erytro journal

7/28/2019 Erytro Journal

1/6

Subject Category: Genetics

Journal of Investigative Dermatology(2008) 128, 16481652; doi:10.1038/sj.jid.5701257; published online 24 January 2008

Mild Recessive Bullous Congenital Ichthyosiform Erythroderma due to a

Previously Unidentified Homozygous Keratin 10 Nonsense Mutation

Akiko Tsubota1, Masashi Akiyama

1, Jean Kanitakis

2, Kaori Sakai

1, Toshifumi Nomura

1, Alain Claudy

2and

Hiroshi Shimizu1

Abstract

We have identified a previously unreported homozygous nonsense mutation p.Cys427X in thekeratin 10 (K10) gene (KRT10) in a Turkish girl with recessive bullous congenital

ichthyosiform erythroderma (BCIE) showing superficial blistering. p.Cys427X is locatedupstream of the previously reported homozygous truncation mutation within the same exon 6causing mRNA decay. Immunohistochemical examination showed a complete absence of K10protein in the patient's epidermis. The findings of this study suggest that K10 knockout

patients show unique clinicopathological features of clinically mild BCIE with blistersoccurring within the granular layer. In addition, the unaffected, heterozygous carriers of themutation indicate that the K10 peptide from one normal allele alone is sufficient for keratinnetwork formation.

Abbreviations:

BCIE, bullous congenital ichthyosiform erythroderma; EHK, epidermolytic hyperkeratosis; K, keratin; MASA, mutant allele-specificamplification; NMD, nonsense-mediated messenger RNA decay

Introduction

Most families affected by inherited keratindiseases present autosomal-dominant

transmission, although a small number of

keratin knockout families showing recessiveinheritance have been reported. In recessiveepidermolysis bullosa simplex, keratin 14 (K14)knockout families presented a very severephenotype (Chan et al., 1994;Jonkman et al.,

1996). We report here a K10 knockout Turkishgirl harboring a previously unidentified

homozygous truncation mutation of the K10

gene (KRT10), whose phenotype was mildbullous congenital ichthyosiform erythroderma(BCIE) with granular degeneration and blisterformation restricted to the granular layer of theepidermis.

Topof page

Results

Unique clinical features of mild BCIE

The proband, a 3-year-old Turkish girl, was thefourth child born to unaffected, healthy parentswho were first cousins (their fathers were

brothers). The patient had two elder sisters andone elder brother, who were unaffected. Therewas no known family history of skin diseases.The patient was born with widespread, diffuse

skin blistering and erosive lesions (Figure 1aand b). At the age of 3 years, she was still

developing skin erosions at the sites of trauma(mainly on the face and trunk) and hadbrownish, hyperkeratotic lesions over her chest,

arms, back, and knees (Figure 1c and d). Shealso developed scaly, keratotic lesions on herscalp. Palmoplantar areas were not affected.Nails, hair, and teeth were normal. Physical and

mental growth was normal

.
http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#aff1http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#aff1http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#aff1http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#aff1http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#aff1http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#aff2http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#aff2http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#aff2http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#aff1http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#aff1http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#aff1http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#aff1http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#aff1http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#aff1http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#aff2http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#aff2http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#aff2http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#aff1http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#aff1http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib1http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib1http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib1http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib1http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib1http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib4http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib4http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib4http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib4http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib4http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib4http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#tophttp://www.nature.com/jid/journal/v128/n7/full/5701257a.html#tophttp://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig1http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig1http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig1http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig1http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig1http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig1http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig1http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig1http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig1http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig1http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#tophttp://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib4http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib4http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib1http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#aff1http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#aff2http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#aff1http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#aff1http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#aff2http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#aff1http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#aff1


2/6

Figure 1.

The patient's clinical features. (a and b) Clinical features at birth. (a) The patient showed generalized erythroderma and blisters. (b)

Superficial erosions were seen on the neck and chest. (c andd) At the age of 3 years, the patient had verrucous, hyperkeratotic plaques,

from light to dark brown in color, and superficial erosions on the chest, abdomen (c) and the back (d). (d, inset) A superficial denudedarea in the hyperkeratotic skin (maserung phenomenon)-like erosion on the back.

Full figure and legend (201K)

Granular degeneration and keratin clumps are restricted to the granular layer

A skin biopsy obtained, soon after birth, from abullous lesion of the trunk revealedorthohyperkeratosis and granular degeneration

with acantholysis restricted to the granular layer(Figure 2a). By electron microscopy, the keratinfilament network was disrupted only in theuppermost keratinocytes of the spinous layer

and the granular layer. Perinuclear shells ofclumped keratin filaments, as often observed inautosomal-dominant BCIE patients, were

absent. Irregularly shaped keratin clumps andcytolysis were seen in the uppermost spinousand granular layers (Figure 2b).

Figure 2.

Granular degeneration, clumped keratin filaments, and keratin expression patterns in the patient's epidermis. (a)Hyperkeratosis and granular degeneration with large keratohyalin granules were noted in the uppermost spinous and the granular layersof the patient's epidermis. Bar=50m. (b) Electron microscopic examination of the superficial epidermal keratinocytes revealed a largenumber of keratin filament clumps (arrows) only in the uppermost spinous and granular layer cells. Inset: high-power view of a keratinclump. Bars=2.5m (inset, 0.6m). (c) Immunohistochemically, no staining is observed with an anti-K10 antibody, suggesting absenceof K10 in the patient's epidermis. Bar=50m. (d) K5/K6 brown labeling is observed in the whole epidermis of the patient's skin, with amaximal intensity in the basal cell layer. Bar=50 m.Full figure and legend (203K)

A homozygous truncation mutation in KRT10 is identified in the patient

We therefore sequenced KRT10 and found apreviously unidentified homozygous two base-

pair exchange (CC to AA) at base pair position1281_1282 in exon 6ofKRT10 (c.1281_1282CC>AA) in the patient

(Figure 3a). This exchange resulted in asubstitution of a cysteine residue (TGC) by astop codon (TGA) at codon 427 (p.Cys427X) 34

amino acids before the end of the 2B domain ofK10 (Figure 4). No other pathogenic mutationswere detected within the helix initiation and

termination motifs of K1, K10, K2, or the linkerdomain (L12) of K10 in the patient's DNA. Both

parents were heterozygous carriers of the samedinucleotide substitution mutation (Figure 3a).

This mutation was not found in 100 normalunrelated alleles (50 individuals) by directsequence analysis and was unlikely to be a

polymorphism. By mutant allele-specificamplification (MASA) analysis (Hasegawa et al.,1995;Xu et al., 2003), a 197bp fragmentderived from the mutant allele was amplifiedfrom the patient's genomic DNA (Figure 3b).The 197bp fragment was sequenced and it wasconfirmed that this fragment was derived fromthe targeted region ofKRT10. MASA showed no
http://www.nature.com/jid/journal/v128/n7/fig_tab/5701257f1.html#figure-titlehttp://www.nature.com/jid/journal/v128/n7/fig_tab/5701257f1.html#figure-titlehttp://www.nature.com/jid/journal/v128/n7/fig_tab/5701257f1.html#figure-titlehttp://www.nature.com/jid/journal/v128/n7/fig_tab/5701257f1.html#figure-titlehttp://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig2http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig2http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig2http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig2http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig2http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig2http://www.nature.com/jid/journal/v128/n7/fig_tab/5701257f2.html#figure-titlehttp://www.nature.com/jid/journal/v128/n7/fig_tab/5701257f2.html#figure-titlehttp://www.nature.com/jid/journal/v128/n7/fig_tab/5701257f2.html#figure-titlehttp://www.nature.com/jid/journal/v128/n7/fig_tab/5701257f2.html#figure-titlehttp://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig3http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig3http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig3http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig4http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig4http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig4http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig3http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig3http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig3http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib3http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib3http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib3http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib3http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib3http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib3http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib13http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib13http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib13http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib13http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib13http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig3http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig3http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig3http://www.nature.com/jid/journal/v128/n7/fig_tab/5701257f2.htmlhttp://www.nature.com/jid/journal/v128/n7/fig_tab/5701257f1.htmlhttp://www.nature.com/jid/journal/v128/n7/fig_tab/5701257f2.htmlhttp://www.nature.com/jid/journal/v128/n7/fig_tab/5701257f1.htmlhttp://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig3http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib13http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib3http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib3http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig3http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig4http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig3http://www.nature.com/jid/journal/v128/n7/fig_tab/5701257f2.html#figure-titlehttp://www.nature.com/jid/journal/v128/n7/fig_tab/5701257f2.html#figure-titlehttp://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig2http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig2http://www.nature.com/jid/journal/v128/n7/fig_tab/5701257f1.html#figure-titlehttp://www.nature.com/jid/journal/v128/n7/fig_tab/5701257f1.html#figure-title


3/6

PCR product band from control DNA samples (Figure 3b).

Figure 3.

A homozygous dinucleotide substitution mutation c.1281_1282CC>AA in KRT10 was detected in the patient. (a) Direct

sequencing ofKRT10 exon 6 PCR products revealed that the patient was a homozygote for the dinucleotide substitution mutation

c.1281_1282CC>AA, whereas both her parents were heterozygous for the same mutation. (b) Mutant allele-specific amplification (MASA)analysis. With normal allele-specific primers, no amplification band was seen in the PCR product from the patient's DNA samples,

suggesting that she had no normal allele. With mutant allele-specific primers, the amplification band from the mutant alleles wasdetected as a 197bp fragment only in the PCR product from the DNA sample from the patient, but not in the PCR product from controlDNA samples, confirming the presence of the mutation c.1281_1282CC>AA in the patient.


Figure 4.

The truncation mutation sites of K10 in the recessive form of BCIE. The nonsense mutation detected in the present family is

marked with red characters. The other, previously reported nonsense mutation in exon 6 lead to mRNA decay (Mller et al., 2006). By

the present mutation, the downstream domain (from the dotted line) was not translated, probably resulting in mRNA decay, because the

present mutation was upstream of the previous mutation in the same exon 6 (Lejeune and Maquat, 2005). Red areas: helix initiation ortermination motif.


K10 protein is absent in the patient's epidermis

Immunohistochemically, three antibodies

recognizing K10 (KL1, RKSE60, and PRB-159P)failed to label the patient's epidermis (Figure2c), whereas on normal control human skin, allthese antibodies labeled suprabasalkeratinocytes. An antibody to K1, K5, K10, and

K14 labeled all epidermal layers of the patient's

skin but in a more or less patchy pattern,weaker than that obtained on control normalskin. An anti-K5/6 antibody labeled allepidermal layers, with a maximal intensity atthe level of basal keratinocytes (Figure 2d).

Topof page

Discussion

Bullous congenital ichthyosiform erythrodermais considered to be a dominantly inheriteddisorder caused by K1 or K10 mutations.

Generally, in keratin diseases, keratin missensemutations lead to mutant keratin polypeptidesand disturbed keratin filament network in a

dominant-negative manner and formation of

keratin filament clumps within the cytoplasm(Smith, 2003;Lane and McLean, 2004).

In this study, we report a girl with a recessiveform of BCIE due to a previously unidentified

nonsense mutation p.Cys427X in KRT10. To ourknowledge, only one family with a recessiveform of BCIE has been previously reported(Mller et al., 2006). In that family, the affectedindividuals were homozygous for the nonsense

mutation p.Gln434X in the 2B domain of K10,whereas the unaffected parents wereheterozygous carriers of the mutation (Mller et

al., 2006). On the basis of the position of thepremature stop codon, the truncated K10polypeptide lacked 27 amino acids in the 2B

domain in the family (Mller et al., 2006). Inthe family reported here, the nonsensemutation, the second nonsense mutation

reported in a human suprabasal keratin, was

upstream of the previously reported nonsensemutation and was predicted to cause the loss of34 C-terminal amino acids of the 2B domain

including the entire helix termination motif(Figure 4). In the previously reported family,the truncation mutation led to nonsense-mediated messenger RNA decay (NMD) and theexistence of a truncated K10 gene product wasexcluded (Mller et al., 2006). NMD is linked to

a splicing-dependent deposition of an exon-junction complex close to each exonexon

junction. An exon-junction complex is essentialfor anchoring the NMD-specific factors upf2 andupf3 to the targeted mRNA. During the process
http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig3http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig3http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig3http://www.nature.com/jid/journal/v128/n7/fig_tab/5701257f3.html#figure-titlehttp://www.nature.com/jid/journal/v128/n7/fig_tab/5701257f3.html#figure-titlehttp://www.nature.com/jid/journal/v128/n7/fig_tab/5701257f3.html#figure-titlehttp://www.nature.com/jid/journal/v128/n7/fig_tab/5701257f3.html#figure-titlehttp://www.nature.com/jid/journal/v128/n7/fig_tab/5701257f4.html#figure-titlehttp://www.nature.com/jid/journal/v128/n7/fig_tab/5701257f4.html#figure-titlehttp://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib6http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib6http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib6http://www.nature.com/jid/journal/v128/n7/fig_tab/5701257f4.html#figure-titlehttp://www.nature.com/jid/journal/v128/n7/fig_tab/5701257f4.html#figure-titlehttp://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig2http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig2http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig2http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig2http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig2http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig2http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig2http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#tophttp://www.nature.com/jid/journal/v128/n7/full/5701257a.html#tophttp://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib12http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib12http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib12http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib5http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib5http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib5http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig4http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig4http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig4http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/fig_tab/5701257f4.htmlhttp://www.nature.com/jid/journal/v128/n7/fig_tab/5701257f3.htmlhttp://www.nature.com/jid/journal/v128/n7/fig_tab/5701257f4.htmlhttp://www.nature.com/jid/journal/v128/n7/fig_tab/5701257f3.htmlhttp://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig4http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib5http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib12http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#tophttp://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig2http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig2http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig2http://www.nature.com/jid/journal/v128/n7/fig_tab/5701257f4.html#figure-titlehttp://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib6http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/fig_tab/5701257f4.html#figure-titlehttp://www.nature.com/jid/journal/v128/n7/fig_tab/5701257f3.html#figure-titlehttp://www.nature.com/jid/journal/v128/n7/fig_tab/5701257f3.html#figure-titlehttp://www.nature.com/jid/journal/v128/n7/full/5701257a.html#fig3


4/6

of ribosomal translation, exon-junction

complexes are displaced from the open-readingframe and NMD is prevented. In case the mRNA

has a premature termination codon locatedmore than a certain range upstream of at leastone exon-junction complex, the exon-junctioncomplex downstream of the premature

termination codon is not removed from themRNA, triggering NMD (Lejeune and Maquat,

2005;Mller et al., 2006). The distance frompremature termination sites to the downstream3-most exonexon junction required fortriggering NMD seems to vary depending on the

gene. All nonsense mutations reported inautosomal-dominant epidermolysis bullosa

simplex to date are located less than 92nucleotides upstream of the 3-most exonexon

junction. In contrast, in p.Gln434X in K10 andp.Gln396X in K14 reported in families withrecessive inheritance, the distance from the 3-

most exonexon junctions are 476 nucleotides

and 274 nucleotides, respectively. From thesedata, in keratin genes, premature terminationcodons located more than 92 nucleotides

upstream to the 3-most exonexon junction are

expected to be targeted by NMD (Mller et al.,2006). In this context, the present nonsensemutation p.Cys427X located 497 nucleotidesupstream to the 3-most exonexon junction isthought to be targeted by NMD in the present

patient, as was the case of the patients reportedbyMller et al. (2006).

Both in the previously reported family (Mller etal., 2006) and the present one with recessiveforms of BCIE, the heterozygous familymembers were clinically unaffected. This fact

clearly suggests that the K10 peptide derived

from the normal allele was sufficient for normalkeratin network formation in the heterozygouscarriers. This implies that knockout or silencingof the mutant K10 allele might theoretically beuseful as a form of gene therapy in dominant

BCIE caused by K10 mutations.

Interestingly, our patient showed granular

degeneration restricted to the granular layer,leading to superficial blistering, and mild BCIE

phenotype. In the recessive forms of BCIE, K16and K17 are compensatively expressed,especially in the superficial epidermis, and arethought to form unstable or less stable

heterodimers with K1 resulting in keratin clumpsin the superficial epidermis (Mller et al., 2006).

In our patient, we found immunohistochemicallabeling of suprabasal epidermal layers byantibodies to K5/6/14, suggesting compensatoryexpression of one or more of these keratins by

suprabasal keratinocytes.

Additional supportive data on animals were

reported. K10 gene knockout and K10 null miceare known to show a very mild phenotype(Reichelt et al., 2001). In the knockout mouseepidermis, the basal keratins K5, K14, and K15

seem to be stabilized in the suprabasal layers,

and it is hypothesized that the lack of K10 iscompensated by the residual basal keratins K5and K14 in suprabasal epidermal layers in K10knockout mouse model (Reichelt et al.,2001;Mller et al., 2006). Keratin aggregates

were shown to consist of residual K1 and K14 inthe model mouse (Reichelt et al., 2001). Thus,an intact epidermis showing no fragility orcytolysis was seen in the K10 knockout mice(Reichelt et al., 2001;Reichelt and Magin,2002). In the previously reported K10 knockout

human patients, persistence of K14 expressionin suprabasal layers was also detected, althoughbasal keratins were not able to compensatecompletely for the loss of K10 in human K10knockout patients (Mller et al., 2006). In an

pedigree of Norfolk terrier dogs with autosomal-

recessive epidermolytic ichthyosis harboring acanineKRT10 splice-site mutation, homozygoteswere reported to show mild phenotype andheterozygotes were not affected (Credille et al.,2005). K10 was absent in the homozygous

dogs, and pathomechanisms similar to those ofhuman K10 knockout patients are speculated inthese K10 knockout dogs.

Topof page

Materials and Methods

Mutation detection

For mutational analysis, genomic DNA wasisolated from peripheral blood leukocytes of thepatient and her parents. DNA was extractedwith phenolchloroform, precipitated with

ethanol, and re-suspended in TE solution(10mMTris-HCl, pH 7.4, 1mM EDTA). DNAencoding the N-terminal region of the 1Adomain, which includes the helix initiation motif,and the C-terminal region of the 2B domain,

which includes the helix termination motif, wereamplified for the K1, K10, and K2 genes

(KRT1, KRT10, and KRT2) (GenBank accessionnos.NT029419,NT010755, andNP000414).DNA encoding the linker domain L12 of K10 wasalso amplified. Specifically, exon 6, which

encodes the 2B region of K10, was amplifiedusing the specific oligonucleotide primers:

sense, 5-agcgtcaccatactcaactgagc-3 and anti-sense, 5-tggcatcttcttggggttta-3. PCR productswere subjected to an ABI 310 automated

sequencer (Perkin Elmer-ABI, Foster City, CA)for nucleotide sequencing

.
http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib6http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib6http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib6http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib6http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib9http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib9http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib9http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib9http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib9http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib9http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib9http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib9http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib9http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib9http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib9http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib9http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib9http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib9http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib9http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib9http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib9http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib9http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib9http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib9http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib9http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib10http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib10http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib10http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib10http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib2http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib2http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib2http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib2http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib2http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib2http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#tophttp://www.nature.com/jid/journal/v128/n7/full/5701257a.html#tophttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=Nucleotide&cmd=Search&term=NT029419http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=Nucleotide&cmd=Search&term=NT029419http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=Nucleotide&cmd=Search&term=NT010755http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=Nucleotide&cmd=Search&term=NT010755http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=Nucleotide&cmd=Search&term=NT010755http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=Nucleotide&cmd=Search&term=NP000414http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=Nucleotide&cmd=Search&term=NP000414http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=Nucleotide&cmd=Search&term=NP000414http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=Nucleotide&cmd=Search&term=NP000414http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=Nucleotide&cmd=Search&term=NT010755http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=Nucleotide&cmd=Search&term=NT029419http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#tophttp://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib2http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib2http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib10http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib10http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib9http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib9http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib9http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib9http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib9http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib8http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib6http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib6


5/6

Mutant allele-specific amplification analysis

For the verification of the mutation, using PCR

products as a template, MASA analysis wasperformed with mutant allele-specific primerscarrying the substitution of two bases at the 3-

end (Linard et al., 2002;Sapio et al., 2006)mutant allele-specific primers: forward,tcgagctgaaaccgagtgaa; reverse,tggcatcttcttggggttta; normal allele-specific

primers: forward, tcgagctgaaaccgagtgcc;

reverse, tggcatcttcttggggttta. PCR conditionswere as follows: 94C for 5minutes after (hot-start procedure) and then 94C for 1minute,56C for 1minute, 72C for 1minute during 35cycles, followed by 72C for 7minutes.

Ultrastructural observation

Skin biopsy samples were fixed in2% glutaraldehyde solution, post-fixed in

1%OsO4, dehydrated, and embedded in Epon812. The samples were sectioned at 1 mthickness for light microscopy and thin-sectioned for electron microscopy (70nm thick).The thin sections were stained with uranylacetate and lead citrate, and examined under atransmission electron microscope.

The medical ethical committee at HokkaidoUniversity Graduate School of Medicine and Ed.Herriot Hospital approved all studies. The study

was conducted according to the Declaration ofHelsinki Principles. Participants or their legal

guardians gave their written informed consent.

Immunohistochemical staining

Immunohistochemical examination wasperformed on formalin-fixed, paraffin-embedded

skin sections after deparaffinization andrehydration, with a Ventana ES automated AECimmunohistochemistry system (Ventana Medical

Systems, Tucson, AZ) using the following

antibodies: (a) KL1, mouse mAb recognizing K1and K10 (Immunotech, Marseille, France); (b)RKSE60, mouse mAb recognizing K10(Monosan, Uden, The Netherlands); (c) PRB-159P, purified rabbit polyclonal antibodyrecognizing K10 (Covance, Berkeley, CA); (d),

mouse mAb recognizing K1, K5, K10, and K1434bE12 (Dako, Copenhagen, Denmark); and (e)D5/16B4, mouse mAb recognizing K5 and K6(Dako).Topof page

Conflict of Interest

The authors state no conflict of interest.

Topof page

References

1. Chan Y, Anton-Lamprecht I, Yu QC, Jackel A, Zabel B, Ernst JP et al. (1994) A human keratin 14"knockout": the absence of K14 leads to severe epidermolysis bullosa simplex and a function foran intermediate filament protein. Genes Dev8:25742587 |Article|PubMed|ISI|ChemPort|

2. Credille KM, Barnhart KF, Minor JS, Dunstan RW (2005) Mild recessive epidermolytichyperkeratosis associated with a novel keratin 10 donor splice-site mutation in a family ofNorfolk terrier dogs. Br J Dermatol153:5158 |Article|PubMed|ChemPort|

3. Hasegawa Y, Takeda S, Ichii S, Koizumi K, Maruyama M, Fujii A et al. (1995) Deletion of K-rasmutations in DNAs isolated from faces of patients with colorectal tumors by mutant-allele-

specific-amplification (MASA). Oncogene10:14411445 |PubMed|ISI|ChemPort|

4. Jonkman MF, Heeres K, Pas HH, van Luyn MJ, Elema JD, Corden JD et al. (1996) Effects ofkeratin 14 ablation on the clinical and cellular phenotype in a kindred with recessive

epidermolysis bullosa simplex.J Invest Dermatol107:764769 |Article|PubMed|ISI|ChemPort|

5. Lane EB, McLean WHI (2004) Keratins and skin disorders.J Pathol204:355366 |Article|PubMed|ISI|ChemPort|

6. Lejeune F, Maquat LE (2005) Mechanistic links between nonsense-mediated mRNA decay andpre-mRNA splicing in mammalian cells. Curr Opin Cell Biol17:309315 |Article|PubMed|ISI|ChemPort|

7. Linard B, Bezieau S, Benlalam H, Labarrire N, Guilloux Y, Diez E et al. (2002) A ras-mutatedpeptide targeted by CTL infiltrating a human melanoma lesion.J Immunol168:4802

4808 |PubMed|ISI|ChemPort|
http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib7http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib7http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib7http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib7http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib7http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib11http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib11http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib11http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib11http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib11http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#tophttp://www.nature.com/jid/journal/v128/n7/full/5701257a.html#tophttp://www.nature.com/jid/journal/v128/n7/full/5701257a.html#tophttp://www.nature.com/jid/journal/v128/n7/full/5701257a.html#tophttp://dx.doi.org/10.1101/gad.8.21.2574http://dx.doi.org/10.1101/gad.8.21.2574http://dx.doi.org/10.1101/gad.8.21.2574http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=7525408&dopt=Abstracthttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=7525408&dopt=Abstracthttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=7525408&dopt=Abstracthttp://links.isiglobalnet2.com/gateway/Gateway.cgi?&GWVersion=2&SrcAuth=Nature&SrcApp=Nature&DestLinkType=FullRecord&KeyUT=A1994PR22000006&DestApp=WOS_CPLhttp://links.isiglobalnet2.com/gateway/Gateway.cgi?&GWVersion=2&SrcAuth=Nature&SrcApp=Nature&DestLinkType=FullRecord&KeyUT=A1994PR22000006&DestApp=WOS_CPLhttp://links.isiglobalnet2.com/gateway/Gateway.cgi?&GWVersion=2&SrcAuth=Nature&SrcApp=Nature&DestLinkType=FullRecord&KeyUT=A1994PR22000006&DestApp=WOS_CPLhttp://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DyaK2MXitVygsLc%3D&pissn=0022-202X&pyear=2008&md5=db07ac2fdfd1ac3c8c36827ec5807342http://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DyaK2MXitVygsLc%3D&pissn=0022-202X&pyear=2008&md5=db07ac2fdfd1ac3c8c36827ec5807342http://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DyaK2MXitVygsLc%3D&pissn=0022-202X&pyear=2008&md5=db07ac2fdfd1ac3c8c36827ec5807342http://dx.doi.org/10.1111/j.1365-2133.2005.06735.xhttp://dx.doi.org/10.1111/j.1365-2133.2005.06735.xhttp://dx.doi.org/10.1111/j.1365-2133.2005.06735.xhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=16029326&dopt=Abstracthttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=16029326&dopt=Abstracthttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=16029326&dopt=Abstracthttp://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DC%2BD2MXps1Kntro%3D&pissn=0022-202X&pyear=2008&md5=bdf1b9d1edc91d2cd0c6cde0f94ce6abhttp://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DC%2BD2MXps1Kntro%3D&pissn=0022-202X&pyear=2008&md5=bdf1b9d1edc91d2cd0c6cde0f94ce6abhttp://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DC%2BD2MXps1Kntro%3D&pissn=0022-202X&pyear=2008&md5=bdf1b9d1edc91d2cd0c6cde0f94ce6abhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=7731696&dopt=Abstracthttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=7731696&dopt=Abstracthttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=7731696&dopt=Abstracthttp://links.isiglobalnet2.com/gateway/Gateway.cgi?&GWVersion=2&SrcAuth=Nature&SrcApp=Nature&DestLinkType=FullRecord&KeyUT=A1995QR65100023&DestApp=WOS_CPLhttp://links.isiglobalnet2.com/gateway/Gateway.cgi?&GWVersion=2&SrcAuth=Nature&SrcApp=Nature&DestLinkType=FullRecord&KeyUT=A1995QR65100023&DestApp=WOS_CPLhttp://links.isiglobalnet2.com/gateway/Gateway.cgi?&GWVersion=2&SrcAuth=Nature&SrcApp=Nature&DestLinkType=FullRecord&KeyUT=A1995QR65100023&DestApp=WOS_CPLhttp://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DyaK2MXltVGjtbY%3D&pissn=0022-202X&pyear=2008&md5=076cd04fb16cf9b48d80779e90860d7ahttp://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DyaK2MXltVGjtbY%3D&pissn=0022-202X&pyear=2008&md5=076cd04fb16cf9b48d80779e90860d7ahttp://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DyaK2MXltVGjtbY%3D&pissn=0022-202X&pyear=2008&md5=076cd04fb16cf9b48d80779e90860d7ahttp://dx.doi.org/10.1111/1523-1747.ep12365805http://dx.doi.org/10.1111/1523-1747.ep12365805http://dx.doi.org/10.1111/1523-1747.ep12365805http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=8875963&dopt=Abstracthttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=8875963&dopt=Abstracthttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=8875963&dopt=Abstracthttp://links.isiglobalnet2.com/gateway/Gateway.cgi?&GWVersion=2&SrcAuth=Nature&SrcApp=Nature&DestLinkType=FullRecord&KeyUT=A1996VN44000019&DestApp=WOS_CPLhttp://links.isiglobalnet2.com/gateway/Gateway.cgi?&GWVersion=2&SrcAuth=Nature&SrcApp=Nature&DestLinkType=FullRecord&KeyUT=A1996VN44000019&DestApp=WOS_CPLhttp://links.isiglobalnet2.com/gateway/Gateway.cgi?&GWVersion=2&SrcAuth=Nature&SrcApp=Nature&DestLinkType=FullRecord&KeyUT=A1996VN44000019&DestApp=WOS_CPLhttp://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DyaK28XmvFWgtbk%3D&pissn=0022-202X&pyear=2008&md5=ad36526b20b141d1a95bffa8d338922chttp://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DyaK28XmvFWgtbk%3D&pissn=0022-202X&pyear=2008&md5=ad36526b20b141d1a95bffa8d338922chttp://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DyaK28XmvFWgtbk%3D&pissn=0022-202X&pyear=2008&md5=ad36526b20b141d1a95bffa8d338922chttp://dx.doi.org/10.1002/path.1643http://dx.doi.org/10.1002/path.1643http://dx.doi.org/10.1002/path.1643http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=15495218&dopt=Abstracthttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=15495218&dopt=Abstracthttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=15495218&dopt=Abstracthttp://links.isiglobalnet2.com/gateway/Gateway.cgi?&GWVersion=2&SrcAuth=Nature&SrcApp=Nature&DestLinkType=FullRecord&KeyUT=000224869100002&DestApp=WOS_CPLhttp://links.isiglobalnet2.com/gateway/Gateway.cgi?&GWVersion=2&SrcAuth=Nature&SrcApp=Nature&DestLinkType=FullRecord&KeyUT=000224869100002&DestApp=WOS_CPLhttp://links.isiglobalnet2.com/gateway/Gateway.cgi?&GWVersion=2&SrcAuth=Nature&SrcApp=Nature&DestLinkType=FullRecord&KeyUT=000224869100002&DestApp=WOS_CPLhttp://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DC%2BD2cXhtVCgsrrN&pissn=0022-202X&pyear=2008&md5=c37e7e53c2535eabe04f34b319466e7ahttp://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DC%2BD2cXhtVCgsrrN&pissn=0022-202X&pyear=2008&md5=c37e7e53c2535eabe04f34b319466e7ahttp://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DC%2BD2cXhtVCgsrrN&pissn=0022-202X&pyear=2008&md5=c37e7e53c2535eabe04f34b319466e7ahttp://dx.doi.org/10.1016/j.ceb.2005.03.002http://dx.doi.org/10.1016/j.ceb.2005.03.002http://dx.doi.org/10.1016/j.ceb.2005.03.002http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=15901502&dopt=Abstracthttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=15901502&dopt=Abstracthttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=15901502&dopt=Abstracthttp://links.isiglobalnet2.com/gateway/Gateway.cgi?&GWVersion=2&SrcAuth=Nature&SrcApp=Nature&DestLinkType=FullRecord&KeyUT=000229621900012&DestApp=WOS_CPLhttp://links.isiglobalnet2.com/gateway/Gateway.cgi?&GWVersion=2&SrcAuth=Nature&SrcApp=Nature&DestLinkType=FullRecord&KeyUT=000229621900012&DestApp=WOS_CPLhttp://links.isiglobalnet2.com/gateway/Gateway.cgi?&GWVersion=2&SrcAuth=Nature&SrcApp=Nature&DestLinkType=FullRecord&KeyUT=000229621900012&DestApp=WOS_CPLhttp://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DC%2BD2MXktleiu7o%3D&pissn=0022-202X&pyear=2008&md5=90ca934d1bee4c22fb8b7705653307e3http://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DC%2BD2MXktleiu7o%3D&pissn=0022-202X&pyear=2008&md5=90ca934d1bee4c22fb8b7705653307e3http://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DC%2BD2MXktleiu7o%3D&pissn=0022-202X&pyear=2008&md5=90ca934d1bee4c22fb8b7705653307e3http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=11971032&dopt=Abstracthttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=11971032&dopt=Abstracthttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=11971032&dopt=Abstracthttp://links.isiglobalnet2.com/gateway/Gateway.cgi?&GWVersion=2&SrcAuth=Nature&SrcApp=Nature&DestLinkType=FullRecord&KeyUT=000175263000070&DestApp=WOS_CPLhttp://links.isiglobalnet2.com/gateway/Gateway.cgi?&GWVersion=2&SrcAuth=Nature&SrcApp=Nature&DestLinkType=FullRecord&KeyUT=000175263000070&DestApp=WOS_CPLhttp://links.isiglobalnet2.com/gateway/Gateway.cgi?&GWVersion=2&SrcAuth=Nature&SrcApp=Nature&DestLinkType=FullRecord&KeyUT=000175263000070&DestApp=WOS_CPLhttp://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DC%2BD38Xjt12ju74%3D&pissn=0022-202X&pyear=2008&md5=2af03a66c538ff79aeafee61a445b7b1http://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DC%2BD38Xjt12ju74%3D&pissn=0022-202X&pyear=2008&md5=2af03a66c538ff79aeafee61a445b7b1http://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DC%2BD38Xjt12ju74%3D&pissn=0022-202X&pyear=2008&md5=2af03a66c538ff79aeafee61a445b7b1http://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DC%2BD38Xjt12ju74%3D&pissn=0022-202X&pyear=2008&md5=2af03a66c538ff79aeafee61a445b7b1http://links.isiglobalnet2.com/gateway/Gateway.cgi?&GWVersion=2&SrcAuth=Nature&SrcApp=Nature&DestLinkType=FullRecord&KeyUT=000175263000070&DestApp=WOS_CPLhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=11971032&dopt=Abstracthttp://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DC%2BD2MXktleiu7o%3D&pissn=0022-202X&pyear=2008&md5=90ca934d1bee4c22fb8b7705653307e3http://links.isiglobalnet2.com/gateway/Gateway.cgi?&GWVersion=2&SrcAuth=Nature&SrcApp=Nature&DestLinkType=FullRecord&KeyUT=000229621900012&DestApp=WOS_CPLhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=15901502&dopt=Abstracthttp://dx.doi.org/10.1016/j.ceb.2005.03.002http://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DC%2BD2cXhtVCgsrrN&pissn=0022-202X&pyear=2008&md5=c37e7e53c2535eabe04f34b319466e7ahttp://links.isiglobalnet2.com/gateway/Gateway.cgi?&GWVersion=2&SrcAuth=Nature&SrcApp=Nature&DestLinkType=FullRecord&KeyUT=000224869100002&DestApp=WOS_CPLhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=15495218&dopt=Abstracthttp://dx.doi.org/10.1002/path.1643http://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DyaK28XmvFWgtbk%3D&pissn=0022-202X&pyear=2008&md5=ad36526b20b141d1a95bffa8d338922chttp://links.isiglobalnet2.com/gateway/Gateway.cgi?&GWVersion=2&SrcAuth=Nature&SrcApp=Nature&DestLinkType=FullRecord&KeyUT=A1996VN44000019&DestApp=WOS_CPLhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=8875963&dopt=Abstracthttp://dx.doi.org/10.1111/1523-1747.ep12365805http://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DyaK2MXltVGjtbY%3D&pissn=0022-202X&pyear=2008&md5=076cd04fb16cf9b48d80779e90860d7ahttp://links.isiglobalnet2.com/gateway/Gateway.cgi?&GWVersion=2&SrcAuth=Nature&SrcApp=Nature&DestLinkType=FullRecord&KeyUT=A1995QR65100023&DestApp=WOS_CPLhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=7731696&dopt=Abstracthttp://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DC%2BD2MXps1Kntro%3D&pissn=0022-202X&pyear=2008&md5=bdf1b9d1edc91d2cd0c6cde0f94ce6abhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=16029326&dopt=Abstracthttp://dx.doi.org/10.1111/j.1365-2133.2005.06735.xhttp://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DyaK2MXitVygsLc%3D&pissn=0022-202X&pyear=2008&md5=db07ac2fdfd1ac3c8c36827ec5807342http://links.isiglobalnet2.com/gateway/Gateway.cgi?&GWVersion=2&SrcAuth=Nature&SrcApp=Nature&DestLinkType=FullRecord&KeyUT=A1994PR22000006&DestApp=WOS_CPLhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=7525408&dopt=Abstracthttp://dx.doi.org/10.1101/gad.8.21.2574http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#tophttp://www.nature.com/jid/journal/v128/n7/full/5701257a.html#tophttp://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib11http://www.nature.com/jid/journal/v128/n7/full/5701257a.html#bib7


6/6

8. Mller FB, Huber M, Kinaciyan T, Hausser I, Schaffrath C, Krieg T et al. (2006) A human keratin10 knockout causes recessive epidermolytic hyperkeratosis. Hum Mol Genet15:11331141 |Article|PubMed|

9. Reichelt J, Bssow H, Grund C, Magin TM (2001) Formation of a normal epidermis supported byincreased stability of keratin 5 and 14 in keratin 10 null mice. Mol Biol Cell12:15571568 |PubMed|ISI|ChemPort|

10. Reichelt J, Magin TM (2002) Hyperproliferation, induction of c-Myc and 14-3-3sigma, but no cellfragility in keratin-10-null mice.J Cell Sci115:26392650 |PubMed|ChemPort|

11. Sapio MR, Posca SD, Trocone G, Pettinato G, Palombini L, Rossi G et al. (2006) Detection ofBRAF mutation in thyroid papillary carcinomas by mutant allele-specific PCR amplification(MASA). Eur J Endocrinol154:341348 |Article|PubMed|ChemPort|

12. Smith F (2003) The molecular genetics of keratin disorders.Am J Clin Dermatol4:347364 |Article|PubMed|ISI|

13. Xu X, Quiros RM, Gattuso P, Ain KB, Prinz RA (2003) High prevalence of BRAF gene mutation inpapillary thyroid carcinomas and thyroid tumor cell lines.Cancer Res 63:45614567 |PubMed|ISI|ChemPort|
http://dx.doi.org/10.1093/hmg/ddl028http://dx.doi.org/10.1093/hmg/ddl028http://dx.doi.org/10.1093/hmg/ddl028http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=16505000&dopt=Abstracthttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=16505000&dopt=Abstracthttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=16505000&dopt=Abstracthttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=11408568&dopt=Abstracthttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=11408568&dopt=Abstracthttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=11408568&dopt=Abstracthttp://links.isiglobalnet2.com/gateway/Gateway.cgi?&GWVersion=2&SrcAuth=Nature&SrcApp=Nature&DestLinkType=FullRecord&KeyUT=000170350200002&DestApp=WOS_CPLhttp://links.isiglobalnet2.com/gateway/Gateway.cgi?&GWVersion=2&SrcAuth=Nature&SrcApp=Nature&DestLinkType=FullRecord&KeyUT=000170350200002&DestApp=WOS_CPLhttp://links.isiglobalnet2.com/gateway/Gateway.cgi?&GWVersion=2&SrcAuth=Nature&SrcApp=Nature&DestLinkType=FullRecord&KeyUT=000170350200002&DestApp=WOS_CPLhttp://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DC%2BD3MXotVSjsLo%3D&pissn=0022-202X&pyear=2008&md5=49443a8e48aad8346bd78832c1ef9816http://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DC%2BD3MXotVSjsLo%3D&pissn=0022-202X&pyear=2008&md5=49443a8e48aad8346bd78832c1ef9816http://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DC%2BD3MXotVSjsLo%3D&pissn=0022-202X&pyear=2008&md5=49443a8e48aad8346bd78832c1ef9816http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=12077355&dopt=Abstracthttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=12077355&dopt=Abstracthttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=12077355&dopt=Abstracthttp://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DC%2BD38XlsFCrt7Y%3D&pissn=0022-202X&pyear=2008&md5=578d107a4c83e88a68994a6b3c444845http://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DC%2BD38XlsFCrt7Y%3D&pissn=0022-202X&pyear=2008&md5=578d107a4c83e88a68994a6b3c444845http://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DC%2BD38XlsFCrt7Y%3D&pissn=0022-202X&pyear=2008&md5=578d107a4c83e88a68994a6b3c444845http://dx.doi.org/10.1530/eje.1.02072http://dx.doi.org/10.1530/eje.1.02072http://dx.doi.org/10.1530/eje.1.02072http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=16452550&dopt=Abstracthttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=16452550&dopt=Abstracthttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=16452550&dopt=Abstracthttp://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DC%2BD28XitlGltL4%3D&pissn=0022-202X&pyear=2008&md5=7a06c69457033475cbc8aea182f54465http://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DC%2BD28XitlGltL4%3D&pissn=0022-202X&pyear=2008&md5=7a06c69457033475cbc8aea182f54465http://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DC%2BD28XitlGltL4%3D&pissn=0022-202X&pyear=2008&md5=7a06c69457033475cbc8aea182f54465http://dx.doi.org/10.2165/00128071-200304050-00005http://dx.doi.org/10.2165/00128071-200304050-00005http://dx.doi.org/10.2165/00128071-200304050-00005http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=12688839&dopt=Abstracthttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=12688839&dopt=Abstracthttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=12688839&dopt=Abstracthttp://links.isiglobalnet2.com/gateway/Gateway.cgi?&GWVersion=2&SrcAuth=Nature&SrcApp=Nature&DestLinkType=FullRecord&KeyUT=000185801500005&DestApp=WOS_CPLhttp://links.isiglobalnet2.com/gateway/Gateway.cgi?&GWVersion=2&SrcAuth=Nature&SrcApp=Nature&DestLinkType=FullRecord&KeyUT=000185801500005&DestApp=WOS_CPLhttp://links.isiglobalnet2.com/gateway/Gateway.cgi?&GWVersion=2&SrcAuth=Nature&SrcApp=Nature&DestLinkType=FullRecord&KeyUT=000185801500005&DestApp=WOS_CPLhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=12907632&dopt=Abstracthttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=12907632&dopt=Abstracthttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=12907632&dopt=Abstracthttp://links.isiglobalnet2.com/gateway/Gateway.cgi?&GWVersion=2&SrcAuth=Nature&SrcApp=Nature&DestLinkType=FullRecord&KeyUT=000184562500040&DestApp=WOS_CPLhttp://links.isiglobalnet2.com/gateway/Gateway.cgi?&GWVersion=2&SrcAuth=Nature&SrcApp=Nature&DestLinkType=FullRecord&KeyUT=000184562500040&DestApp=WOS_CPLhttp://links.isiglobalnet2.com/gateway/Gateway.cgi?&GWVersion=2&SrcAuth=Nature&SrcApp=Nature&DestLinkType=FullRecord&KeyUT=000184562500040&DestApp=WOS_CPLhttp://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DC%2BD3sXmtFers7Y%3D&pissn=0022-202X&pyear=2008&md5=ca156cb4314983d9e3e6cb355682d209http://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DC%2BD3sXmtFers7Y%3D&pissn=0022-202X&pyear=2008&md5=ca156cb4314983d9e3e6cb355682d209http://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DC%2BD3sXmtFers7Y%3D&pissn=0022-202X&pyear=2008&md5=ca156cb4314983d9e3e6cb355682d209http://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DC%2BD3sXmtFers7Y%3D&pissn=0022-202X&pyear=2008&md5=ca156cb4314983d9e3e6cb355682d209http://links.isiglobalnet2.com/gateway/Gateway.cgi?&GWVersion=2&SrcAuth=Nature&SrcApp=Nature&DestLinkType=FullRecord&KeyUT=000184562500040&DestApp=WOS_CPLhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=12907632&dopt=Abstracthttp://links.isiglobalnet2.com/gateway/Gateway.cgi?&GWVersion=2&SrcAuth=Nature&SrcApp=Nature&DestLinkType=FullRecord&KeyUT=000185801500005&DestApp=WOS_CPLhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=12688839&dopt=Abstracthttp://dx.doi.org/10.2165/00128071-200304050-00005http://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DC%2BD28XitlGltL4%3D&pissn=0022-202X&pyear=2008&md5=7a06c69457033475cbc8aea182f54465http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=16452550&dopt=Abstracthttp://dx.doi.org/10.1530/eje.1.02072http://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DC%2BD38XlsFCrt7Y%3D&pissn=0022-202X&pyear=2008&md5=578d107a4c83e88a68994a6b3c444845http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=12077355&dopt=Abstracthttp://chemport.cas.org/cgi-bin/sdcgi?APP=ftslink&action=reflink&origin=npg&version=1.0&coi=1:CAS:528:DC%2BD3MXotVSjsLo%3D&pissn=0022-202X&pyear=2008&md5=49443a8e48aad8346bd78832c1ef9816http://links.isiglobalnet2.com/gateway/Gateway.cgi?&GWVersion=2&SrcAuth=Nature&SrcApp=Nature&DestLinkType=FullRecord&KeyUT=000170350200002&DestApp=WOS_CPLhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=11408568&dopt=Abstracthttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?holding=npg&cmd=Retrieve&db=PubMed&list_uids=16505000&dopt=Abstracthttp://dx.doi.org/10.1093/hmg/ddl028

erytro journal

Documents