.4.1 The effect of temperature and salinity on Bonamia ostreae and Ostrea edulis 13

1.4.2 Project aims 13

2. Materials and methods 14

2

2.1 Sampling, husbandry and dissection 14

2.2 Histological analysis 15

2.3 PCR analysis 16

2.4 Statistical analysis 17

3. Results 18

3.1 Data visualisation 18

3.1.1 Boxplots 18

3.1.2 Q-Q plots and normality 19

3.2 Wet weight and infection intensity 20

3.2.1 Data visualisation 20

3.2.2 Effect of wet weight on mean infection intensity 20

3.3 Infection intensity from histological analysis 21

3.3.1 Tank infection intensities 21

3.3.2 Treatment group infection intensities 21

3.3.3 Effect of temperature and salinity on mean infection intensity 22

3.3.4 Site comparison 22

3.4 Detection methods and prevalence 23

3.4.1 PCR results 23

3.4.2 Detection methods and success 23

3.4.3 Comparison of detection success of each method between groups 24

4. Discussion 25

5. Conclusions and future work 29

References 30

3

Acknowledgements

Firstly, I would like to thank both my project supervisors, Dr. Lawrence Hawkins and Dr. Chris Hauton, for all the time and effort they have put in throughout this project, and all their guidance at each step of the way. I would also like to thank all the aquarium staff at NOCS for all their help and their patience and thank you to all the technical staff for their help with materials and guidance on procedures.

4

1. Introduction

1.1 Ostrea edulis

Ostrea edulis (otherwise known as the European flat oyster) is a bivalve mollusc with an oval, irregular shell (FAO 2004). The shell consists of two valves that are hinged along the mid-dorsal line. The hinge ligament is organised in conjunction with the sculpturing of the dorsal valve margins. The ligament is subjected to compression when the valves are closed

5

Figure 1. Distribution of O. edulis in Europe (Jaziri 1990).

and elastic recoil causes the valves to open upon relaxation of the adductor muscles (Harrison & Kohn 1997). The two valves are different shapes, the left valve concave and the right valve flat. The right valve sits inside the left valve and acts as a lid. Individuals can grow to large sizes (>20 cm) and can live up to 20 years old. O. edulis can be found along the Western European coast from Norway to Morocco and in the Mediterranean basin (figure 1). Populations can also be observed along the eastern coast of the USA from Maine to Rhode Island (FAO 2004).

O. edulis populations can be found inhabiting muddy-sand, muddy-gravel and rock substrata in shallow coastal waters at depths up to 20 m. Populations can also be found in estuaries and can tolerate salinities as low as 23‰. Individuals feed by filtering phytoplankton and other particulate material from the water column (Lapège et al. 2007).

The European flat oyster has an unusual reproductive biology (da Silva 2009). It is a larviparous and protandric species, generally changing gender twice in a single reproductive cycle (Lapège et al. 2007). Individuals first mature as a male before undergoing a regular rhythm of alternating between female and male sexual phases (Sparck 1925; Orton 1927, 1933; Cole 1942). Gametogenesis of both sexes in a single follicle is common due to this changing of sex (Galtsoff 1964; Pascual et al. 1989). Individuals can produce up to 1 million eggs per spawning, which are released into the pallial cavity where they become fertilised by externally released sperm. Embryos are then brooded for 8-10 days before being released as pelagic larvae. This dispersal stage usually lasts 8-10 days before settlement (Lapège et al. 2007).

1.2 Bonamia ostreae

1.2.1. Bonamiasis and parasite distribution

Bonamiasis is the parasitic disease of flat oyster haemocytes (OIE 2009) caused by haplosporidian microcells belonging to the genus Bonamia and infect oysters around the world. Haemocytes play an important role in the molluscan immune system and eliminate foreign particles through phagocytosis (Cheng 1981). There are rarely signs of infection but a yellow or black colouration of the mantle and gill lesions have been observed in heavily infected individuals (Woolmer et al. 2011). The only usual sign of infection is mass mortality but by this time it is too late for mitigation (Cao et al. 2009). Studies have also shown that, once a site is infected, it is almost impossible to eradicate and the disease tends to reappear in populations that are reintroduced to areas after a fallowing period of a number of years (van Banning 1985).

The genus Bonamia is comprised of four species: B. ostreae that infects O. edulis in Europe, USA, Canada and Morocco (Pichot et al. 1980; Bucke et al. 1984; Elston et al. 1986; Montes & Melendez 1987; Friedman et al. 1989; McArdle et al. 1991; Friedman & Perkins 1994; OIE 2005; Marty et al. 2006), O. lurida, O. angasi, T. chilensis and O. puelchana (Argentina) (Culloty & Mulcahy 2007); B. exitiosa which infects Tiostrea chilensis in New Zealand (Hine et al. 2001; Berthe & Hine 2003) and O. angasi in Australia (Corbeil et al. 2006); B. roughleyi that infects Saccostrea glomerata in Southeast Australia (Cochennec-Laureau et al. 2003a) and B. perspora that infects O. lurida on the east coast of the USA (Carnegie et al. 2006).

6

B. ostreae is an intracellular protistan parasite belonging to the phylum Haplosporidia (Sprague 1979), roughly 2-5 µm in diameter (Arzul et al. 2009), and was initially detected in Brittany, France in 1979 (Comps et al. 1980; Grizel & Tige 1982), Spain & Denmark in 1980 (van Banning 1985; Figueras 1991), Fal and Helford rivers, UK in 1982 (Bannister & Key 1982) and Ireland in 1987 (McArdle et al. 1991). Since then the disease has spread and has most recently been recorded in British Columbia, Canada in 2004 (Marty et al. 2006), Morocco in 2005 and Scotland and Wales in 2006 (Culloty 2007). An ultrastructural study of infected branchial epithelial tissue and haemocytes in individuals from Galicia, Spain found that the parasite can be located intracellularly in both ciliated epithelial cells and in haemocytes (Montes et al. 1994). B. ostreae exhibits a large nucleus containing dispersed chromatin with a prominent nucleolus to one side of the nucleus. The cytoplasm is moderately dense and contains mitochondria and haplosporosomes. In epithelial cells, the parasite was visible as a spherical or ovoid cell contained within a vacuole formed by the host-cell membrane (see figure 3) and structures which may be interpreted as the parasite undergoing mitosis were observed (Montes et al. 1994).

The place that species of Bonamia hold within the phylum Haplosporidia is tenous, however. Pathology and host range formed the initial basis for microcell taxonomy (Farley et al. 1988) but early ultrastructural studies of B. ostreae found dense cytoplasmic structures resembling haplosporosomes (Pichot et al. 1980), features present in the haplosporidia, myxozoa (Perkins 1979) and Paramyxea (Morris et al 2000). The presence of these structures, in an organism that does not display the cell-within-a-cell structure of the Paramyxea, supported the argument for their inclusion into the Haplosporidia (Perkins 1987, 1988), although a spore stage has never been observed in B. ostreae. Additionally, direct transmission is not characteristic of Haplosporidium spp. except, perhaps, in Haplosporidium pickfordi (Barrow 1965). On the other hand, a spore stage has recently been described in a close relative of B. ostreae, B. perspora, suggesting that other species of Bonamia may also produce spores, but perhaps only under certain conditions that have not been observed yet (Carnegie et al. 2006).

Despite 25 years of research, the life cycle of B. ostreae is poorly known. Regardless of the date that naïve oysters are exposed to the parasite, the first known stages of the parasite can be observed 3-5 months after (Tige & Grizel 1984; Montes 1991). The parasite can be detected in oyster spat (Lynch et al. 2005) but mortalities mainly affect oysters that are 2 years old or more (Culloty & Mulcahy 1996) and can be transmitted directly between oysters in a population or experimentally by cohabitation (Elston et al. 1986; Hervio et al. 1995), meaning that it is unlikely that an intermediate host is required to complete the life cycle. Culloty et al. (1999) found that a number of bivalve species (e.g. Mytilus edulis, Mytilus galloprovincialis, Ruditapes philippinarum and Crassostrea gigas) cannot become infected with B. ostreae nor act as a vector. However, some evidence does suggest that the brittle star, Ophiothrix fragilis, may act as an intermediate carrier of the parasite as two naïve oysters in a laboratory cohabitation study showed low levels of infection after cohabitating with the brittle star (Lynch et al. 2007). In an attempt to contribute to our understanding of the life cycle of this parasite, Montes et al. undertook an ultrastructural study of B. ostreae. They observed parasites in the gill epithelium, however it could not be determined whether they were leaving the host as none were observed crossing either the basal or apical membrane. The parasite Haplosporidium nelsoni appear to invade gill epithelia and form plasmodia in extracellular spaces. However, no observation of plasmodial phases of B. ostreae were found although these types of cell can be seen in figure 2.. They also observed phases of rapid proliferation of the parasite, not only in haemocytes but also within the gill epithelium. Based on this evidence they proposed a life cycle for the parasite: 1) adhesion of Bonamia to haemocyte, 2) subsequent phagocytosis, 3) proliferative stage, 4) eventual

7

destruction of haemocyte, 5) release of parasite into extracellular medium, thus reinitiating the cycle through infection of new haemocytes or epithelial cells. In addition to this, an ultrastructural study of Bonamia spp. in T. chilensis (Hine 1991a) was carried out and 5 stages of development were described. Stage 1 consisted of a dense, small cell with haplosporosomes and dense ribosomes. Stage 3 was described as an intermediate, dense form with an irregular cell shape and a golgi detached from the nucleus. Stage 5 appeared to be a plasmodial stage containing multivesicular bodies a large smooth endoplasmic reticulum. Stages 2 and 4 were described as transitional phases. Based on seasonal observations, the following life cycle was proposed: An incubation phase from September to November (spring), a proliferation phase from December to May (summer and autumn) and a plasmodial phase from June to August (winter) (Hine 1991b). This seems to correlate well with the peaks in parasite prevalence and infection intensity seen in B. ostreae populations in late winter and autumn (Grizel 1985; Montes 1990) (i.e. just after the proliferation phase and during the terminal stages when a larger plasmodial form occurs).

1.2.2. Pathology of Bonamia ostreae

As previously mentioned, B. ostreae is a parasite of the haemocytes of O. edulis. This is important because haemocytes, as well as playing an important role in the internal defence mechanism of molluscs, are also involved in wound repair, shell repair, nutrient digestion and transport and excretion (Cochennec-Laureau et al. 2003b).

8

Figure 2. Micrograph showing binucleate (∆) and plasmodial (→) stages of B. ostreae (Culloty & Mulcahy 2007).

Bonamiasis is characterised by branchial ulceration accumulation of haemocytes in connective tissue (Cochennec et al. 1992). The infection is usually associated with intense haemocyte infiltration of the connective tissue of the gills, mantle and digestive gland. Although described as a haemocytic infection, the parasite can also be observed extracellularly between epithelial cells in the gills, stomach and necrotic connective tissues. The observation of free parasites in the gill epithelia supports the theory of the release of the parasite through these organs (Montes et al. 1994). However, most are probably released through tissue lysis upon death of the host organism and the infective form and routes of entry remain unclear (Arzul et al. 2009). Sometimes, cells may appear more electron-dense and this is especially true in heavily infected organisms, which has led scientists to believe that this may be the infective form (Carnegie & Cochennec-Laureau 2004).

Various studies have been undertaken to try to better our understanding of how the parasite affects the haemocytes of oysters (Balouet et al. 1983; Cochennec et al. 1992; Montes et al. 1994; Cochennec 2001; Cochennec et al. 2003b; Comesaña et al. 2012). Cochennec et al. (2003b) found no difference in the total haemocyte count (THC) between infected and naïve individuals. They also found an increase in accumulation of tissue haemocytes that was quantitatively associated with infection intensity. They also found that the balance between granulocytes and agranular cells varied significantly between infected and naïve individuals, with a significantly higher proportion of large agranular cells in infected oysters. A difference in circulating haemocyte ratios was also found between susceptible and resistant strains of O. edulis, suggesting that a lower number of granulocytes in the haemolymph of susceptible oysters may explain the variation in susceptibility between individuals (Cochennec et al. 2003). This relative abundance of different types of haemocyte is termed the differential haemocyte count (DHC) and is known to be influenced by some pathogens already (Allam & Ford 2006; Oubella et al. 1996; Reid et al. 2003).

Phagocytosis is the principal cell defence mechanism of bivalves (Bachère et al. 1995; Cheng 1981; Feng 1988). The phase of bonamiasis occurring within the haemocytes appears to involve a, sometimes profound, alteration of the host cell (Montes et al. 1994). Hervio (1988) provided histological and enzymatic evidence that the parasite occurs within a phagolysosome (see figure 3) and possesses enzymatic machinery that interferes with the host cell cytocidal mechanisms. Once the pathogen is internalised, a respiratory burst may

9

Figure 3. Heart smear of O. edulis. Thick arrow indicates extracellular B. ostreae cells. Thin arrow indicates B. ostreae within oyster

haemocytes (Culloty & Mulcahy 2007).

be triggered, leading to the generation of reactive oxygen species (ROS) with antimicrobial properties (Adema et al. 1991; Babior 1997; Kimura et al. 2005). The superoxide anion (O2

-) is the first to be formed and is subsequently transformed into H2O2 (Comesaña et al. 2012).

The production of these oxygen species has been demonstrated by O. edulis and C. gigas (Bachère et al. 1991; Chagot 1989; Hervio et al. 1989; Nakayama & Maruyama 1998). In addition to this, two reactive nitrogen species (RNS) may be generated by nitric oxide synthase that occurs in mollusc haemocytes, nitric oxide (NO) and peroxinitrite (ONOO-) (Comesaña et al. 2012). Nitric oxide participates in the elimination of pathogens (Chakravortty & Hensel 2003) and production is stimulated by phagocytosis in bivalves and shows cytotoxic properties (Romestand & Torreilles 2002). A few studies have found that the ROS levels in the haemocytes of O. edulis individuals after in vitro phagocytosis of B. ostreae were minimal (Cochennec & Garcia 2000; Hervio 1992; Morga et al. 2009) which may be due to an acid phosphatase activity of the parasite, leading to the block of a respiratory burst (Hervio et al. 1991).

Considering the parasite can be found in the branchial epithelium tissue, it cannot be considered as a strictly haemocytic parasite. However, the only division that occurs in the connective tissue is within haemocytes (Pichot et al. 1980) and the division occurs rapidly (Grizel et al. 1988). However, it has been reported that the parasite does undergo rapid proliferation within epithelial cells (Montes et al. 1994). In digestive gland tissue, the parasite was found in haemocytes located between the digestive tubules and the parasite appears to be contained within a vacuolar membrane. Montes et al. (1994) also observed that the parasite cell was generally more dense in haemocytes than in the epithelium.

1.2.3. The appearance of Bonamia ostreae and the decline of the European oyster industry

Worldwide oyster production was almost 4,604 million tons in 2004 with aquaculture supplying 97% of that (European Commission 2009). China is the main oyster producer (83%). The second highest producer is Republic of Korea (6%), followed by Japan (4%).

Over the last 40 years, the production of O. edulis has seen a dramatic decline producing 6000 tons a year compared to a peak output of nearly 30,000 tons in 1961. This decline has been caused by two parasitic agents Marteilia refringens and B. ostreae (Lallias et al. 2008) (see figure 4). The natural range of O. edulis extends to Norway, Morocco, and into the Mediterranean basin (FAO 2012) but natural beds are rare and are only surviving in a few areas such as the west coast of Ireland (Flannery 2014). In 2002, O. edulis production contributed less than 0.2% of the total global

10

Figure 4. Worldwide production (tonnes) of O. edulis from 1950-2005. Appearance of M. refringens and B. ostreae marked with arrows (Culloty).

of all farmed oyster species, with 67% of production coming from Spain (4,565 tons), 24% in France (1,600 tons) and only the UK and Ireland contributed more than 200 tons (FAO 2012). However, as the supply of oysters decreased, the average price has increased substantially and O. edulis can be 3-5 times more expensive than C. gigas and now occupy a niche market (Lapège et al. 2007). The total value of farmed O. edulis in 2002 was USD 24.3 million and therefore remains an important industry (European Commission 2009). However, due to the on-going problems with O. edulis culture, C. gigas has become the main focus of European oyster production. C. gigas production constitutes 80% of the global oyster production from aquaculture, reaching 728,552 tons in 2007 (FAO 2008).

It is thought that the spread of B. ostreae throughout Europe can mainly be attributed to the transfer of infected oysters to uninfected areas, but it has also been suggested that the use of equipment in infected areas can contribute to the spread of the disease such as in Lake Grevelingen, Netherlands (van Banning 1991). Other mechanisms have also been suggested such as fouling on boat hulls (Howard 1994). The rapid spread of the disease and its devastating effects on oyster production therefore necessitated the development of sensitive detection techniques for effective early diagnosis in an attempt to control the spread of the disease (Lynch et al. 2005).

1.3 Diagnostic techniques and disease management

1.3.1. Development of diagnostic techniques

Traditional methods for the detection of B. ostreae include histological staining procedures for microscopic detection, heart and gill tissue imprints and Transmission Electron Microscopy. However, it is thought that these methods lack necessary sensitivity for detecting low-level infections (Lynch et al. 2005). Tissue imprints were described as having low specificity, but higher sensitivity than histological staining (da Silva & Villalba 2004). However, heart imprints are not considered unreliable for detecting latent infections. Histology considered reliable for moderate-high intensity infections but not for low-level infections (OIE 2012). Additionally, histological techniques can be slow and require a trained observer (Ramilo et al. 2013). Specifically, B. ostreae bears a resemblance to routine intra-haemocytic inclusions which can lead to false positive identification (Carnegie et al. 2000). This has led to the development of numerous diagnostic methods (Cochennec et al. 1992; Carnegie et al. 2000; Cochennec et al. 2000; Carnegie et al. 2003; Carnegie et al. 2004; Corbeil et al. 2006; Marty et al. 2006; Robert et al. 2009).

Due to the lack of suitable tissue culture systems for the culture of the parasite, Mialhe et al. (1988) developed a purification protocol. The development of this protocol and therefore the availability of purified B. ostreae suspensions allowed for quantification of parasite injection allowing more precise experimental infections to be carried out (Hervio et al. 1995) and allowed scientists to investigate in vitro interactions between parasites and haemocytes (Chagot et al. 1992; Mourton et al. 1992).

In 1992, Cochennec et al. developed a monoclonal antibody sandwich immunoassay for the detection of B. ostreae in haemolymph samples and the specificity and sensitivity of this technique were 76.7% and 106%, respectively, compared with histology (Cochennec et al. 1992). However, this kit is no longer available on the market (OIE 2012). However, specific primer pairs (BO & BOAS) were developed later by Cochennec et al. (2000). These primers amplify a 300 base-pair (bp) product and successfully detected B. ostreae infection with in situ hybridisation.

Around the same time, Carnegie et al. (2000) developed another PCR assay for the detection of B. ostreae, involving two primer (CF and CR which amplify a 760 bp product. This

11

PCR assay proved to be more sensitive when compared with cytological analysis (Carnegie et al. 2000).

In addition to these PCR assays, two TaqMan® PCR assays (Corbeil et al. 2006; Marty et al. 2006) and a qPCR assay (Robert et al. 2009) have been developed. The latter is considered extremely sensitive and semi-quantitative (OIE 2012).

These molecular techniques can be faster and more sensitive than traditional approaches, have the benefit of only needing a small tissue sample (Traub et al. 2005) and are more useful for detecting low-level infections. Not only this, they have given insight into the phylogenetic relationships and has become an important tool in parasite systematics (Gasser 2006). These techniques may require lengthy optimisation, however.

1.3.2 Disease management: E.U. controls and OIE

Considering it is almost impossible to eradicate B. ostreae once a site has been infected (van Banning 1985 & 1987), control of the disease relies heavily on prophylactic measures such as restricting the transfer of oysters and strict screening processes. Countries within the EU are required to monitor for a number of notifiable diseases. Legislation dealing with the movement of molluscs include Council Directive 95/70/EC (22 December 1995) introducing minimum Community measures for the control of certain diseases affecting bivalve molluscs. The OIE Aquatic Manual (2009) compares the specificity and sensitivity of some diagnostic tests available and the advantages and disadvantages of these techniques (OIE 2009).

In addition to this, management practice guidelines have been set out by the Centre for Environment, Fisheries and Aquaculture Science (CEFAS) and these include: disposal of unwanted oysters on land, avoiding unnecessarily stressful conditions (such as overstocking) and do not accept undocumented batches of oyster spat Woolmer et al. 2011).

Perhaps the most important area of research with regards to disease management is the development of disease-resistant populations of O. edulis. By the mid-1980’s there was strong evidence to suggest that O. edulis might be capable of developing resistance to B. ostreae (Carnegie et al. 2004). A degree of resistance appears to have developed in a strain of Rossmore oysters in Ireland. The site has been running a selective breeding programme for 16 years. The Rossmore population performed significantly better compared with other populations in terms of prevalence and intensity of infection (Culloty et al. 2004). Resistance to B. ostreae infection is clearly heritable and appears to be mostly additive (Naciri-Graven et al. 1998). A French O. edulis selection programme focused on improving growth as well as improving disease resistance. The economic impact of the pathogen can be reduced by improving survival and obtaining market-size oysters faster (Carnegie et al. 2004).

1.4 The effect of temperature and salinity on parasite prevalence and infection intensity

1.4.1. The effect of temperature and salinity on Bonamia ostreae and Ostrea edulis

Correlations between environmental parameters and development of bonamiasis have been difficult to demonstrate thus far, though previous work has suggested an impact of temperature on the parasite and/or the defence capacity of the host oyster (Arzul et al. 2009).

One study found that B. ostreae prevalence was higher at 10 °C than at 20 °C, suggesting low temperatures may negatively affect the host defense mechanisms or positively affect the ability of the parasite to infect its host (Cochennec & Auffret 2002). Audemard et al. (2008)

12

also found that increased temperature and salinity increased pathogenicity of Bonamia spp. in C. ariakensis.

There have also been studies dedicated to quantifying the physiological response of O. edulis to adverse environmental conditions. In a study by Hutchinson & Hawkins (1992), O. edulis individuals were found to have a reduced Scope for Growth (SFG) at low salinities (regardless of temperature) but showed a differential response to temperature at high salinities. SFG was reduced at low temperatures. Additionally, another study concluded that adverse temperature and salinity conditions can reduce the functionality of O. edulis haemocytes. A Neutral Red Retention (NRR) assay was used to assess haemocyte functionality of individuals that had been exposed to various temperature-salinity combinations and found a reduced retention time at low salinities, potentially due to osmotic imbalance. The retention time showed a peak at 15°C, slowly decreasing towards 25°C at a salinity of 32‰ (Hauton et al. 1998).

1.4.2. Project aims

It is important to understand the effect of temperature and salinity on the development of bonamiasis in O. edulis, especially in light of the global climate issues facing us. Highlighting the relationship between environmental factors and infection may help to better improve our understanding of the parasite biology, especially in relation to life cycle, which may contribute to improving management practices and mitigating oyster losses. Perhaps most importantly, forecasting of disease evolution is necessary in relation to climate change and may help contribute to defining risky and non-risky geographic areas (Arzul et al. 2009).

The aim of this project is to determine whether there is a statistically significant difference in infection intensity and prevalence between individuals subjected to varying temperature-salinity combinations. Additionally, a brief site comparison between oysters obtained from two different sites will be conducted as well as an analysis of the three diagnostic methods employed.

2. Materials and methods

2.1. Sampling, husbandry and dissection

On the 5th of August 2014, 52 O. edulis individuals were taken from Ryde Middle (~50°46’N., 1°14’W.) and transported back to the NOC in Southampton. These individuals were stored in a net bag on the pontoon of the NOC from 8th August 2014, and were shaken daily to remove accumulated sediment and prevent clogging of the gills. These individuals were removed from the pontoon and dissected on 14th August for histology and PCR analysis. All individuals were opened, their gills removed and their hepatopancreas halved. Half of each hepatopancreas was fixed in Bouin’s solution for histological analysis and half was frozen at -20°C to preserve DNA for PCR analysis. Each sample was also earmarked appropriately.

On Monday 9th February 2015, a further 88 O. edulis individuals were obtained from Poole Harbour (~50°41’N., 1°59’W.) for temperature and salinity manipulation under three treatments. These organisms were originally stored in 4 tanks (2a, 2b, 3a and 3b) on a stand-alone system set up by the aquarium staff in a constant temperature room of 12°C. The organisms were kept in full strength seawater and were kept under these conditions for a further 9 days to allow for their acclimation to the aquarium conditions. A sample size of 20 individuals was examined for each treatment group (treatment A: ~28‰ at 12°C; treatment B: 34‰ at 12°C; treatment C: ~34‰ at 20°C). Individuals from treatment groups A and B were kept in a 12°C constant temperature room to control the water temperature and individuals from treatment group C were kept in the main aquarium in a stand-alone system

13

which was heated by a 200W Juwel™ aquarium heater. 28‰ water was prepared by mixing full strength seawater with R.O. water and checked using a temperature/salinity probe. The tank water was filtered using standard mesh filters and a UV filter. Treatment B acted as a control group whilst samples from Ryde Middle were considered as a separate treatment (D).

On 18th February, 20 random oysters were transferred to treatment A (tanks 1a and 1b) and 20 random oysters were transferred to a water bath at 16°C and 33‰ salinity and kept overnight to avoid shocking the organisms by moving them directly to water at 20°C. On 19th February those organisms were transferred to treatment C (tanks 4a, 4b and 4c). The remaining oysters were kept in the original four tanks at the same conditions as they represent the control group (treatment B).

The individuals from Poole Harbour required water changing and feeding whilst being stored in the aquarium and this was carried out every Monday, Wednesday and Friday. The tank conditions were also recorded each day so that any variation between tanks in each treatment group could be elucidated. Individuals were fed Isochrysis spp. and any water required for the water changes was made up the day before and acclimated overnight to the appropriate temperature for each treatment group. The algal concentration was obtained each day by counting individual algal cells under a microscope using a Neubauer 0.0025mm² flow cytometer. The volume of algae was then adjusted each day to deliver a consistent amount (concentration x volume = concentration x volume).

On 11th March all oysters were removed from the aquarium, earmarked appropriately (e.g. sample 2A1 – sample 2 from tank A1) and dissected for histology and PCR analysis. A negligible mortality was observed over the acclimation period with two oysters from tank 2A and one oyster from tank 4A dead. With such a minute mortality rate, a mortality index would have been unnecessary. The dissection procedure for the individuals from Poole Harbour was the same as for the individuals from Ryde Middle but the wet weight of each individual was also recorded before dissection (mean wet weight=11.68g, ±4.61SD, n=85). No control for gender was made during this experiment, resulting in a mixture of males and females being processed. 20 random oysters chosen from each treatment group, with an attempt to take equal samples from each tank, and 20 random individuals from Ryde Middle were then examined using histological and PCR analysis. A sample size of 20 was chosen in accordance with research published on minimum sample sizes required for accurate estimates of parasite prevalence (Jovani & Tella 2006).

2.2. Histological analysis

As mentioned before, half of the hepatopancreas of all individuals was fixed in Bouin’s solution ready for histological analysis. The samples were then dehydrated through an ethanol series (30%, 50%, 70%, 90%, 100%, dry ethanol). These ethanol concentrations were prepared using Fisher analytical grade ethanol and were diluted using R.O.

14Figure 5. Micrograph O. edulis connective gill tissue (H&E stain). Arrows indicate B. ostreae cells (Arzul et al. 2011).

water. Dry ethanol was prepared by heating a crucible of cupric sulphate until it became discoloured and adding it to 1 litre of stock ethanol. All samples were kept at each ethanol concentration for at least 24 hours and were finally kept in Fisher analytical grade xylene for a further 24 hours to clear the tissue for histology. All samples were then embedded in paraffin wax and allowed to set. 5 micrometre sections were then taken from the front, middle and back of each embedded sample, using a microtome, so that a prevalence and intensity estimate that was representative of the whole tissue sample could be obtained. Approximately 3 sections were taken from the front, middle and back of the tissue, giving a total of 9 sections per sample. Each slide was then stained using the following adaptation of the method used by Austin & Austin (1989):

1. 5 minutes in Xylene 2. 1 minute in 100% ethanol3. 1 minute in 70% ethanol4. 1 minute in 50% ethanol5. 1 minute in 30% ethanol6. 3 minutes in haematoxylin 7. 15 minutes under running water8. 15 minutes in Gomori triple stain9. Rinse with water10. 1 minute in acetic acid11. First rinse in 100% ethanol (2 minutes)12. Second rinse in 100% ethanol (2 minutes)13. 3 minutes in Xylene14. DPX and mounting

Slides were then observed under an Olympus BH2-RFCA microscope to obtain prevalence and intensity estimates. Slides were scanned at 20x magnification and once a parasite had been located it was bought to the centre of the field of view. The magnification was then increased to 40x and all parasites located within that field of view were counted and an average was obtained from the three counts for each individual.

Parasites were identified by reference to figures 2, 3 and 5 as there is a good representation of different stages of the parasite over these figures.

2.3. DNA extraction and PCR analysis

DNA was extracted from 10mg of tissue of each sample using the Qiagen™ DNeasy Blood and Tissue kit, following the Animal Tissues Spin-Column Protocol. The resulting DNA was quantified using a NanoDrop™ ND-1000 Spectrophotometer.

Once the DNA was extracted, 25µl PCR reactions were carried out following an adaptation of protocol C set out by Carnegie et al. (2000). These PCR reactions contained 0.5µl C FWD and REV primers (Eurofins MGW Operon™) (see table 1), 1µl dNTP nucleotide mix (QIAGEN™ 10mM), 7.75µl nuclease-free water, 4µl MgCl2 (Promega™, 25mM), 5µl 5X green GoTaq® Flexi buffer (Promega™), 0.25 µl GoTaq® G2 Flexi DNA Polymerase (Promega™) and 6 µl template DNA. Amplification was then carried out using a Bio-Rad™ MyCycler thermocycler following the following protocol: a 3-minute initial denaturing cycle at 94°C, followed by 40 one-minute cycles of denaturing, annealing and extension at 94°C, 59°C and 72°C, respectively. This protocol was designed to amplify a 760bp product of putative Bonamia ostreae DNA.

In addition to this PCR protocol, a

15

PCR reaction Primer sequence Tm (°C) Amplicon size (bp)C (FWD) CGGGGGCATAATTCAGGAACC (REV) CCATCTGCTGGAGACACAG

Nest (FWD) AAGGAATTGACGGAAGGGCACNest (REV) TAAGAACGGCCATGCACCAC

59

55

760

150

Table 1. Forward and reverse primer sequences, annealing temperature and amplicon size primary and nested PCR reactions.

‘nested’ PCR protocol was also carried out on the remaining primary PCR products. The first round PCR products were diluted to a concentration of 10% by combining 1µl of primary PCR product with 9µl of milliQ water. 1 µl of diluted PCR product were combined with 0.5 µl B. ostreae nested F1 and R1 primers (Eurofins Genomics™), 1 µl dNTP nucleotide mix (QIAGEN™ 10mM), 12.75µl nuclease-free water, 4µl MgCl2 (Promega™, 25mM), 5µl 5X green GoTaq® Flexi buffer (Promega™) and 0.25 µl GoTaq® G2 Flexi DNA Polymerase (Promega™) to produce 25 µl PCR reactions for each sample. These reactions were then amplified using the Bio-Rad™ MyCycler following the protocol: a 3-minute initial denaturing cycle at 95°C, followed by 35 one-minute cycles of denaturing, annealing and extension at 95°C, 55°C and 72°C, respectively.

The final primary and nested PCR products were analysed using gel electrophoresis. Agarose gel (Fisher, 1%) was made by adding 1g of Fisher Agarose to each 100ml of 1xTAE buffer. 50 ml of gel was then combined with 4 µl ethidium bromide (Sigma) and then poured into the casting tray. Two 15-well combs were added to allow 28 samples to be run each time. The gel was allowed to set for approximately 30 minutes and the primary and nested PCR products for each sample were loaded adjacent to each other. 5 µl of 100bp DNA ladder (500 µg/ml, New England BioLabs Inc. ™) was combined with 1 µl blue Gel Loading Dye (6X, New England BioLabs Inc. ™) and loaded onto the gel. The gels were then run for 30 mins at 70V and the separated fragments were visualised using ultraviolet transillumination in a Bio-Rad™ Gel Doc 2000 and analysed using Quantity One (Bio-Rad™) software. The separated DNA fragments were then compared with the DNA ladder to estimate fragment size.

2.4. Statistical analysis

All data obtained was stored using Microsoft Excel. The data was then imported into R and all subsequent data manipulation, graphical representation and statistical analysis was carried out there.

Firstly, all vectors and dataframes required for graphical and statistical analysis were created. Boxplots were created for data visualisation and all normality was assessed using Q-Q plots and Shapiro-Wilk Normality Tests. All Shapiro-Wilk outputs were indicated for each Q-Q plot. The relationship between wet weight (g) and infection intensity was tested using a General Linear Model and Spearman’s Rank Correlation Coefficient. Dunn’s Multiple Comparison Test was used to assess differences in average infection intensity between tanks within each treatment group and in arcsine-transformed detection success between each treatment group for each detection method. Wilcoxon Rank Sum tests were used to test for differences in average infection intensity between treatment groups, Kruskal-Wallis Rank Sums tests to test for differences in average infection intensity between different temperature and salinity treatments and Chi-Square Goodness of Fit tests to test for differences in arcsine-transformed detection successes between different detection methods. All statistical outputs can be found in the appendix. All statistical outputs were denoted in the appropriate figures except in the case of non-significance and when the figure would become over-crowded.

16

3. Results

3.1. Visualisation of treatment data

3.1.1. Boxplots

The boxplots in figure 6 provide a useful tool for data visualisation. It can be seen that most of the sample groups that they represent do not appear normally distributed with perhaps the exception of figure 6b) (treatment A), although it does appear slightly skewed. The remainder of the sample groups appear to be negatively skewed with figures 6a) and d) (all samples and treatment group C) displaying a few outliers (supposedly shared). These outliers represent a few exceptionally high parasite counts, apparently in treatment group C. Considering the skew of the sample groups and the outliers in figures 6a) and d), it is unlikely that the data is normal.

17

Figure 6(a-e). Figure showing boxplots of the mean

infection intensity for a) all samples; b) treatment group A; c) treatment group B; d) treatment group C; e) Ryde

Middle samples.

From figure 7(a-i) it can be seen that the majority of the data for the individual tanks is also skewed one way or another (except for maybe 7f)).

3.1.2. Q-Q plots and normality

From figure 8(a-e), it can be seen from the Q-Q plots that the sample group data is close to being normal as the majority of the points lie on the normal line of the plot. However, as the boxplots appeared to portray, the data appears to be lightly tailed in treatment groups A and B, and the rest of the data appears to be heavily tailed. The Shapiro-Wilk tests indicate normality in all data groups except for all samples and treatment group C. All sample sizes are equal (n=20) except for figure 8a) (n=80).

ail

18

Figure 8(a-e). Figure showing Q-Q plots of mean infection intensity with Shapiro-Wilk statistic and p-value (n=80 for a and n=20 for b-e) for a) all samples; b) treatment group A; c) treatment group

B; d) treatment group C; e) Ryde Middle samples.

Figures 9(a-i) indicate a mixture of normality and non-normality among the different tanks. Figures 9(a-b) look normal from the Q-Q plot and the majority of the data points appear to fit the normal line. However, the Shapiro-Wilk test indicates non-normality. Figure 9h) and i) appears to be skewed to the right whilst the rest of the plots appear to show tailing to different extents. None of the Shapiro-Wilk tests came back positive except for tank 4C, which appears to heavily tailed. Additionally, as we break down the data into smaller groups, the sample size decreases also with the lowest (n=5) for tanks B1-4 and the highest (n=10) for tanks A1 and 2. With all this in mind, it is best to treat all data groups as non-normal and apply non-parametric tests to test for significant differences.

3.2 Wet weight and infection intensity

3.2.1. Data visualisation

From figures 10(a-b), it can be seen that the intensity data appears to be skewed to the left, whilst the Q-Q plot also reveals heavy tails in the data. In addition to this, the Shapiro-Wilk test also indicates non-normality. However, the histogram and boxplot regarding the weight data appears to show a normal distribution. The Q-Q plot and Shapiro-Wilk test also appears to indicate normality. Square root transformation (recommended for count data) did not

19

Figure 10(a-f). Figure showing histogram, boxplot and Q-Q plot with Shapiro-Wilk statistic and p-value (n=60) of the mean infection intensity of Poole Harbour samples (a-c) and histogram, boxplot and Q-Q plot with Shapiro-Wilk statistic and p-value (n-60) of weight (g) of Poole Harbour samples (d-f).

result in normal intensity data. Therefore, the data should be treated as non-normal and non-parametric tests should be applied.

3.2.2. Effect of wet weight on mean infection intensity

Figure 11 shows that there appears to be no relationship between weight and infection intensity. The General Linear Model applied to the data appears to show an almost steady infection rate (slightly decreasing) as weight increases.

This apparent decrease in intensity is probably due to the high value outliers at lower weights. The Spearman’s rank correlation coefficient indicates no correlation between wet weight and infection intensity. As wet weight has no apparent effect on infection intensity, it will be ruled out as a factor for the remainder of the analysis.

3.3. Infection intensity from histological analysis

3.3.1. Tank infection intensities

Firstly, it is important to understand whether there is any variation within treatments groups for determining whether there is variations between treatment groups. From figure 12, it can be seen that the lowest mean infection intensities are associated with treatment group A (approximately 5-6), whilst the highest mean infection intensities are associated with treatment group C (approximately 16). Dunn’s multiple comparison indicated that only two tanks within a treatment group were significantly different from each other (Tanks B3 and

20

Figure 11. Figure showing mean infection intensity plotted against weight (g) for Poole Harbour samples (n=60) with General Linear Model equation

and Spearman’s rank correlation coefficient.

Figure 12. Figure showing the mean (±1 S.D.) infection intensity for each holding tank within each treatment group. Sample size (n) indicated within bars, lower case letters denote statistically significant difference (P<0.05,

Dunn’s multiple comparison). All statistical outputs in appendix.

B4). In addition to this, tanks from treatment group B also have the lowest sample size (n=5). The standard deviations for group C and tanks B2 and B3 are also quite high.

3.3.2. Treatment group infection intensities

From figure 13, it can be seen that treatment group C had the highest mean infection intensity whilst treatment group C had the lowest mean infection intensity. Treatment groups B and D appear to have similar mean infection intensities between treatment groups A and C. It can also be seen that there are numerous significant differences between treatment groups. Firstly, treatment group A is significantly different from all other treatment groups, as is treatment group C. In addition to this, treatment group B is significantly different from treatment group C as well. The standard deviations associated with treatments groups B-D also remain high.

3.3.3. Effect of temperature and salinity on mean infection intensity

21

Figure 13. Figure showing mean (±1 S.D.) infection intensity for each treatment group. Sample size (n) indicated within bars, lower case letters denote statistically significant difference (P<0.05, Wilcoxon

rank sum test). All statistical outputs in appendix.

Figure 14a) and 14b). Figure showing the mean (±1 S.D.) infection intensity of Poole Harbour samples at a) 12 and 20 (°C) at 34‰ salinity and b) 28 and 34 (‰) at 12°C. Sample size (n) indicated within bars, H-statistic and p-value of Kruskal-Wallis rank sum Test also supplied.

Figure 14 can be used to visualise the differences in mean infection intensities between different environmental conditions. Kruskal-Wallis rank sum test was used so that the effect of temperature and salinity could be assessed instead of just testing between two independent sample groups. At 34‰, the mean infection intensity increased from 9.42 at 12°C to 13.69 at 20°C (43% increase). At 12°C the mean infection intensity decreased to 5.57 at 28‰ salinity from 9.42 at 34‰ salinity (69% r).

3.3.4. Site comparison

Figure 15 shows the mean infection intensity for all Poole Harbour samples (n=60) compared with the mean infection intensity of the Ryde Middle samples (n=20). The standard deviations remain large and the Wilcoxon rank sums test showed no significant difference between the two sites as the mean infection intensities appear almost identical.

3.4. Detection methods and prevalence

3.4.1 PCR results

All PCR results were obtained by comparing transilluminated DNA fragments with a DNA ladder. Figure 16 shows the gel electrophoresis result for the primary PCR (P) and nested PCR (N) for sample 3-10 from tank A1 and compared with the DNA ladder. This is only 7 samples out of 80 and the rest of the PCR results can

22

Figure 15. Comparison of mean (±1 S.D.) infection intensities between the two sample sites. Wilcoxon rank sums test showed no significant difference.

Figure 16. Photo of an example transilluminated gel containing primary and nested PCR products for samples 3A1-10A1 with 100 bp ladder. Red lines indicate region between 1000 and 500 bp whilst green lines indicate region between 100 and 200 bp. All gel images can be found in the appendix.

10A1(N)10A1(P)9A1(N)9A1(P)8A1(N)8A1(P)

7A1(N)7A1(P)6A1(N)

6A1(P)4A1(N)4A1(P)3A1(N)3A1(P)Ladder

be found in the appendix. The red lines help to visualise the 1000 and 500 base-pair bands of the DNA ladder and the green lines help to visualise the 100 and 200 base-pair bands of the DNA ladder. This helps us to determine whether the sample tests positive for the primary PCR (760 base-pairs) and the nested PCR (150 base-pairs). From figure 16, we can see that positive primary PCR results were obtained for samples 3A and 9A, although 9A is very faint and questionable. The remainder of primary PCR results for this figure are negative, however. The nested PCR appears to have tested positive for all samples in this figure. However, faint bands were observed for some other samples and, depending on how faint, may not have been convincing enough to warrant a positive result. Ideally, all DNA fragments would need to be sequenced to determine whether they were truly positive.

3.4.2. Detection methods and success

Figure 17 was designed to compare prevalence estimates between three detection methods (histological analysis, primary PCR and nested PCR). However, a prevalence of 100% was obtained through histological analysis and it seems that comparing detection success between the different methods would be more appropriate. Whilst histological analysis revealed a 100% prevalence, PCR and nested PCR reactions only managed to successfully detect 13.75 and 72.5%. These values indicate that there is a difference of 86.25% between success rates of histology and PCR, whilst there is a difference of 58.75% between PCR and nested PCR. According to figure 17, histology is the most successful method for detection whilst PCR is the least effective.

Chi-squared goodness of fit tests revealed no significant difference between the arcsine-transformed proportions any of the detection methods.

3.4.3. Comparisons of detection success of each method between treatment groups

23

Figure 17. Figure showing the total detection success (%) for each detection method (n=80).

Figure 18. Figure comparing the detection success (%) for each detection method for each treatment group (n=20). Lower case letters denote a statistically significant

difference (P<0.05, Dunn’s multiple comparison’s Test)

As can be seen from figure 18, the detection success of the primary and nested PCR reactions varied between treatment groups. The highest primary PCR detection success (25%) was for treatment group A, whilst the lowest (5%) was for treatments B and C. A 20% detection success was found for treatment group D. The highest nested PCR detection success (95%) was in treatment group A, whilst the lowest (40%) was in treatment group B. Dunn’s multiple comparison’s test also revealed a significant difference between the arcsine-transformed proportions of these two treatment groups. The detection successes for treatment groups C and D were 85% and 70%, respectively. The highest detection success for molecular methods appears to be in treatment group A, whilst the lowest appears to be in treatment group B.

4. Discussion

Firstly, the data collected was visualised and tested for normality in figures 6-9. These plots revealed a mixture of normality and non-normality between the treatment groups and a lot of the data appeared to be skewed or tailed. However, Shapiro-Wilk normality tests revealed a large proportion of normal treatment groups. However, the data for all samples was not normal and nor was treatment C. The count data for treatment groups appears to display great standard deviation as well as occasional outliers. Square root transformation (recommended for count data) did not help to normalise non-normal groups of data. The high standard deviations and some extreme outliers can be explained by the nature of this experiment. Counts of B. ostreae cells were higher in tissues such as connective tissue and digestive tubules. These odd, extremely high counts are probably the reason for the skew in some of the data and the high standard deviations. Although sections were taken from the front, middle and back of the tissue sample in an attempt to obtain an average representative of the whole tissue samples, in future studies a higher number of technical replicates should be examined. Due to the non-normality of some of the groups of data, the high standard deviations across the board, numerous outliers and the fact that most of the data was analysed according to discrete categories, all data was treated as non-normal and the appropriate non-parametric tests were applied. This is especially true when comparing mean tank intensities as some group sample sizes are greatly reduced (n=5).

The wet weight of all Poole samples were measured prior to dissection (mean=11.68g ±4.61S.D. n=85) in an attempt to quantify the effect of weight on mean infection intensity to better understand the effect this parameter may have when analysing the mean infection intensities between groups. From figure 11, it can be seen that there is no correlation between wet weight (g) and mean infection intensity. The general linear model shows an almost constant infection rate with increasing weight and the Spearman’s rank correlation coefficient shows no sign of correlation between the two. Therefore, this parameter can be

24

ignored in the later analyses. Weight is not known to affect prevalence or infection intensity. Older O. edulis individuals tend to show higher infection intensities although it is not entirely clear why. Older and larger oysters are certainly more likely to have captured infectious particles but a physiological change associated with age may affect the progression of the disease (da Silva 2009). Reproduction in bivalve molluscs has been shown to be affected by some protozoan parasites such as M. refringens in O. edulis (Robert et al. 1991) and M. galloprovincialis (Villalba et al. 1993) and H. nelsoni in C. virginica, usually by inhibiting gametogenesis. Van Banning (1990) suggested that B. ostreae has an incubation period within the ovaries of O. edulis before developing to the infectious stage. Further investigation showed no effect of gender on infection intensity (Caceres-Martinez et al. 1995; Culloty & Mulcahy 1996). However, it has been suggested that oysters become weaker after spawning, allowing the progression of bonamiasis (Hine 1991b; Culloty & Mulcahy 1996; Jeffs & Hickman 2000). One study did obtain results that suggest an advancement of infection associated with female gametogenesis (da Silva 2009). In any case, the Poole Harbour oysters likely came from the same cohort, meaning that they were probably similar in age too and therefore this effect of age is likely to be constant between individuals.

Another important factor to quantify before comparing infection intensities between treatment groups is the variation within treatment groups. The only significant difference found within treatments was between tanks three and four in treatment B. This may have also contributed to the large standard deviations. Considering that there was no way of knowing how infected the individuals stored in each tank were at the start of the incubation period, there is no way to tell if this difference was due to different tank conditions, or to initial infection intensities. In addition, this positive statistical result came from an extremely small sample size. Therefore, this apparent difference will be ignored. Future studies would benefit from the study of naïve oysters and infect them through inoculation (Hervio et al. 1995). This way, each oyster can receive the same dose of B. ostreae and proliferation can be measured more accurately.

Figures 13 indicates a statistically significant difference between all treatment groups except for B and D, which appear similar. Figure 14 indicates a 43% increase in infection intensity between oysters kept at 12°C and 20°C at 34‰ salinity and a reduction of 69% between oysters maintained at 34‰ and 28‰ at 12°C. This suggests that a rise in temperature or a rise in salinity can improve the parasites infectious abilities. One previous study did find bonamiasis prevalence was higher at low temperature (10°C) than at high temperature (20°C), suggesting that temperature may impact the abilities of the parasite and/or the defensive capabilities of O. edulis (Cochennec & Auffret 2002). This impact of temperature on prevalence may explain the peaks in parasite prevalence observed during late winter, although transmission occurs year-round and peaks are also observed in Autumn (Grizel 1985). Arzul et al. (2009) found that 25°C did not appear suitable for parasite survival and purified B. ostreae suspensions seemed to show preference for a hypersaline medium. Additionally, Audemard et al. (2008) found that increased water temperature seemed to increase the pathogenicity of Bonamia spp. in C. ariakensis. Finally, the environmental conditions also would have affected oyster physiology, with the NRR time of haemocytes reduced at low salinities (possibly due to osmotic imbalance). The retention time of haemocytes in O. edulis has also been shown to be low around 10°C, with a peak at 15°C. Retention time at 20°C also seems reasonable as a compromise between 15°C and 25°C at high salinities (Hauton et al. 1998). The results of this study are particularly important in the present context due to B. ostreae’s existence as a, predominantly, intrahaemocytic parasite. These factors help to explain the apparent difference in infection intensity between treatment groups in the Poole Harbour samples.

25

However, it is difficult to draw conclusions from the apparent difference in intensity between treatment D and other groups due to the fact that the samples were taken from different sites at a different time of year, resulting in the samples being drawn from sites with different environmental conditions, as well as being at different life cycle stages. Additionally, no control for age or size was made for treatment D. Figure 15 displays the average infection intensities for all Poole samples compared with the average infection intensity of the Ryde Middle (treatment D) samples processed. A Wilcoxon rank sums test showed no significant difference between the two. Considering that the Ryde Middle samples were taken in early autumn and the Poole samples in late winter (both approximately around the time of peak prevalence) this is unsurprising.

The results presented here have many potential possible applications in management practices, life cycle elucidation and in light of the current climate change issues facing us (Audemard et al. 2008) as the global distribution of B. ostreae will surely be affected. O. edulis can tolerate salinities as low as 23‰ (Beaumont) and, as the data suggests lower parasite prevalence at lower salinities, management practices could be based around holding individuals of susceptible populations at low salinities to mitigate oyster losses. Similar management practices have been implemented, successfully, in an attempt to mitigate infection of oysters with H. nelsoni in Delaware Bay (Haskin & Ford 1982).

Furthermore, a life cycle consisting of five stages, based on seasonal observations and ultrastructural studies, has been proposed for Bonamia spp. in T. chilensis (Hine 1991b). This life cycle correlates well with seasonal peaks in prevalence and is supported by changes in ultrastructure throughout the cycle. Seasonal changes in temperature and salinity, therefore, could possibly act as cues for transitions between development stages of the parasite. Although these studies are based on different species to B. ostreae, any discoveries concerning B. ostreae may also be relevant to other haplosporidians, and vice versa (Carnegie et al. 2004).

The implementation of these management practices in conjunction with other current management practices may help to greatly reduce the impact of B. ostreae on the European flat oyster industry. Perhaps one of the most important current areas of research with regards to disease management is the development of resistance to B. ostreae in O. edulis. Acquired resistance has been demonstrated previously in Ireland (Culloty 2001) and France (Carnegie 2004). In both cases, this acquired resistance has led to improved survival. Research has been conducted to try to better understand the mechanism for resistance in flat oysters, comparing the circulating haemocyte ratios of resistance and susceptible populations of O. edulis and C. gigas, which appears to resist infection by B. ostreae. The study found that the proportion of agranular cells was significantly higher in infected oysters than uninfected and significant differences in haemocyte ratios were observed between susceptible and resistant oysters, suggesting that a lower number of granulocytes may impact susceptibility (Cochennec et al. 2003b).

Figures 17 and 18 compare the total detection success of the three techniques employed in this study and the success of these methods between treatment groups, respectively. From figure 17, although no statistical difference was observed, it is quite clear that the nested PCR protocol and histology returned a much higher prevalence estimate than the primary PCR. This is a strange observation as the PCR protocol has previously been shown to be more sensitive than histological techniques (Carnegie et al. 2000). However, this highlights the need for optimisation of PCR protocols before reliable prevalence estimates can be produced. Unfortunately, this optimisation could not be fully carried out in the present study due to time and resource limitations. Additionally, in the case of PCR, there are a number of

26

steps involved, and no way of telling if a particular step has not worked properly. Therefore, it is sensible to conclude that, although they are generally considered less sensitive (Lynch et al. 2005), this PCR protocol should be used in conjunction with histological techniques. The nested PCR returned a much higher prevalence estimate than the primary PCR. Although, there are many methods recommended by OIE for the detection of B. ostreae (OIE 2012). The results presented in this study suggest that protocol C (Carnegie et al. 2000) should be used in conjunction with a second round of nested PCR for higher sensitivity. Detection through histology returned a prevalence of 100%, higher than either molecular techniques employed here. For the Poole samples, this is unsurprising due to the close proximity of infected oysters to each other in experimental tanks and both sites were sampled during periods of peak prevalence. In addition to this, B. ostreae can resemble intra-haemocytic inclusions, possibly resulting in false-positive microscopic identification (Carnegie et al. 2000). However, the histological staining protocol recommended by the OIE is staining in Haemotoxylin before counter-staining in Eosin. Using Gomori triple stain, no difficulties were encountered in locating and identifying the parasite in histological sections in the present study and is the protocol recommended by Austin & Austin (1989). Finally, the unexpected PCR result may also be due to other factors. High counts of B. ostreae cells were observed in the connective tissues and digestive tubules of O. edulis and some of the negative PCR results may have been due to the type of tissue sampled. In any future study, careful selection of the tissue used for PCR should be employed, preferably tissue from deep within the animal.

Figure 18 indicates that there was no significant difference in detection success of any method between treatment groups except between treatments A and B for the nested PCR. However, due to the apparent unreliability of the PCR results in this study, it would be unwise to draw any conclusions on how temperature and salinity may affect detection.

Although the primary molecular analysis carried out in this study has not provided reliable results, there are numerous other detection methods recommended by OIE for the detection of B. ostreae and molecular diagnostic techniques have great potential in other areas of parasitic research as well as detection. The nested PCR primers used in this study show great sensitivity, as well as other PCR assays that have been developed (Corbeil et al. 2006; Marty et al. 2006) as well as a qPCR assay (Robert et al. 2009) that shows good sensitivity

27

Figure 19. Table comparing the sensitivity (se) and specificity (sp) of some detection methods (OIE 2009).

and reliable prevalence estimates when compared with tissue imprints (OIE 2012). The reliability of the prevalence estimates is encouraging, as semi-quantitative analysis of B. ostreae infections has traditionally been limited to histological analysis. These histological methods have been described as slow and require a trained observer for screening (Lynch et al. 2005), making qPCR an attractive candidate for future analysis. The advantages and disadvantages of histological techniques compared with molecular techniques, as well as the varying sensitivities and specificities of certain techniques, are outlined in figures 19 and 20, respectively. Molecular techniques such as laser-assisted microdissection could become useful techniques for isolating individual parasites and may be used to more accurately describe the life cycle of B. ostreae (Small et al. 2008). In addition to this, the use of crosses between lines of selectively bred individuals may be useful in mapping quantitative trait loci (QTL’s) and could be useful in elucidating the molecular basis of host-parasite interactions (Carnegie et al. 2004).

Conclusions and future work

In conclusion, the results presented here suggest that higher temperatures and salinities result in an increased intensity of infection with B. ostreae in O. edulis, an important. This has important implications in disease management practices and could be used in conjunction with seasonal ultrastructural studies to shed some light on the life cycle of B. ostreae. The results are also important in the context of climate change, as forecasting of disease evolution is much needed.

Additionally, the primary PCR protocol used in this study proved unreliable. If used, results should be verified with a second-round nested PCR reaction. Histological staining with Gomori triple stain was a useful and easy protocol for identification of B. ostreae, but molecular techniques as well as traditional techniques should both be employed for detection as well as for physiological studies. Unfortunately, this study was limited by the lack of technical replicates taken from each sample to give a fully representative rate of infection due to high variation within tissue types. Additionally, time and resource constraints did not allow for full optimisation of the primary PCR protocol.

Future work should now concentrate on seasonal ultrastructural studies that may help to elucidate the life cycle of B. ostreae, as well as continued research into resistance mechanisms in O. edulis. Both these areas of research have important implications in disease management and industry practices. QTL mapping may play an important part in unveiling the mechanism for resistance in O. edulis and life cycle studies (and the effect of environmental conditions on development) may also help to reduce the economic impact caused by this disease and contribute to the restoration of the European flat oyster industry.

28

References

Adema, C.M., van der Knaap, W.P.W. & Sminia, T. (1991). Molluscan hemocyte- mediated cytotoxicity: the role of reactive oxygen intermediates. Rev. Aquat. Sci,. 4, pp. 201–223.

Allam, B. & Ford, S.E. (2006). Effects of the pathogenic Vibrio tapetis on defence factors of susceptible and non-susceptible bivalves species: I. Haemocytes changes following in vitro challenge. Fish Shellfish Immunol. 20, pp. 374–383.

Arzul, I., Diggles, B., Heasman, M., Chollet, B., Berthe, F.C.J. & Crane, M.S.J. (2006). Development of a TaqMan PCR assay for the detection of Bonamia species. Diseases of Aquatic Organisms, 71, pp. 75-80.

Arzul, I., Gagnaire, B., Bond, C., Chollet, B., Morga, B., Ferrand, S., Robert, M. & Renault T. (2009). Effects of temperature and salinity on the survival of Bonamia ostreae, a parasite infecting flat oysters Ostrea edulis. Dis. Aquat. Org., 85 (1), pp. 67–75.

Audemard, C., Carnegie, R.B., Bishop, M.J., Peterson, C.H. & Burreson, E.G. (2008). Interacting effects of temperature and salinity on Bonamia sp. parasitism in the Asian oyster Crassostrea ariakensis. Journal of invertebrate pathology, 98, pp. 344-350.

Austin, B. & Austin, D.A. (1989) Methods for the Microbiological Examination of Fish and Shellfish. Ellis Horwood, Chichester.

Babior, B.M. (1997). Superoxide: a two-edged sword. Bra. J. Med. Biol. Res., 30, pp. 141– 155.

Bachère, E., Hervio, D. & Mialhe, E. (1991). Luminol-dependent chemiluminescence by hemocytes of two marine bivalves, Ostrea edulis and Crassostrea gigas. Dis. Aquat. Org., 11, pp. 173–180.

Bachère, E., Mialhe, E., Noel, D., Boulo, V., Morvan, A. & Rodríguez, J. (1995). Knowledge and research prospects in marine mollusc and crustacean immunology. Aquaculture, 132, pp. 17–32.

Balouet, G.,Poder, M. & Cahour,A. (1983).Haemocytic parasitosis:morphology and pathology of lesions in the French flat oyster, Ostrea edulis L. Aquaculture, 34, pp. 1–14.

Bannister, C. & Key, D. (1982). Bonamia a new threat to the native oyster fishery. Fishes Notes. MAFF, Lowestoft.

Barrow, J.H. (1965). Observations on Minchinia pickfordae (Barrow, 1961) found in snails of the Great Lakes region. Trans. Am. Microscop. Soc., 84, pp. 587-593.

Berthe, F.C.J. and Hine, P.M. (2003). Bonamia exitiosa Hine et al., 2001 is proposed instead of B. exitiosus as the valid name of Bonamia sp. infecting flat oysters Ostrea chilensis in New Zealand. Diseases of Aquatic Organisms, 57, pp. 181.

Bucke, D., Hepper, B., Key, D. & Bannister, R.C.A. (1984). A report on Bonamia ostreae in Ostrea edulis in the UK. International Council for Exploration of the Sea CM 1984/K, 9: pp. 7.

Cáceres-Martínez, J., Robledo, J. & Figueras, A. (1995). Presence of Bonamia and its relation to age, growth rates and gonadal development of the flat oyster, Ostrea edulis, in the Ria de Vigo, Galicia (NW Spain). Aquaculture, 130, pp. 15- 23.

29

Cao, A., Fuentes, J., Comesaña, P., Casas, S.M. & Villalba, A. (2009). A proteomic approach envisaged to analyse the bases of oyster tolerance/resistance to bonamiasis, Aquaculture. 295, pp.149-156.

Carnegie, R B, Barber, B. J., Culloty, S. C., Figueras, a J., & Distel, D. L. (2000). Development of a PCR assay for detection of the oyster pathogen Bonamia ostreae and support for its inclusion in the Haplosporidia. Diseases of aquatic organisms, 42(3), pp.199–206.

Carnegie, R.B., Barber, B.J. & Distel, D.L. (2003). Detection of the oyster parasite Bonamia ostreae by fluorescent in situ hybridization. Diseases of Aquatic Organisms, 55, pp. 247-252.

Carnegie, R., Burreson, E., Hine, P., Stokes, N., Audemard, C., Bishop, M. & Peterson, C. (2006). Bonamia perspora n. sp (Haplosporidia), a parasite of the oyster Ostreola equestris, is the first Bonamia species known to produce spores. J. Eukaryot. Microbiol., 53, pp. 232–245.

Carnegie, R.B. & Cochennec-Laureau, N. (2004). Microcell parasites of oysters: recent insights and future trends. Aquatic Living Resources, 17, pp. 519 – 528.

Chagot, D.J. (1989). Caracterisation morphologique et functionelle des hemocytes d’Ostrea edulis et de Crassostrea gigas, mollusques bivalves. Etude in vitro de leurs interactions avec le protozoaire Bonamia ostreae (Ascetospora). Thèse du diplome de l’Ecole Pratique des Hautes Etudes, Université de Montpellier, France.

Chagot, D., Boulo, V., Hervio, D., Mialhe, E., Bachère, E., Mourton, C. & Grizel, H. (1992). Interactions between Bonamia ostreae (Protozoa: Ascetospora) and hemocytes of Ostrea edulis and Crassostrea gigas (Mollusca: Bivalvia): Entry mechanisms. Journal of Invertebrate Pathology, 59, pp. 241–249.

Chakravortty, D. & Hensel, M. (2003). Inducible nitric oxide synthase and control of intracellular bacterial pathogens. Microbes Infect., 5, pp. 621–627.

Cheng, T.C.,1981. Bivalves. In: Ratcliff, N.A., Rowley, A.F. (Eds.), Invertebrate Blood Cells. Academic Press, London, pp. 233–330.

Cochennec, N. (2001). Bonamia ostreae, parasite de l’huître plate, Ostrea edulis, sa position taxonomique parmi les parasites du groupe “Microcell,” analyses des interactions hôte/parasite chez plusieurs populations d’huîtres plates. Thèse de Doctorat. Biologie cellulaire, Université de la Rochelle, France.

Cochennec, N. & Auffret, M. (2002). European project FAIR-CT98-4120 “Environmental Factors and Shellfish Diseases” 15/05/2002 Final Report.

Cochennec, N. & Garcia, S. (2000). Flow cytometric comparison of esterase and radicals oxygen intermediate productions by Ostrea edulis haemocytes uninfected and infected by the protistan parasite Bonamia ostreae. J. Eukaryot. Microbiol. 48, pp. 16A–17A.

Cochennec, N., Hervio, D., Panatier, B., Boulo, V., Mialhe, E., Rogier, H., Grizel, H. & Paolucci, F. (1992). A direct monoclonal antibody sandwich immunoassay for detection of Bonamia ostreae (Ascetospora) in haemolymph samples of the flat oyster Ostrea edulis (Mollusca:Bivalvia). Diseases of aquatic organisms, 12, pp. 129-134.

Cochennec, N., LeRoux, F., Berthe, F. & Gerard, A. (2000). Detection of Bonamia ostreae based on small subunit ribosomal probe. Journal of Invertebrate Pathology, 76, pp. 26-32.

Cochennec-Laureau, N., Auffret, M., Renault, T. & Langlade, A. (2003b). Changes in circulating and tissue-infiltrating haemocyte parameters of European flat oysters, Ostrea edulis, naturally infected with Bonamia ostreae. Journal of invertebrate pathology, 83, pp. 23-30).

Cochennec-Laureau, N., Reece, K., Berthe, F. & Hine, P. (2003a). Mikrocytos roughleyi taxonomic affiliation leads to the genus Bonamia (Haplosporidia). Dis. Aquat. Org., 54, pp. 209–217.

Comesaña, P., Casas, S.M., Cao, A., Abollo, E., Arzul, I., Morga, B. & Villalba, A. (2012). Comparison of haemocytic parameters among flat oyster Ostrea edulis stocks with different susceptibility to bonamiasis and the Pacific oyster Crassostrea gigas. Journal of invertebrate pathology, 109, pp. 274-286.

Comps, M., Tige, G. & Grizel, H. (1980). Etude ultrastructural d’un protiste parasite de l’huitre plate Ostrea edulis L. C. R. Acad. Sci, Paris, Ser D, 290, pp. 383-384.

30

Corbeil, S., Arzul, I., Diggles, B., Heasman, M., Chollet, B., Berthe, F.C.J. & Crane, M.S.J. (2006). Development of a TaqMan PCR assay for the detection of Bonamia species. Diseases of Aquatic Organisms, 71, pp. 75-80

Culloty, S.C., Cronin, M.A. & Mulcahy, M.F. (2004). Potential resistance of a number of populations of the oyster Ostrea edulis to the parasite Bonamia ostreae. Aquaculture, 237, pp. 41-58.

Culloty, S.C. & Mulcahy, M.F. (1996). Season-, age-, and sex-related variations in the prevalence of bonamiasis in flat oyster (Ostrea edulis L.) on the south coast of Ireland. Aquaculture, 144, pp. 53-63.

Culloty, S.C. & Mulcahy, M.F. (2007). Bonamia ostreae in the native oyster Ostrea edulis. Marine and environmenta health series, 29, pp. 3-30.

Culloty, S.C., Novoa, B., Pernas, M., Longshaw, M., Mulcahy, M.F., Feist, S.W. Figueras, A. (1999). Susceptibility of a number of bivalve species to the protozoan parasite Bonamia ostreae and their ability to act as a vector for this parasite. Diseases of Aquatic Organisms 37, pp. 73-80.

da Silva, P.M., Fuentes, J. & Villalva, A. (2009). Differences in gametogenic cycle among strains of the European flat oyster Ostrea edulis and relationship between gametogenesis and bonamiasis. Aquaculture, 287, pp. 253-265.

da Silva, P.M. & Villalba, A. (2004). Comparison of light microscopic techniques for the diagnosis of the infection of the European flat oyster Ostrea edulis by the protozoan Bonamia ostreae. Journal of Invertebrate Pathology, 85, pp. 97-104.

Elston, R.A., Farley, C.A. & Kent, M.L.. (1986). Occurrence and significance of bonamiasis in European flat oysters Ostrea edulis in North America. Diseases of Aquatic Organisms, 2, pp. 49-54.

European Commission. (2009). Building a sustainable future for aquaculture - A new impetus for the Strategy for the Sustainable Development of European Aquaculture. COM (2009) 162.

FAO 2004-2014. Cultured Aquatic Species Information Programme. Ostrea edulis. Cultured Aquatic Species Information Programme. Text by Goulletquer, P. In: FAO Fisheries and Aquaculture Department [online]. Rome. Updated 1 January 2004. [Cited 11 May 2015].

FAO (2008) Oyster Market Report Globefish.

FAO (2012) FAO Fisheries & Aquaculture Ostrea edulis.

Farley, C.A., Wolf, P.H. & Elston, R.A. (1988). A long-term study of "microcell" disease in oysters with a description of a new genus, Mikrocytos (g. n.) and two new species, Mikrocytos mackini (sp. n.) and Mikrocytos roughleyi (sp. n.). Fishery Bulletin, 86, pp. 581-593.

Feng, S.Y. (1988). Cellular defense mechanisms of oysters and mussels. Am. Fish. Soc. Spec. Publ., 18, pp. 153–168.

Figueras, A.J. (1991). Bonamia status and its effects in cultured flat oysters in the Ria de Vigo, Galicia (N.W. Spain). Aquaculture, 93, pp. 225-233.

Flannery, G. (2014). Aspects of the biology of the parasite Bonamia ostreae with a view to gaining a greater understanding of how to alleviate its impact on the European flat oyster, Ostrea edulis. PhD Thesis, University College Cork.

Friedman, C.S. & Perkins, F.O. (1994). Range extension of Bonamia ostreae to Maine, U.S.A. Journal of Invertebrate Pathology, 64, pp. 179-181.

Friedman, C.S., McDowell, T., Groff, J.M., Hollibaugh, J.T., Manzer, D. & Hedrick, R.P. (1989). Presence of Bonamia ostreae among populations of the European flat oyster, Ostrea edulis Linn. in California, USA. Journal of Shellfish Research, 8, pp. 133-137.

Galtsoff, P.S. (1964). The American oyster Crassostrea virginica Gmelin. U.S. Fish Wildl. Serv., Fish. Bull, 64, pp.480.

Gasser, R.B. (2006). Molecular tolos – advances, opportunities and prospects. Veterinary Parasitology, 136 (2), pp. 69-89.

Grizel, H. (1985). Etudes des récentes épizooties de l’huître plate Ostrea edulis L. et de leur impact sur l’ostréiculture bretonne. PhD dissertation, Université des Sciences et Techniques de Languedoc, Montpellier.

Grizel, H., Mialhe, E., Chagot, D., Boulo, V. & Bachère, E. (1988). Bonamiasis: A model study of diseases in marine molluscs. American Fisheries Society Special Publication, 18, pp. 1-4.

31

Grizel, H. & Tige (1982). Evolution of the hemocytic disease caused by Bonamia ostreae. 3rd Int Coll. Invert. Pathol., 6-10 Sept., Brighton, pp. 258-260.

Harrison, F.W. & A.J. Kohn eds. (1996). Microscopic anatomy of invertebrates, Vol. 6A and B: Mollusca II. Wiley-Liss, New York.

Haskin, H.H. & Ford, S.E. (1982). Haplosporidium nelsoni (MSX) on Delaware Bay seed oyster beds: a host-parasite relationship along a salinity gradient. Journal of invertebrate pathology, 40, pp. 388-405.

Hauton, C., Hawkins, L. ., & Hutchinson, S. (1998). The use of the neutral red retention assay to examine the effects of temperature and salinity on haemocytes of the European flat oyster Ostrea edulis (L). Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology, 119(4), pp.619–623.

Hervio, D. (1988). “Adaptaation de Bonamia ostreae (Ascetospora) a la survie intahaemocytaire chez l’huitre plate Ostrea edulis L. Etudes in vitro and in vivo,” pp. 1-32. D.E.A. de biologie fondamentale et appliquée. Université Blaise Pascal, Clermont Ferrand II.

Hervio, D. (1992). Contribution a l’etude de Bonamia ostreae (Ascetospora), protozoaire parasite de l’huitre Ostrea edulis (Bivalvia), et a l’analyse des interactions hote–parasite. Ph D Thesis, Blaise Pascal University, Clermont Ferrand, France.

Hervio, D., Bachère, E., Boulo, V., Cochennec, N., Vuillemin, V., Le Coguic, Y., Cailletaux, G., Mazuri‚ I. & Mialhe, E. (1995). Establishment of an experimental infection protocol for the flat oyster, Ostrea edulis, with the intrahaemocytic protozoan parasite, Bonamia ostreae: application in the selection of parasite-resistant oysters. Aquaculture, 132, pp. 183-194.

Hervio, D., Bachère, E., Mialhe, E. & Grizel, H. (1989). Chemiluminescent responses of Ostrea edulis and Crassostrea gigas hemocytes to Bonamia ostreae (Ascetospora). Dev. Comp. Immunol., 13, pp. 449.

Hervio, D., Chagot, D., Grizel, H., Mialhe, E. & Goldin, P. (1991). Localization and characterization of acid phosphatase activity in Bonamia ostreae (Ascetospora), an intrahemocytic protozoan parasite of the flat oyster Ostrea edulis (Bivalvia). Dis. Aquat. Org., 12, pp. 67–70.

Hine, P.M. (1991a). Ultrastructural observations on the annual infection pattern of Bonamia sp in flat oysters Tiostrea chilensis. Diseases of Aquatic Organisms, 11, pp. 163-171.

Hine, P.M. (1991b). The annual pattern of infection by Bonamia sp. in New Zealand flat oysters, Tiostrea chilensis. Aquaculture, 93(3), pp. 241-251.

Hine, P.M., Cochennec-Laureau N. & Berthe, F.C.J. (2001). Bonamia exitiosus n.sp. (Haplosporidia) infecting flat oysters Ostrea chilensis in New Zealand. Diseases of Aquatic Organisms, 47, pp. 63-72.

Howard, A.E. (1994). The possibility of long distance transmission of Bonamia by fouling on boat hulls. Bulletin of the European Association of Fish Pathologists, 14, pp. 211-212.

Hutchinson, S. & Hawkins, L.E. (1992). Quantification of the physiological responses of the European flat oyster Ostrea edulis to temperature and salinity. J. Moll. Stud., 58, pp. 215-226.

Jaziri, H. (1990). Variations génétiques et structuration biogéographique chez un bivalve marin: l’huître plate Ostrea edulis L. (PhD dissertation). Montpellier, France: University of Montpellier II.

Jeffs, A.G. & Hickman, R.W. (2000). Reproductive activity in a pre-epizootic wild population of the Chilean oyster, Ostrea chilensis, from southerm New Zealand. Aquaculture 183, pp. 241–253.

Jovani R., Tella J.L. (2006) Parasite prevalence and sample size: misconceptions and solutions. Trends in parasitology, 22, pp. 214-218.

Kimura, H., Sawada, T., Oshima, S., Kozawa, K., Ishioka, T. & Kato, M. (2005). Toxicity and roles of reactive oxygen species. Current drug targets. Inflamm. Allergy, 4, pp. 489–495.

Lallias, D., Arzul, I., Heurtebise, S., Ferrand, S., Chollet, B., Robert, M., Beaumont, A., Boudry, P., Morga, B. & Lapègue, S. (2008). Bonamia ostreae-induced mortalities in one-year old European flat oysters Ostrea edulis: experimental infection by cohabitation challenge. Aquatic Living Resources, 21, pp. 423-439.

Lapège, S., Beaumont, A., Boudry, P. & Goulletquer, P. (2007). European flat oyster – Ostrea edulis. Available: http://www.imr.no/genimpact/filarkiv/2007/07/european_flat_oyster.pdf/en [cited 11 May 2015].

32

Lynch, S., Armitage, D.V., Coughlan, J., Mulcahy, M.F. & Culloty, S.C. (2007). Investigating the possible role of benthic macroinvertebrates and zooplankton in the life cycle of the haplosporidian Bonamia ostreae. Experimental Parasitology, 115(4), pp. 359-368.

Lynch, S.A., Wylde, S., Armitage, D.V., Mulcahy, M.F. & Culloty, S.C. (2005). The susceptibility of young, prespawning oysters, Ostrea edulis, to Bonamia ostreae. Journal of Shellfish Research, 24(4), pp. 1019- 1026.

Marty, G., Bower, S., Clarke, K., Meyer, G., Lowe, G., Osborn, A., Chow, E., Hannah, H., Byrne, S., Sojonky, K. & Robinson, J. (2006). Histopathology and a real-time PCR assay for detection of Bonamia ostreae in Ostrea edulis cultured in western Canada. Aquaculture, 261, pp. 33–42.

McArdle, J.F., McKiernan, F., Foley, H. & Jones, D.H. (1991). The current status of Bonamia disease in Ireland. Aquaculture, 93, pp. 273-278.

Mialhe, E., Bachere, E., Chagot, D. & Grizel, H. (1988). Isolation and purification of the protozoan Bonamia ostreae (Pichot et al. 1980), a parasite affecting the flat oyster Ostrea edulis L. Aquaculture, 71, pp. 293–299.

Montes, J. (1990). Development of Bonamia ostreae parasitosis of flat oyster, Ostrea edulis, from Galicia, northwest Spain. In: Perkins FO, Cheng TC (eds) Pathology in marine aqua- culture. Academic Press, New York, pp. 223–227.

Montes, J. (1991). Lag time for the infestation of flat oyster (Ostrea edulis L.) by Bonamia ostreae in estuaries of Gali- cia (N.W. Spain). Aquaculture, 93, pp. 235–239.

Montes, J., Anadón, R. & Azevedo, C. (1994). A possible life cycle for Bonamia ostreae on the basis of electron microscopy studies. Journal of Invertebrate Pathology, 63, pp. 1-6.

Montes, J. & Meléndez, I. (1987). Données sur la parasitose de Bonamia ostreae chez l'huître plate de Galice, côte nord-ouest de l'Espagne. Aquaculture, 67, pp. 195-198. (French, English abstract.).

Morga, B., Arzul, I., Chollet, B. & Renault, T. (2009). Infection with the protozoan parasite Bonamia ostreae modifies in vitro haemocyte activities of flat oyster Ostrea edulis. Fish Shellfish Immunol., 26, pp. 836–842.

Mourton, C., Boulo, V., Chagot, D., Hervio, D., Bachère, E., Mialhe, E. & Grizel, H. (1992). Interactions between Bonamia ostreae (Protozoa: Ascetospora) and hemocytes of Ostrea edulis and Crassostrea gigas (Mollusca: Bivalvia): in vitro system establishment. Journal of Invertebrate Pathology, 59, pp. 235- 240.

Naciri-Graven, Y., Martin, A.G., Baud, J.P., Renault, T. & Gérard, A. (1998). Selecting the flat oyster Ostrea edulis (L.) for survival when infected with the parasite Bonamia ostreae. Journal of Experimental Marine Biology and Ecology, 224, pp. 91-107.

Nakayama, K. & Maruyama, T. (1998). Differential production of active oxygen species in photo-symbiotic and non symbiotic bivalves. Dev. Comp. Immunol., 22, pp. 151– 159.

Office Internationale d'Epizootie. (2005). Dis. inf., 18(47), pp. 450.

Office Internationale d’Epizootie. (2009). Surveillance for infection with Bonamia ostreae. Available: http://www.oie.int/fileadmin/Home/eng/Internationa_Standard_Setting/docs/pdf/Aquatic_Commission/2.4.09_BON_OST_SURV_FINAL.pdf [cited 11 May 2015]

Office Internationale d'Epizootie. (2012). Infection with Bonamia ostreae. Manual of diagnostic tests for aquatic animals.

Oubella, R., Maes, P., Allam, B., Paillard, C. & Auffret, M. (1996). Selective induction of hemocytic response in Ruditapes philippinarum (Bivalvia) by different species of Vibrio (Bacteria). Aquat. Living Resour. 9, pp. 137–143.

Pascual, M.S., Iribarne, O.O., Zampatti, E.A. & Bocca, A.H. (1989). Female–male interaction in the breeding system of the puelche oyster Ostrea puelchana d'Orbigny. J. Exp. Mar. Biol. Ecol., 132, pp. 209–219

Perkins, F.O. (1979). Cell structure of shellfish pathogens and hyperparasites in the genera Minchinia, Urosporidium, Haplosporidium,and Marteilia: Taxonomic implications. Mar. Fish. Rev., 41, pp. 25-37.

Perkins, F.O. (1987). Protistan parasites of commercially signifi- cant marine bivalves, life cycles, ultrastructure, and phylogeny. Aquaculture, 67, pp. 240-243.

Perkins, F.O. (1988). Structure of protistan parasites found in bivalve molluscs. Am. Fish. Soc. Spec. Publ., 18, pp. 93-111.

33

Pichot, Y., Comps, M., Tigé, G., Grizel, H. & Rabouin, M.A. (1980). Recherches sur Bonamia ostreae gen. n., sp. n., parasite nouveau de l'huître plate Ostrea edulis L. Revue des Travaux de l'Institut des Pêches Maritimes. 43, pp. 131-140.

Ramilo, A., Navas, J. I., Villalba, A., & Abollo, E. (2013). Species-specific diagnostic assays for Bonamia ostreae and B. exitiosa in European flat oyster Ostrea edulis: conventional, real-time and multiplex PCR. Diseases of aquatic organisms, 104(2), pp.149–61.

Reid, H.I., Soudant, P., Lambert, C., Paillard, C. & Birkbeck, T.H. (2003). Salinity effects on immune parameters of Ruditapes philippinarum challenged with Vibrio tapetis. Dis. Aquat. Org., 56, pp. 249–258.

Robert, R., Borel, M., Pichot, Y. & Trut, G. (1991). Growth and mortality of the European oyster Ostrea edulis in the bay of Arcachon (France). Aquatic Living Resources, 4, pp. 265–274.

Robert, M., Garcia, C., Chollet, B., Lopez-Flores, I., Ferrand, S., François, C., Joly, J. * Arzul, I. (2009). Molecular detection and quantification of the protozoan Bonamia ostreae in the flat oyster, Ostrea edulis. Molecular and Cellular Probes, 23, pp. 264-271.

Romestand, B. & Torreilles, J. (2002). Etude de la resiteance de l’huitre Crassostrea gigas face a la protozoose a Perkinsus marinus. Haliotis, 31, pp. 21–32.

Small, J.H., Sturve, J., Bignell, J.P., Longshaw, M., Lyons, B.P., Hicks, R., Feist, S.W. & Stentiford, G.D. (2008). Laser-assisted microdissection: a new tool for aquatic molecular parasitology. Diseases of aquatic organisms, 82, pp. 151-156.

Sparck, R. (1925). Biology of the oyster (Ostrea edulis) in Limfjord, with special reference to the influence of temperature and the sex change. Rep. Dan. Biol. Sta., 30, pp.1-84.

Sprague, V. (1979). Classification of the Haplosporidia. Mar Fish Rev, 41, pp. 40–44.

Tigé, G., Grizel, H. (1984). Essai de contamination d’Ostrea edulis Linne par Bonamia ostreae (Pichot et al., 1979) en rivière de Crach (Morbihan). Rev Trav Inst Pêch Marit, 46, pp. 307–314.

Traub, R.J., Monis, P.T. & Robertson, I.D. (2005). Molecular epidemiology: A multidisciplinary approach to understanding parasitic zoonoses. International Journal for Parasitology, 35, pp. 1295-1307.

van banning, P. (1985). Control of Bonamia in Dutch oyster culture. In: Ellis, A.E. (ed.) Fish and shellfish pathology. Proceedings of a symposium, 20-23 September 1983, at Plymouth Polytechnik, Plymouth, U.K. Academic Press, London, pp.393-396.

van Banning, P. (1987). Further results of the Bonamia ostreae challenge tests in Dutch oyster culture. Aquaculture, 67, pp. 191–194.

van Banning, P. (1990). The life cycle of the oyster pathogen Bonamia ostreae with a presumptive phase in the ovarian tissue of the European flat oyster, Ostrea edulis. Aquaculture 84, pp. 189-192.

van Banning, P. (1991). Observations on bonamiosis in the stock of the European flat oyster, Ostrea edulis, in the Netherlands, with special reference to the recent developments in Lake Grevelingen. Aquaculture, 93, pp. 205-211.

Villalba A, Mourelle SG, López MC, Carballal MJ, Azevedo C (1993) Marteiliosis affecting cultured mussels Mytilus galloprovincialis of Galicia (NW Spain). I. Etiology, phases of the infection, and temporal and spatial variability in prevalence. Diseases of Aquatic Organisms, 16, pp. 61–72.

Woolmer, A.P., Syvret, M. & FitzGerald A., 2011. Restoration of Native Oyster, Ostrea edulis, in South Wales: Options and Approaches. CCW Contract Science Report No: 960, pp. 93.

34