epigenetics in personalized psychiatry · irritable bowel syndrome, chronic pain, chronic fatigue1...

Epigeneticsin personalized psychiatry

Stephan Claes, Md, PhD

University Psychiatric Center KU Leuven


1. Early life stress and mental health

2. Looking for epigenetic marks

3. Towards personalized psychiatry

Early life stress and psychopathology

Trauma is an important risk factor for a number of psychiatric disorders

• Anxiety and mood disrorders 1

• Substance abuse 2

• Personality disorders 3

• Psychosis 4

1. Heim C & Nemeroff CB. Biol Psychiatry, 46: 1509-22, 1999.2. Anda R et al. Eur Arch Psych Clin Neurosci 256: 174-86, 2006.3. Ball JS et al. Curr Psychiatry Rep 11: 63-8, 2009.4. Morgan C & Fisher H. Schizophr Bull 33:3-10, 2007

Early life stress and (funcctional) somatic disorders

• Risk factor for functional somatic disorders, such as irritable bowel syndrome, chronic pain, chronic fatigue1

• Risk factor for somatic disorders, such as diabetes, astma, autoimmune and cardiovascular disorders2, 3, 4

1. Van Houdenhove, B., & Luyten, P. (2009). In: Trauma and physical health. Understanding the effects of extreme stress and psychological harm. (pp. 37-64). London/New York: Routledge.

2. Batten, S. et al. Journal of Clinical Psychiatry, 65, 249-254, 2004.3. Dube, S. R. et al. Psychosomatic Medicine, 71, 243-250, 2005.4. Goodwin, R. D., & Stein, M. D. Psychological Medicine, 34, 509-520, 2004.

DOHaD hypothesis

Developmental Origins of Health and Disease

Barker and Osmond 1986, The Lancet

infant undernutrition

1920

coronary heart disease

1970

1944/45: The Dutch hunger winter

The Dutch famine

Consequences of famine during pregnancy are multiple, and time-dependent

Roseboom T, de Rooij S, Painter R. The Dutch famine and its long-term consequences for adult health. Early Hum Dev 82:485-91, 2006.

The Barker hypothesis: Developmental Origins of (Behavior,)

Health & Disease [DO(B)HaD]

Prenatal stress and mental health:early development

• Babies of mothers with many negative life events and/or with higher cortisol levels during pregnancy show increased crying, negative facial expressions and higher irritability at ages of 3 and 6 months (1, 2, 3)

• Babies of mothers with increased anxiety and/or higher cortisol levels during pregnancy show increased anxiety at the age of 6-9 years (4)

• Maternal anxiety during pregnancy accounts for 22% of the variability in ADHD symptoms at the age of 6-12 years (5, 6)

1. Würmser et al., 2006; 2. De weerth et al., 2003; 3. Davis et al., 2007;4. Davis & Sandman, 2012; 5. Grizenko et al., 2012; 6. Van den Bergh & Marcoen, 2014;

The consequences of ELS

• Rats taken away from the dam during 3 hours at day 2-14 postnatally (1)

• Throughout life:

• Increased anxiety

• Hyper-responsive HPA-as

• Cognitive dysfunctions

• Structural defects in de

hippocampus

(1) Huot RL et al. Brain Res. 2002 Sep 20;950(1-2):52-63

“Early life stress” and pathology

ELS

Psychiatric disorders

Somaticdisorders

Psychosomatic disorders

Modulation of the biological stress response

Epigeneticmodifications

Epigeneticmodifications

C. Sandi; Nature Reviews Neuroscience, 2004

GR

GRGR

GRGR

GR

early life stress

DNA methylation

changes

dysregulated stress system

Cortisol

Crucial role of theglucocorticoidreceptor (GR)

Hackman D. et al., Nature Reviews Neuroscience 2010

NR3C1: the glucocorticoid receptor

ELS and GR methylation

Significant Associations of Childhood Adversity Variables and Percent Methylation at Predicted CpG Sites (1–4).The Parental Care scale of the Parental Bonding Instrument reflects parental warmth, affection, and involvement; lower scoresreflect greater parental coldness, rejection, and detachment. Maltreatment reflects the total score of Childhood Trauma Questionnaire. Parental loss is defined as loss of a parent before age 18, including death (N=12) and/or prolonged separation/desertion (N=14).

Tyrka AR et al. Childhood adversity and epigenetic modulation of the leukocyte glucocorticoid receptor: preliminaryfindings in healthy adults. PLoS One. 2012;7(1):e30148.

• 99 healthy adults• History of early trauma

(maltreatment, early parentalloss) was associated withincreased NR3C1 promoter methylation

• NR3C1 promoter methylationcoupled to blunted cortisol response to Dex/CRH test

Prenatal stress and GR methylation

8-15 w 16-27 w 28-37 w °

SCR

EEN

ING

MOTHER

GENERAL INFORMATION (health, substance use, …) + + +

PSYCHIATRIC – PSYCHOLOGICAL QUESTIONNAIRE

• Edinburgh Depression Scale (EDS) + + +

• Spielberger State and Trait Anxiety Inventory (STAI) + + +

• Pregnancy Related Anxiety Questionnaire (PRAQ) + + +

• Maternal and Fetal Attachment Scale (MFAS) + + +

BIO

L.

PAR

AM

.

MOTHER

Saliva: Basal cortisol secretion (4x/day – 1 d.) + + +

CHILD

Cord blood sample +

“Prenatal and Early Life Stress (PELS) Study”: Tilburg, Londen, Leuven

Prenatal anxiety and GR methylation

aaccccgF12tagcccctttcgF13aagtgacacacttcacgF14caactcgF15gcccgF16gc

gF17gcgF18gcgF19gcgF20cgF21ggccactcacgF22cagctcagccgF23cgF24ggaggcgF25ccccgF2

6gc

tcttgtggcccgF27cccgF28ctgtcacccgF29caggggcactggcgF30gcgF31cttgccgF32

ccaaggggcagagcgF33agctcccgF34agtgggtctggagccgF35cgF36gagctgggc

gF37ggggcgF38ggaaggaggtagcgF39agaaaagaaactggagaaactcgF40gtggcc

F36.39: T2: Cort

F20.21: T1: Pregn. Anx. - T2: Pregn & Gen. Anx.

F12.13: T1 & T2: Pregn. Anx.

Hompes T, Izzi B, … , Claes S. Investigating the influence of maternal cortisol and emotional state during pregnancy on the DNA methylation status of the glucocorticoid receptor gene (NR3C1) promoter region in cord blood. J PsychiatrRes. 2013 Jul;47(7):880-91.

Figure 4. Results of meta-analyses of prenatal stress exposure influence on methylation of the CpG sites 35 to 39. From left to right, displayed variables consist of: study, sample size (n), a graphical representation of the computed correlations, correlation values between methylation and the assessed prenatal stress variable, their corresponding confidence intervals and the weightof each study in the meta-analysis as determined by a random effects model.

Published in: H Palma-Gudiel; A Córdova-Palomera; E Eixarch; M Deuschle; L Fañanás; Epigenetics 2015, 10, 893-902.DOI: 10.1080/15592294.2015.1088630Copyright © 2015 Taylor & Francis Group, LLC

From: Genome-wide Epigenetic Regulation by Early-Life Trauma

Arch Gen Psychiatry. 2012;69(7):722-731. doi:10.1001/archgenpsychiatry.2011.2287

Figure 1. Chromosomal location and expression. A, Chromosomal distribution of differentially methylated probes in

abused suicide completers (SAs). The first row represents the chromosomal location of probes with increased

methylation (hypermethylated) in the SAs and the second row indicates the chromosomal location of probes with

decreased methylation (hypomethylated) in the SAs. B, Inverse correlation between whole-genome expression and

promoter methylation differences between SAs and controls. The mean promoter methylation differences (Meth) and

gene expression (Expr) differences show that differential methylation is inversely correlated with differential gene

expression across the genome (Pearson r = −0.19, P ≤ 4.0E−6). Data were obtained by summarizing promoter

methylation and gene expression differences across regions of 1 megabase throughout the whole genome.

Not just GR…

high anxiety

n = 23

low anxiety

n = 22

Genome-wide data analysis

Differentially methylatedregions (DMR)

Candidate genePathways andnetworks

GABBR1?

rank

combp

refGene

name

Location (GRCh37/hg19

assembly)

Minimum

P-value

Number

of

probes

Stouffer-

Liptak-

Kechris P-

value

Šidák

corrected

CpG

island

1 TP53INP1 chr8:95962083-95962464 5.7E-07 6 6.36E-12 1.42E-06 yes

2 PRSS50 chr3:46759334-46759699 1.2E-06 8 3.097E-11 7.24E-06 yes

3 HOXC4 chr12:54446278-54446577 1.8E-06 6 4.24E-11 1.21E-05 no

4 PKP3 chr11:396685-397078 1.3E-05 3 7.065E-10 0.000153 yes

5 ZNF764 chr16:30572738-30573014 0.00015 5 1.136E-08 0.003506 yes

6 PPT2 chr6:32120954-32121421 4.5E-05 14 2.556E-08 0.00466 no

7 GABBR1 chr6:29595001-29595316 0.00015 7 2.70E-07 0.07059 yes

8 PITPNM3 chr17:6358362-6358600 0.00278 4 2.88E-07 0.09817 yes

9 ESRRG chr1:217306589-217306764 0.00734 3 1.01E-06 0.3886 no

10 HS3ST2 chr16:22959593-22959820 0.00383 2 0.0001211 1 yes

Candidate gene selection top gene in both methods located in a CpG island

GABBR1

Validation EpiTYPER

Vangeel EB, et al. Clin Epigenetics. 2017 Oct 3;9:107.

Validation study (n=80)


The infant stress system and GABBR1 methylation

2 months 4 months 12 months

* p < 0,05 ** p < 0,01

* ** **


GABBR1

Rat hippocampal GABBR1 expressiondecreased by 36% in prenatal stress

Receptor for GABAergicneurotransmission

Regulates early-life and chronic psychosocial stress

Depression-like phenotype

GABBR1 epigenetics in psychiatric research

Newborn stress response

?


• Why has nature developed such a mechanism?

• Are epigenetic changes heritable?

A lot of questions

27

An old discussion…

28

Weaver et al:

• rats (hippocampus)

• Better maternal care (LG/ABN) changes methylation patterns at the GR 1F promoter region in the pups

Epigenetic marks of prenatal stress: reversible?

Weaver IC. Nat Neurosci. 2004 Aug;7(8):847-54.

Also reversible in humans?

Pharmacological interventions?

• Mainly in cancer research

• DNA methyltransferase inhibitors, such as

• 5-azacytidine (azacitidine)

• 5-aza-2'-deoxycytidine (decitabine)

Pilot studies in animals

epigenetics in personalized psychiatry · irritable bowel syndrome, chronic pain, chronic fatigue1...

Documents