expression and biochemical characterization of human

Vol. 64, No. 7JOURNAL OF VIROLOGY, JUlY 1990, p. 3447-34540022-538X/90/073447-08$02.00/0Copyright © 1990, American Society for Microbiology

Expression and Biochemical Characterization of HumanImmunodeficiency Virus Type 1 nef Gene Product

J. KAMINCHIK,1* N. BASHAN,1 D. PINCHASI,' B. AMIT,1 N. SARVER,2 M. I. JOHNSTON 2 M. FISCHER,'Z. YAVIN,1 M. GORECKI' AND A. PANET'

Biotechnology General (Israel) Ltd., Kiryat Weizmann, Rehovot, 76326 Israel,' and Developmental Therapeutics Branch,Basic Research and Development Program, Division ofAIDS, National Institute of Allergy and Infectious Diseases,

Bethesda, Maryland 208922

Received 24 January 1990/Accepted 13 April 1990

nefgenes from human immunodeficiency virus type 1 isolates BH10 and LAV1 (lymphadenopathy-associatedvirus type 1) were expressed in Escherichia coli under the deo operon promoter. The two proteins found in thesoluble compartment of the bacterial lysate were purified by ion-exchange column chromatography to apparenthomogeneity. Determination of the amino-terminal sequence revealed glycine as the first amino acid in the Nefprotein, indicating removal of the initiator methionine during expression in E. coli. Under native conditions,the recombinant Nef protein is a monomer of 23 kilodaltons. In denaturing polyacrylamide gels, however,BH10 and LAV1 Nef proteins migrate as 28 and 26 kilodaltons, respectively. GTP binding and GTPase activitywere monitored during Nef protein purification. These activities did not copurify with the recombinant Nefprotein from either the BH10 or the LAV1 isolate. Purified recombinant BH10 Nef protein was used as an

immunogen to elicit mouse monoclonal antibodies. A series of monoclonal antibodies were obtained whichreacted with sequences at either the amino or carboxy terminus of Nef. In addition, a conformational epitopereacting with native BH10, but not LAV1, Nef was isolated.

The human immunodeficiency virus type 1 (HIV-1) nefgene was first identified as an open reading frame of 647 basepairs, at the 3' end of the viral genome. Expression of Nefprotein was demonstrated by immunoprecipitation of a 27-kilodalton (kDa) protein from extracts of infected cells byantisera of patients with acquired immunodeficiency syn-drome (2). Substantial sequence polymorphism has sincebeen detected among nef genes of different HIV isolates.Amino acid variations can be as high as 17%, and, in someHIV strains, an in-frame termination codon is present withinthe nef coding sequence (21, 23). Nef has been reported todownregulate viral replication, since a virus isolate harbor-ing a nonfunctional nefgene appears to replicate faster thandoes its nondefective counterpart (18). On the basis of theseobservations, it was suggested that Nef participates in main-taining viral latency by restricting transcription from theviral long terminal repeat (1, 4, 19). However, this conceptshould be reevaluated in light of recent results indicating noeffect by Nef on transcription or on viral replication (12, 16).Sequence similarities between Nef and other guanine

nucleotide binding proteins, and the finding that Nef isN-myristoylated, led to the prediction that Nef acts inconjunction with other cellular regulatory proteins in amanner similar to that of cellular G proteins (22). The ideagained support by the work of Guy et al. (10), whichdemonstrated that GTP binding and GTPase activity areassociated with partially purified Nef protein expressed inEscherichia coli.

In an attempt to establish a correlation between biochem-ical activities and sequence diversity, we have expressed inE. coli neffrom two independent HIV-1 isolates and we havecharacterized the protein products. Contrary to previouslypublished data (10), the purified protein contained neitherGTP nor GTPase activity. A series of monoclonal antibodiesfor different epitopes and conformational specificities was

* Corresponding author.

also generated; these antibodies can be used for studyingcross-immunogenicity among different isolates of Nef pro-tein.

MATERIALS AND METHODSBacterial strains and plasmids. E. coli S0930 (deoR mu-

tant) was used to express recombinant proteins under the E.coli deo P1-P2 promoter system (11; M. Fischer, submittedfor publication). HIV isolates BH10 (19) and pBENN-16 (7),a 3' terminus subclone of a genomic LAV1 (lymphadenopa-thy-associated virus type 1) isolate, were the source of nefgenes. The nucleotide sequences of these genes were veri-fied after subcloning. E. coli 169A3 expressing RASH p21protein under control of the phage lambda PL promoter wasa gift from A. Levitzki (The Hebrew University, Jerusalem,Israel). The plasmid is essentially similar to that describedelsewhere (17).

Construction of nef expression plasmids. A 1,100-base-pairDNA fragment was isolated from the BH10 clone (20) byBamHI endonuclease digestion. nef coding sequences en-compass 618 bases (nucleotides 8374 through 8992) startingwith an ATG 323 base pairs downstream of the BamHI site.The DNA was subcloned in a pBR322 derivative from whichthe NdeI and PvuII restriction sites were removed. Tofacilitate insertion of the deo promoter, the plasmid wasdigested with XhoI (at nucleotide 8476) and EcoRI endonu-cleases and was ligated to a synthetic DNA linker with XhoIand EcoRI sites at the termini. The inserted linker reconsti-tuted the 5' terminus of nef downstream of the AUGinitiation codon. The region upstream of AUG contained aninternal NdeI restriction site and an EcoRI site at the 5'terminus of the linker which permitted cloning. The resultingplasmid, designated pN7 (Fig. 1), was digested by PstI andEcoRV endonucleases, and the 5' terminus of nefDNA wasgel purified.The nef gene of BH10 contains an in-frame termination

codon at position 8740, resulting in a truncated peptide of

3447

3448 KAMINCHIK ET AL.

BamH I Bam HIEcoRRI Nds I EcR I Nda I

XhoI SsiA VXhoI

EcoRV EtA-EoR V

PSI pD-NEF-2 EcoR V D PSI Ij PI D-Y-6111WEcoR V

scI

H

FIG. 1. Construction of Nef expression plasmids. Plasmid pNl isa pBR322 derivative lacking PvuII (nucleotide 2069) and NdeI(nucleotide 2899) restriction sites. The BH10 nef gene was sub-cloned via the BamHI site. Linker I (shown below) was used togenerate an NdeI restriction site adjacent to the first ATG (under-scored) of the nefgene. The linker was inserted between the EcoRIsite of pBR and the XhoI site of nef in pNl (A). Linker II (shownbelow) was used to correct termination within the BH10 nef codingsequence. The linker contains several changes to the originalsequence. (i) The termination codon in nef (position 8740) wasaltered to TGG (underscored) which codes for tryptophan. (ii) AnEcoRI restriction site was added to the 5' terminus. (iii) Thesequence GGGCCAGGG (positions 8761 through 8770) waschanged to GGGCCCGGG, generating unique Apal and SmaIrestriction sites. (iv) The EcoRV recognition site at the 3' terminusof the linker was abolished by changing the sequence from GAT toGGT. Plasmid pNl was digested with EcoRV and EcoRI. A DNAfragment of 4 kilobases, which contained nefsequences downstreamto the EcoRV site, was gel purified and ligated to linker II (B). Thetwo plasmids pN7 and pEF1 were digested with PstI and EcoRV,and the 5' end of nef isolated from pN7 was ligated into pEF1 (C).The deo promoter was then inserted between the PstI and NdeIsites, resulting in the BH10 Nef expression plasmid pD-Nef-2. Mostof the LAV1 nef gene was isolated from pBENN-16 by XhoI andSacl digestion and was exchanged with the corresponding fragmentin pD-Nef-2. The rest was prepared as a synthetic linker (linker III)and was exchanged with the NdeI-XhoI DNA fragment of BH10 (D),yielding a LAV1 Nef expression plasmid designated pD-YN-61.Linker I:EcoRI NdeI

(5'-AATTCCATATGGGTGGCAAGTGGTCAAAAAGTAGTGTGGTTGGATGGCCTGCTGTAAGGGAAAGAATGAGACGAGCTGAGCCAGCAGCAGATGGGGTGGGAGCAGCATC-3'OH)Linker II:EcoRI EcoRV

(5'-AATTCGATATCCTTGATCTGTGGATCTACCACACACAAGGCTACTTCCCTGATTGGCAGAACTACACACCAGGGCCCGGGATCAGGT-3' OH)

122 amino acids (20, 21). To restore a full coding capacity tothe gene, a synthetic oligomer, in which TGG (tryptophan)replaced the TAG terminator, was synthesized. The oligo-mer contained an EcoRI cohesive sequence at its 5' terminusand a substituted EcoRV site (GGT) at the 3' end. ApaI andSmaI restriction sites were incorporated within the linker byreplacing the sequence GGGCCAGGG (nucleotides 8761through 8770) with GGGCCCGGG. All changes were madewithout modifying the amino acid coding capacity of nef.The linker was inserted between the EcoRI-EcoRV sites ofpNl, yielding pEF1. Construction of the contiguous nefgeneand insertion of the deo promoter are depicted in Fig. 1.Briefly, pEF1 was linearized by PstI and EcoRV endonu-cleases and the 5' end of nef (EcoRV-NdeI fragment),isolated from pN7, was ligated along with the deo promoter(PstI-NdeI restriction fragment isolated from plasmidpMF5534; M. Fischer, unpublished data). The resultingplasmid, pD-Nef-2, was used to express BH10 Nef protein.To construct the LAV1 nef expression vector, the plasmidpD-Nef-2 was first digested with XhoI and Sacl endonu-cleases and the nef region between those sites was ex-changed with the corresponding pBENN-16 sequences. Asynthetic DNA sequence upstream of the XhoI restrictionsite was prepared and ligated between the XhoI and NdeIrestriction sites, yielding the plasmid pD-YN-61 (Fig. 1). Thenef sequence in each construct was verified by dideoxynu-cleotide sequencing.

Purification of Nef. An E. coli pellet (20 g) was suspendedin 400 ml of 50 mM Tris buffer (pH 8.0) containing 50 mMNaCl, 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride,and 10% glycerol (wt/wt). Cells were treated with 0.5 mg oflysozyme per ml for 15 min at 4°C and were disrupted bysonication. Nef was precipitated from clarified supernatantby slow addition of ammonium sulfate to a final concentra-tion of 250 mg/ml. The solution was stirred at 4°C for 1 h andcentrifuged for 1 h at 10,000 x g. Precipitates were sus-pended in 800 ml of 20 mM Tris buffer (pH 7.6) containing 1mM EDTA, passed through a 0.45-,um-pore-size filter, andloaded onto a Q-Sepharose column (30 by 50 cm; Pharmacia)equilibrated with 20 mM Tris (pH 7.6)-i mM EDTA. Un-bound material was removed with equilibration buffer.Bound proteins were eluted stepwise by increasing concen-trations of NaCl in equilibration buffer. Nef was eluted at 200mM NaCl.The Nef-enriched Q-Sepharose fractions were further

purified as follows: the LAV1 Nef protein was dialyzedagainst 1 mM Tris (pH 7.6) containing 0.5 mM EDTA and 5mM NaCl, diluted in equilibration buffer (50 mM sodiumacetate [pH 6.0], 0.5 mM EDTA), and then loaded onto aCM-Sepharose column (30 by 26 cm; Pharmacia) equili-brated in the same buffer. Nef protein was eluted from thecolumn at increasing NaCl concentrations. BH10 Nef frac-tions were diluted in phenyl-Sepharose equilibration buffer(20 mM Tris (pH 7.4), 1 mM EDTA, 0.6 M ammoniumsulfate) and loaded onto a phenyl-Sepharose column (2.6 by18.5 cm; Pharmacia) equilibrated with the same buffer.Elution was done with 0.36 M ammonium sulfate. The purityof the Nef proteins was determined by sodium dodecyl

Linker III:NdeI

(5'-TATGGGTGGCAAGTGGTCAAAAAGTAGTGTGGTTGGATGGCCAACTGTAAGGGAAAGAATGAGACGAGCTGAGCCAGCAGCAGATGGGGTGGGAGCAGCATC-3' OH)

J. VIROL.

CHARACTERIZATION OF HIV Nef 3449

KD

94

67

1 2 3

.. . ..

,...im

4 5

43 -

30

20 -

FIG. 2. Gel electrophoresis of bacteria expressing Nef lysatesand purified Nef protein. Bacteria expressing BH10 Nef (lane 2) or

LAV1 Nef (lane 3) protein were grown in a 2-liter fermentor inminimal medium to an optical density of 0.2 (at 600 nm). Cells were

pelleted, lysed, and analyzed on an SDS-12.5% polyacrylamide geland stained with Coomassie blue. Purified BH10 Nef (4 ,ug) (lane 4)and LAV1 Nef (20 ,ug) (lane 5), prepared as described in Materialsand Methods, were also included on the gel. Molecular size proteinmarkers are shown in lane 1.

sulfate (SDS)-polyacrylamide gel electrophoresis (Fig. 2)and fast performance liquid chromatography gel filtrationthrough Superose 12 (Fig. 3).

Production of anti-Nef monoclonal antibodies. FemaleBALB/c mice were inoculated subcutaneously with 50 ,ug ofpurified recombinant BH10 Nef protein emulsified in com-

plete Freund adjuvant. Fifteen days later, a second injectionof Nef in incomplete Freund adjuvant was administered.Five days after the second injection, the mice were bled andtiters of anti-Nef antibodies were determined by solid-phaseenzyme-linked immunosorbent assay (ELISA). Hyperim-mune animals were boosted 2 weeks after the second inoc-ulum by an intraperitoneal injection of 50 ,ug of Nef in 0.5 mlof saline.

Fusion of splenic lymphocytes (1 x 108) with myelomacells (2 x 107) (line P3-NS1/1-Ag4-1; 8) was performed byaddition of polyethylene glycol to 50% and plating the cellsin a 24-well Costar culture plate in the presence of super-HAT (hypoxanthine-aminopterin-thymidine) medium (15).Supernatant solutions from the growing hybridomas were

screened for antibody production 10 days later by solid-phase ELISA. Positive lines were further cloned by repeatedlimiting dilutions, and hybridoma clones were used forproduction of ascitic fluids in mice.

Solid-phase ELISA. Microdilution culture plates (96 wells;Costar) were precoated with 0.1 ml of a 1-mg/ml aqueoussolution of poly-L-lysine hydrobromide (molecular weight,75,000 to 150,000) for 30 min at room temperature. Nonat-tached poly-L-lysine was removed and 0.5 pug of recombinantNef in phosphate-buffered saline (PBS) (100 ,ul) was addedinto each well and incubated for 1 h at 37°C.The plates were centrifuged at 3,000 rpm for 10 min,

excess antigen was discarded, and the wells were treatedwith 100 ,ul of PBS containing 1% skim milk for 30 min at

0.10 MTW

X 0.4 0.5 0.6C ~~~~~~~Kav

o00.04

0.0

Retention Time (min)FIG. 3. Analysis of recombinant Nef protein by fast performance

liquid chromatography gel filtration. Purified BH10 Nef (1 mg/ml)(---) and LAV1 Nef (0.5 mg/ml) (---) protein in 20 mM Tris (pH7.8)-150 mM NaCl were analyzed by chromatography through aSuperose 12 column (Pharmacia). The protein profile was generatedby continuous monitoring at 280 nM. The molecular size of Nefunder native conditions was determined from a standard curve(insert) as follows: Marker proteins, bovine serum albumin (BSA) (1mg/ml, 67 kDa) myoglobin from horse heart (2 mg/ml; 17.8-kDa and35.6-kDa dimers) were chromatographed separately through thesame column. The Ka, value of the column was determined from theformula Kav = (t, - t,,)I(t, - to), where to, equals time of voidvolume, tc equals time of column volume, and te equals retentiontime for each of the proteins on the column.

room temperature followed by 5 to 10 rinses of 0.05% Tween20 in PBS plus 0.05%o Tris (TBS). Supernatants collectedfrom hybridomas or PBS dilutions of ascitic fluids (100 ,ul)were placed into each well and incubated for 1 h at 37°C.

Biotinylated anti-mouse antibody (100 ,ul at a dilution of1:1,000 in TBS containing 15% skim milk) was added to eachwell and, after being incubated for an additional hour at37°C, was rinsed as described above.

ExtrAvidin peroxidase (100 ,uLl; BioMakor Israel) at adilution of 1:1,000 in PBS was added to the wells andincubated for 30 min at room temperature. After the plateswere washed, the substrate solution (200 ,ul) of 2,2'azido-di-(3-ethylbenzthiazoline sulfonate) (ABTS) (1 mM)-H202(0.002% [vol/vol]) in phosphate-citrate buffer (pH 4.3) wasadded to each well. After 30 min of incubation at 37°C, thereactions were stopped with 0.1 M citric acid and the A405 ofthe plates was read in an ELISA reader.CNBr digestion of recombinant Nef. Nef protein (1 mg/ml)

in PBS was adjusted to 2% CNBr-70% formic acid and wasincubated for 16 h at room temperature (25). The digest waslyophilized and suspended in PBS. Analysis of peptides wascarried out by elution from a reverse-phase high-pressureliquid chromatography (HPLC) column (PRO RPC RP8300A; Pharmacia) with a linear gradient of acetonitrile (0 to60%) in 0.1% trifluoroacetic acid and by separation onSDS-12% polyacrylamide gel.GTP binding. GTP binding assay was carried out as

described previously (9) with the following modifications:

VOL. 64, 1990

0..Nmlmk.

.ww-

wow

AP-,-.IV?

...p


the concentration of MgCI2 was reduced to 1 mM, andunlabeled ATP was added to a final concentration of 2.5 mMto suppress nonspecific binding. The assay (40 Rd) contained80 mM Tris (pH 8.0), 100 mM NaCl, 1 mM MgCl2, 0.5 mg ofbovine growth hormone (added as a protein carrier) per ml,15 pmol of [y-35S]ThioGTP (8.3 x 104 cpm/pmol), and either2 to 8 ,ug of crude bacterial lysate or samples collected duringprotein purification. Duplicate reactions were incubated for20 min at 37°C and were filtered through nitrocellulose filters(0.45-,um pore size; Schleicher & Schuell). Filters werewashed with 10 ml of 80 mM Tris (pH 8.0-100 mM NaCI-1mM MgCl2, dried, and counted.

Bacterial lysates were prepared from 10-ml cultures. Bac-terial pellets were suspended in 2 ml of 20 mM Tris (pH7.5)-0.1 mM EDTA-1 M MgCl2-0.1 mM ATP-1 mM 1B-mercaptoethanol, and 0.5 mg of fresh lysozyme was added.After incubation on ice for 30 min, phenylmethylsulfonylfluoride (1 mM) was added to the samples and the bacteriawere lysed by sonication. Debris were removed by centrif-ugation, and the protein concentration was determined bythe method of Bradford (3).GTPase activity. GTPase activity was measured by the

method of Hattori et al. (13) with minor modifications. Thereaction mixture (20 Pld) contained 80 mM Tris (pH 8.0), 5mM MgCl2, 0.5 mg of bovine growth hormone as proteincarrier, 1 FM [-y-32PIGTP (105 cpm/pmol), 2.5 mM ATP, and3-ul- samples containing 0.1 to 2 ,ug of protein. Reactions induplicates were incubated at 37°C as indicated in the text.The inorganic phosphate byproduct was determined as de-scribed previously (5). Acid-washed charcoal (Norit A) in10% trichloroacetic acid (1 ml) was added, and samples wereleft on ice for 10 min, filtered through nitrocellulose filters,and counted. Zero-time reaction mixtures, from whichMgCl2 was omitted, were used as background and weresubtracted from all subsequent time points.

Protein sequencing. The amino-terminal sequence ofrecombinant Nef was determined by Edman degradation byusing an Applied Biosystems (model 470A) gas-phase pro-tein sequencer (14), followed by HPLC to monitor thephenylthiohydantoin of the cleaved amino acid residues.

RESULTS

Expression of Nef in E. coli. Nef proteins from differentHIV isolates exhibit a high degree of amino acid heteroge-neity confined to distinct domains (21). To identify potentialbiochemical variations in different Nef proteins, two HIV-1isolates, BH10 and LAV1, were compared. The BH10 nefgene contains a premature termination codon, and the pro-tein is presumed to be inactive. The LAV1 Nef protein wasreported to possess GTP binding and GTPase activities (10).Except for the termination codon, the two Nef proteins differin seven amino acids (20, 21).Comparison of the nef gene sequence of several HIV

isolates revealed that the in-frame TAG termination codon inBH10 (nucleotides 8740 through 8742) is replaced by TGG(tryptophan) in other strains. A TGG triplet was thereforeincorporated instead of TGA in the synthetic oligomerdesigned for site-directed mutagenesis of BH10 nef. Theconstruction of nef expression vector (pD-Nef-2) and thereplacement of BH10 nefgene with the nefgene of the LAV1plasmid pBENN-16 (pD-YN-61) are illustrated in Fig. 1.The two nef plasmids were introduced into E. coli S0930

lacking deoR repressor (M. Fischer, unpublished data). Thisgenetic background supports constitutive expression ofrecombinant proteins from the combined deo promoters.

TABLE 1. Purification of recombinant LAV1 Neffrom W. coli lysatea

Nef purity Recovery ofToaNef (%) .(Nef! GTPase in recov-Purification step recovery total pro- Nef fc- ery of

(% teins) tion (% GTPase

Ammonium sulfate 80 (80 mg) 14 (80 mg/ 48.8 80576 mg)

Q-Sepharose column 52 28 21.0 100CM-Sepharose column 46.6 86 0 72

a Nef purification is described in Materials and Methods. Recovery andpurity of Nef protein were determined by photometric scan of Coomassieblue-stained SDS-polyacrylamide gels. The material was assayed for Mg+-dependent GTPase activity before being loaded onto the column, and eachfraction of the chromatography was also assayed. GTPase activity (picomolesof Pi released in 20 min by 1 p.g of protein) in each fraction was used tocompute total GTPase recovery and recovery in Nef-enriched fractions afterevery purification step.

Nef expression was analyzed by electrophoresis of bacteriallysate protein on SDS-polyacrylamide gels and photometricscans of Coomassie blue-stained gels. Recombinant Nefconstituted up to 40% of the total bacterial protein and wasconfined mainly to the soluble fraction of the bacteriallysate. The recombinant Nef proteins migrate on SDS-polyacrylamide gels faster than does the 30-kDa proteinmarker (Fig. 2). A difference in migration rates betweenBH10 Nef (lanes 2 and 4) and that of LAV1 (lanes 3 and 5) isapparent. Since the two nefgenes were sequenced and foundto be identical in length, the difference in electrophoreticmigration rates may be attributed to a variation in amino acidcomposition.

Purification of recombinant Nef proteins. The purificationof the LAV1 Nef protein is summarized in Table 1. Follow-ing chromatography on Q-Sepharose and CM-Sepharosecolumns, the preparation contained 86% Nef. We triedreplacing the CM-Sepharose with a phenyl-Sepharose col-umn, which gave better results (95% purity) in the purifica-tion of the BH10 Nef protein. However, LAV1 Nef elutedfrom phenyl-Sepharose as a broad peak with no significantimprovement in purity. Electrophoretic analysis of purifiedBH10 Nef (lane 4) and LAV1 Nef (lane 5) is presented in Fig.2. Some minor protein bands are evident; however, only28-kDa BH10 Nef and 26-kDa LAV1 Nef could be precip-itated by anti-Nef antibodies, indicating that the minorcontaminants are of bacterial origin. Chemical and physicalcharacteristics of the recombinant Nef proteins were furtheranalyzed by amino acid sequencing and fast performanceliquid chromatography gel filtration. Protein sequencing ofthe BH10 Nef amino terminus revealed the sequence NH2-Gly-Gly-Lys-Trp-Ser-Lys-Ser-Ser-Val-Val-Gly-Trp-Pro-Ala-Val. This amino acid sequence corresponds to the sequenceof the nefgene (21) and indicates efficient removal of the firstmethionine by an E. coli aminopeptidase. Fast performanceliquid chromatography on a Superose 12 column (Pharmacia)revealed that, under native conditions, the two recombinantNef proteins migrate as monomers of 23 kDa (Fig 3). Themolecular weight determined by fast performance liquidchromatography is in agreement with that computed fromthe amino acid residues (i.e., 23,442). These proteins are notmyristoylated, as was expected for expression in E. coli.

Epitope mapping of Nef by monoclonal antibodies. Nefcontains three methionine residues (positions 20, 79, and173) which are potential cleavage sites for CNBr. PurifiedBH10 Nef protein was subjected to limited CNBr digestion

J. VIROL.


AMet Met Met

NH21 COOH

1 20 79 173 207

1 Nef B

Ec

0

CD

Coi

.0

0

, , , , ,0 10 20 30 40 50

Retention Time (min.)FIG. 4. Chromatography of CNBr cleavage products of BH10

Nef. The putative CNBr cleavage sites in BH10 Nef protein are

shown (A). The three methionine residues (Met) in the molecule arenumbered relatively to the first glycine (1) in the mature protein.HPLC column chromatography was used to separate the CNBrdegradation products (B). Recombinant BH10-Nef was cleaved withCNBr as described in Materials and Methods. Cleavage productswere loaded onto a PRO RPC RP8 300A HPLC column and elutedat a flow rate of 0.7 ml/min with a linear gradient (0 to 60%) ofacetonitrile in 0.1% trifluoroacetic acid. To assign each peptide (Ithrough IV) to its location in the protein, each peak was collectedseparately and was analyzed by protein gel electrophoresis. PeptideI corresponds to amino acids 1 through 19, II to 20 through 78, III to79 through 172, and IV to 173 through 206.

and was resolved by reverse-phase HPLC column as de-scribed in Materials and Methods. Under these conditions,30% of Nef was cleaved into four peptides which migratedfaster than did the uncleaved Nef protein on an RP8 HPLCcolumn (Fig. 4). The eluted peptides were collected individ-ually and assayed for reactivity with Nef monoclonal anti-bodies. The size of each peptide, assigned by electrophoresison an SDS-polyacrylamide gel (data not shown), was inagreement with that predicted from the distribution of me-thionine residues in the protein (molecular weights for thepeptides: I, 2,090; II, 6,490; III, 10,340; and IV, 3,740).Monoclonal antibodies NFlAl, NF2B2, NF3A3, andNF8D4 were tested for their ability to react with Nef proteinand with purified Nef CNBr-peptides in solid-phase ELISA(Table 2). As expected, all monoclonal antibodies testedreacted with the intact BH10 Nef protein. NF8D4 was theonly antibody which did not react with any of the CNBrcleavage products, suggesting that the antibody is directedagainst a conformational structure in the native proteinrather than a primary sequence. Except for NF8D4, eachmonoclonal antibody reacted equally well with Nef of thetwo isolates BH10 and LAV1. NF8D4 antibody, which was

active against intact BH10 Nef, gave negative results withLAV1 Nef, further supporting its specificity in recognizing

TABLE 2. Binding of monoclonal antibodies to Nef andCNBr cleavage products

Peak Amino acid A405 Of:ano. sequence NFlA1 NF2B2 NF8D4 NF3A3

I 1-19 0.19 0.15 0.16 0.24II 20-78 0.20 0.39(+) 0.18 0.28(+)III 79-172 0.19 0.19 0.19 0.21IV 173-206 0.25 (+) 0.17 0.15 0.23

Intact BH10 Nef 0.26 (+) 2.19 (+) 2.22 (+) 0.29 (+)Intact LAV1 Nef 0.61 (+) 2.09 (+) 0.18 0.44 (+)

a Monoclonal antibody preparations and solid-phase ELISA are describedin Materials and Methods. Ascitic fluids from mice bearing the four hybridomacells were Nef positive in solid-phase ELISA at the following end-pointdilutions: NF2B2, 1:20,000; NF8D4, 1:50,000; NFlA1 and NF3A3, 1:5,000.The actual dilutions used in the above experiment were as follows: NFlA1and NF3A3, 1:200; NF2B2 and NF8D4, 1:10,000. The absorbance of theELISA plates was read in an ELISA reader at 405 nm. The analysis wasrepeated several times and values above 0.240 are significantly positive(boldface numbers).

the conformational structure of the native protein. NF2B2and NF3A3 reacted with peptides derived from the aminoterminus of Nef (Table 2), while NFlA1 reacted with apeptide derived from the carboxy terminus. No monoclonalantibody was found to react with a peptide derived from themiddle portion of Nef (amino acids 80 through 173). It shouldbe noted that NFlA1 and NF3A3 antibodies are of lowaffinity, and, therefore, ELISA values were relatively low.However, they gave significantly positive values in severalrepeated experiments.GTP binding and GTPase activity of recombinant Nef. The

biochemical activities of Nef and a well-characterized Gprotein, RASH p21, were compared with respect to theirGTP binding and GTPase activities. Total soluble proteinfrom bacterial cells expressing either Nef or RASH p21 wasassayed for GTP binding. Soluble lysates from the parentalstrain S0930 and uninduced RASH p21-169A3 cells wereincluded as controls (Fig. 5). On the basis of SDS-polyacryl-amide gel electrophoresis and scanning of the Coomassieblue-stained gels, the amounts of Nef and RASH p21 pro-teins in the soluble fractions of the bacterial lysates werefound to be 40% (BH10), 20% (LAV1), and 5% (RASH p21).Since equal amounts of lysate protein were added to the GTPbinding assays, the quantity of Nef in each sample was four-to eightfold greater than that of RASH p21. Nevertheless,only low levels of GTP binding could be detected in Nef-containing lysates (data not shown). This low binding activ-ity was completely abolished upon addition of 2.5 mM ATP(Fig. 5). In contrast, significant amounts of GTP were boundto RASH p21 and ATP had no effect upon GTP binding,indicating the specificity of RASH p21 for GTP (Fig. 5).High GTPase activity was present in all extracts, including

those from the parental bacterium S0930 and uninducedRASH p21-169A3 cells. This high endogenous GTPase activ-ity obscured any increase in RASH p21 GTPase subsequentto heat induction.GTP binding and GTPase activity were assayed at each

step of the Nef purification process (Fig. 6; Table 1). NoGTP binding was observed in Nef-enriched fractions, whichis consistent with the results obtained with crude lysates.The GTPase activity measured in bacterial lysates express-ing Nef did not copurify with the recombinant protein. TotalGTPase activity and GTPase activity associated with Nef-enriched fractions were monitored during purification. Whiletotal GTPase was recovered after each step, the activityassociated with Nef declined (Table 1). Purified Nef of either

VOL. 64, 1990


75E

(DCaCa

CD

2

1.5 -a-5E

1 cm

.5

0.5 C

Oco pD S0930 pD-Nef-2 pDYN-6169A3OO 169A3/42°FIG. 5. GTP binding and GTPase activity of crude bacterial

lysates. GTP binding (stippled bars) and Mg2"-dependent GTPaseactivity (open bars) are shown. All reaction mixtures (exceptcontrols) containing 8 jig of clarified bacterial lysates were incu-bated at 37°C for 20 min (binding assays) or 30 min (GTPase assays).Mg2+-dependent GTPase activity was calculated from duplicatesamples by substracting the activity obtained without Mg2+. Desig-nations: Control, samples without bacterial lysate; S0930, parentalE. coli strain; pD-Nef-2, S0930 cells harboring BH10 Nef expres-sion plasmid pD-Nef-2; pD-YN-61, S0930 cells harboring LAV1Nef expression plasmid pD-YN-61; 169A3/30°C, E. coli cells har-boring RASH p21 expression plasmid grown at 30°C (uninduced);169A3/42°C, E. coli harboring RASH p21 plasmid grown at 30°C upto an optical density of 0.8 and then induced for RASH p21expression (2 h at 42°C).

BH10 or LAV1 had no apparent GTP binding or GTPaseactivity.

In a previously published work (10), Nef protein ex-pressed in E. coli was sequestered in insoluble inclusionbodies and partial purification was facilitated by solubiliza-tion with SDS. To test whether SDS denaturation followedby refolding caused reactivation of Nef, purified Nef wastreated with 0.2% SDS for 30 min. SDS was removed byprecipitation with KCI (75 mM) and centrifugation in anEppendorf centrifuge. The supernatant was dialyzed exten-sively against 10 mM sodium phosphate buffer (pH 7.4) andwas assayed for GTPase activity. This treatment, however,did not result in reactivation of the recombinant Nef protein(data not shown).

DISCUSSION

The observations that some infectious isolates of HIVcontain an in-frame termination codon within the nef geneand the findings that expression of nef suppresses HIVreplication have led to the hypothesis that Nef protein is anegative regulator of HIV replication (1, 4, 18, 19, 24). Tostudy the biochemical characteristics of this protein, thecorresponding genes of two virus isolates (BH10 and LAV1)were expressed in E. coli and procedures for the purificationof recombinant Nef were developed. Amino acid sequenceanalysis of the recombinant Nef has established the aminoterminus Gly Gly Lys Trp Ser, which is identical to thepredicted sequence based on nef codons. Lack of initiatormethionine indicates efficient removal by an E. coli ami-nopeptidase. The sequence also conforms to the consensussignal for protein amino-terminal myristoylation in eucary-otic cells (26). Indeed, myristoylation of Nef has beendemonstrated by expression of the gene in mammalian cells(10).Sequence polymorphism among nef genes from indepen-

dent HIV-1 isolates was previously described (21). How-

1 0.6

E0coN 0.4

a00o< 0.2

10.66

CD

0

~ .4

0.2

'D 1 1 ,21l3 4L5 6 117 L80-j Fraction No.

laI I1. ,,2 , 3L L 4J ILjL6JLL7 L809 ~~~~~Fraction No.

0

D

x

E

.52::t0

0

co0~t-

co

0

0

g

>C

ECD

SP0

0

I9-

05Z

FIG. 6. Purification of LAV1 Nef protein by ion-exchange chro-matography. (A) Q-Sepharose column; (B) CM-Sepharose column.Columns were developed by an NaCl step gradient (broken line),and the column fraction absorbance profile at 280 nm was recorded(solid line). Mg2+-dependent GTPase activity was assayed on eachfraction (hatched bars). The Q-Sepharose column was loaded withNef fraction after ammonium sulfate precipitation (see Table 1).Samples of column fractions were analyzed by SDS-polyacrylamidegel electrophoresis, and fraction number 6 (eluted at 200 mM NaCl)was found to be enriched with Nef protein. For further purification,fraction number 6 was applied to CM-Sepharose and a peak of Nefwas eluted at 100 mM NaCl, as detected by SDS-polyacrylamide gelelectrophoresis (Fig. 2, lane 5).

ever, no experimental evidence exists documenting anystructural or functional differences among different Nefproteins. By generating a monoclonal antibody with speci-ficity to native BH10, but not to LAV1, Nef, we were able toconfirm the existence of structural differences between thetwo proteins. The availability of monoclonal antibodiesagainst structural and conformational epitopes enables fur-ther exploration of Nef cellular compartmentalization andmay shed light on its possible site of action.

Close examination of nef open reading frames in bothBH10 and LAV1 virus isolates reveals certain homologieswith the GTP binding domain of G proteins (6). In Gproteins, the GTP binding sequence is composed of thefollowing three elements: (i) Gly X X X X Gly Lys, (ii) AspX X Gly, and (iii) Asn Lys X Asp, with a consensus spacingof 40 to 80 amino acids between the first and second andbetween the second and third sequence elements. The firstconsensus element in Nef is Gly Phe Cys Tyr Lys Met GlyGly Lys, located at amino acids -5 to +4 with respect to theinitiator Met at position +1 (22). This sequence, however,contains nine amino acids, including the initiator Met atposition +1, rather than the standard seven amino acids. To

J. VIROL.


include this putative element in the protein, translation oughtto initiate upstream of Met at position +1. However, noATG start codon is present within the 30 nucleotides (8344 to8374; 20) upstream of the open reading frame. In addition, asthe only myristoylation consensus signal in the nef openreading frame is adjacent to Met at position + 1, it is the mostlikely initiation site for neftranslation. The second and thirdputative GTP binding elements are located at positions 28through 31, Asp Gly Val Gly, and positions 157 through 160,Asn Lys Gly Glu. The latter sequence deviates from theconsensus element Asn-Lys-X-Asp, which is conserved inmost known G proteins. Thus, Nef sequences which exhibitsome similarity to other G proteins do not conform well tothe standard arrangement of GTP binding domain.To analyze the recombinant Nef for G-protein activities,

Nef was compared with a well-characterized G protein,RASH p21. No increase in GTP binding was observed inbacteria expressing recombinant Nef. Furthermore, GTPaseactivity present in the crude bacterial extracts did notcopurify with recombinant Nef. In contrast, extracts ofbacteria expressing recombinant RASH p21 exhibited a10-fold increase in GTP-binding activity. This was observedin spite of the lower expression levels of RASH p21 relativeto Nef.

In a previous work, the nef gene of a LAV1 virus isolatewas expressed in E. coli and the recombinant protein wasfound sequestered in insoluble inclusion bodies (10). Tofacilitate partial purification of the recombinant protein, itwas solubilized in SDS. Following removal of the detergent,GTP binding and GTPase activity were detected in thesoluble fraction (10). Although the recombinant Nef de-scribed in this work was soluble and in monomeric form,similar reactivation attempts failed to result in active pro-tein; no apparent GTP binding or GTPase activity wasassociated with the purified Nef after such treatment.

Several possibilities may account for the differences be-tween the data presented in this work and those described byothers (10): (i) bacterial protein impurities present in apartially purified recombinant Nef preparation; (ii) differentmodes of expression in E. coli which resulted in a solublemonomeric Nef in our studies and in an insoluble protein inthe work of Guy et. al. (10), which potentially affect theGTPase and GTP binding activities; (iii) different Nef amino-terminal sequence in the recombinant Nef protein, resultingfrom initiation at a putative start codon other than theauthentic AUG (position 8374); and (iv) different nucleotidesequences in the cloned nefgene in the two studies, resultingin different amino acid sequences.

In summary, the biochemical function of Nef, specificallyregarding its G-protein-like functions, needs to be reevalu-ated in light of this work. Further, the availability of recom-binant Nef protein and immunological reagents may facili-tate resolution of the controversial role of Nef in HIVreplication (12, 16).

ACKNOWLEDGMENTS

We thank M. Tabachnik for assistance in the DNA sequencing ofall of the nef clones, M. Azmon for the fermentation of Nef-expressing bacteria, and L. Nir for typing the manuscript.

This work was supported by Public Health Service contractNO1-AI-82696 of the National Institute of Allergy and InfectiousDiseases.

LITERATURE CITED1. Ahmad, N., and S. Venkatesan. 1988. Nef protein of HIV-1 is a

transcriptional repressor of HIV-1 LTR. Science 241:1481-1485.

2. Allan, J. S., J. E. Coligan, T. H. Lee, M. F. McLane, P. J.Kanki, J. E. Groopman, and M. Essex. 1985. A new HTLV-III/LAV encoded antigen detected by antibodies from AIDSpatients. Science 230:810-813.

3. Bradford, M. M. 1976. A rapid and sensitive method for thequantitation of microgram quantities of protein utilizing theprinciple of protein-dye binding. Anal. Biochem. 72:248-254.

4. Cheng-Mayer, C., P. lannello, K. Shaw, P. A. Luciw, and J. A.Levy. 1989. Differential effects of Nef on HIV replication:implications for viral pathogenesis in the host. Science 246:1629-1632.

5. DePierre, J. W., and M. L. Karnovsky. 1974. Ecto-enzymes ofthe guinea pig polymorphonuclear leukocyte. J. Biol. Chem.249:7111-7120.

6. Dever, T. E., M. J. Glynias, and W. C. Merrick. 1987. GTP-binding domain: three consensus sequence elements with dis-tinct spacing. Proc. Natl. Acad. Sci. USA 84:1814-1818.

7. Folks, T., S. Benn, A. Rabson, T. Theodore, M. D. Hoggan, M.Martin, M. Lightfoote, and K. Sell. 1985. characterization of acontinuous T-cell line susceptible to the cytopathic effects of theacquired immunodeficiency syndrome (AIDS)-associated retro-virus. Proc. Natl. Acad. Sci. USA 82:4539-4543.

8. Galfre, G., S. C. Howe, C. Milstein, G. W. Butcher, and J. C.Howard. 1977. Antibodies to major histocompatibility antigensproduced by hybrid cell lines. Nature (London) 266:550-552.

9. Gibbs, J. B., I. S. Sigal, M. Poe, and E. M. Scolnick. 1984.Intrinsic GTPase activity distinguishes normal and oncogenicras p21 molecules. Proc. Natl. Acad. Sci. USA 81:5704-5708.

10. Guy, B., M. P. Kieny, Y. Riviere, C. Le Peuch, K. Dott, M.Girard, L. Montagnier, and J. P. Lecocq. 1987. HIV F/3' orfencodes a phosphorylated GTP-binding protein resembling anoncogene product. Nature (London) 330:266-269.

11. Hammer-Jesperson, K. 1983. Nucleoside catabolism, p. 203-208. In A. Much-Petersen (ed.), Metabolism of nucleotides,nucleosides and nucleobases in microorganisms. AcademicPress, Inc. (London), Ltd., London.

12. Hammes, S. R., E. P. Dixon, M. H. Malim, B. R. Cullen, andW. C. Greene. 1989. Nef protein of human immunodeficiencyvirus type 1: evidence against its role as a transcriptionalinhibitor. Proc. Natl. Acad. Sci. USA 86:9549-9553.

13. Hattori, S., L. S. Ulsh, K. Halliday, and T. Y. Shih. 1985.Biochemical properties of a highly purified v-rasH p21 proteinoverproduced in Escherichia coli and inhibition of its activitiesby a monoclonal antibody. Mol. Cell. Biol. 5:1449-1455.

14. Hunkapiller, M. 1985. PTH amino acid analysis. Appl. Biosys-tems User Bull. 14:1-27.

15. Kennett, R. H., K. H. Davis, A. S. Tung, and N. R. Klinman.1978. Hybrid plasmacytoma production: fusion with adultspleen cells, monoclonal spleen fragment, neonatal spleen cells,and human spleen cells. Curr. Top. Microbiol. Immunol. 81:77-91.

16. Kim, S., K. Ikeuchi, R. Byrn, J. Groopman, and D. Baltimore.1989. Lack of a negative influence on viral growth by the nefgene of human immunodeficiency virus type 1. Proc. Natl.Acad. Sci. USA 86:9544-9548.

17. Lacal, J. C., E. Santos, V. Notario, M. Barbacid, S. Yamazaki,H.-F. Kung, C. Seamans, S. McAndrew, and R. Crowl. 1984.Expression of normal and transforming H-ras genes in Esche-richia coli and purification of their encoded p21 proteins. Proc.Natl. Acad. Sci. USA 81:5305-5309.

18. Luciw, P. A., C. Cheng-Mayer, and J. A. Levy. 1987. Mutationalanalysis of the human immunodeficiency virus: the orf-B regiondown-regulates virus replication. Proc. Natl. Acad. Sci. USA84:1434-1438.

19. Niederman, T. M. J., B. J. Thielan, and L. Ratner. 1989. Humanimmunodeficiency virus type 1 negative factor is a transcrip-tional silencer. Proc. Natl. Acad. Sci. USA 86:1128-1132.

20. Ratner, L., W. Haseltine, R. Patarca, K. J. Livak, B. Starcich,S. F. Josephs, E. R. Doran, J. A. Rafalski, E. A. Whitehorn, K.Baumeister, L. Ivanoff, S. R. Petteway, Jr., M. L. Pearson, J. A.Lautenberger, T. S. Papas, J. Ghrayeb, N. T. Chang, R. C.Gallo, and F. Wong-Staal. 1985. Complete nucleotide sequenceof the AIDS virus, HTLV-III. Nature (London) 313:277-284.

VOL. 64, 1990


21. Ratner, L., B. Starcich, S. F. Josephs, B. H. Hahn, E. P. Reddy,K. J. Livak, S. R. Petteway, Jr., M. L. Pearson, W. A. Haseltine,S. K. Arya, and F. Wong-Staal. 1985. Polymorphism of the 3'open reading frame of the virus associated with the acquiredimmune deficiency syndrome, human T-lymphotropic virustype III. Nucleic Acids Res. 13:8219-8229.

22. Samuel, K. P., A. Seth, A. Konopka, J. A. Lautenberger, andT. S. Papas. 1987. The 3'-orf protein of human immuno-deficiency virus shows structural homology with the phos-phorylation domain of human interleukin-2 receptor and theATP-binding site of the protein kinase family. FEBS Lett.218:81-86.

23. Sodroski, J., W. C. Goh, C. Rosen, A. Tartar, D. Portetelle, A.Burny, and W. Haseltine. 1986. Replication and cytopathicpotential of HTLV-III/LAV with sor gene deletions. Science231:1549-1553.

24. Terwilliger, E., J. G. Sodroski, C. A. Rosen, and W. A. Hasel-tine. 1986. Effects of mutations with the 3' orf open readingframe region of human T-cell lymphotropic virus type III(HTLV-III/LAV) on replication and cytopathogenicity. J. Virol.60:754-760.

25. Tisdale, M., P. Ertl, B. A. Larder, D. J. M. Purifoy, G. Darby,and K. L. Powell. 1988. Characterization of human immunode-ficiency virus type 1 reverse transcriptase by using monoclonalantibodies: role of the C terminus in antibody reactivity andenzyme function. J. Virol. 62:3662-3667.

26. Towler, D. A., S. P. Adams, S. R. Eubanks, D. S. Towery, E.Jackson-Machelski, L. Glaser, and J. I. Gordon. 1988. MyristoylCoA: protein N-myristoyltransferase activities from rat liverand yeast possess overlapping yet distinct peptide substratespecificities. J. Biol. Chem. 263:1784-1790.

J. VIROL.

expression and biochemical characterization of human

Documents