ensembl training materials are protected by a cc by license … · 2017-05-11 · 6th april...
TRANSCRIPT
Training materials
• Ensembl training materials are protected by a CC BY license • http://creativecommons.org/licenses/by/4.0/• If you wish to re-use these materials, please credit Ensembl for
their creation• If you use Ensembl for your work, please cite our papers • http://www.ensembl.org/info/about/publications.html
Ben Moore
Ensembl Outreach Officer
EMBL-EBI
Browsing Genes and Genomes with Ensembl
Objectives
• What is Ensembl?
• What type of data can you get in Ensembl?
• How to navigate the Ensembl browser website.
• How to use Ensembl tools
• Where to go for help and documentation.
This webinar course
Date Webinar topic Instructor
6th April Introduction to Ensembl Helen Sparrow
13th April Ensembl genes Emily Perry
20th April Data export with BioMart Victoria Newman
27th April Variation data in Ensembl and the Ensembl VEP Victoria Newman
4th May Comparing genes and genomes with Ensembl Compara Ben Moore
11th May Finding features that regulate genes – the Ensembl Regulatory Build
Ben Moore
18th May Uploading your data to Ensembl and advanced ways to access Ensembl data
Emily Perry
All webinars begin at 9am BST
Structure
Presentation:What the data/tool isHow we produce/process the data
Demo:Getting the data
Using the tool
Exercises:On the train online course
Questions?
• Ask questions in the Chat box in the webinar interface
• My Ensembl colleagues will respond during
• There’s no threading so please respond with @username
Emily Perry Victoria Newman
Course exerciseshttp://www.ebi.ac.uk/training/online/course/ensembl-browser-w
ebinar-series-2016
This text will be replaced by a YouTube (link to YouKu too) video of this webinar
and a pdf of the slides
The “next page”is the exercises for this
module
A link to exercises and their solutions are in the page hierarchy
Get help with the exercises
• Use the exercise solutions in the online course
• Join our Facebook group and discuss the exercises with everybody (see the online course for the link)
• Email us: [email protected]
EBI is an Outstation of the European Molecular Biology Laboratory.
Ensembl Regulation
Regulation- Annotation of the genome with functional regulatory elements;
promoters, enhancers, repressors
- Epigenetic marks
- Histone modifications
- DNA methylation
- Transcription Factor binding
- RNA Pol binding
- Predicted open/closed chromatin
- DNase I sensitivity
Epigenetics
The study of heritable genetic changes, without changes in the DNA sequence.
This is known to regulate gene expression.
Epigenetic change -> cell differentiation
Epigenetic change -> cell differentiation
- Cells carry out different functions- Cells are morphologically different- Cells express different genes- Cells have different epigenomes
Epigenetic change -> cell differentiation
Stem cell
Differentiated cell
Histone modifications
We describe histone modifications using the form Subunit, Amino acid, Position, Modification, eg H3K36me3.
Histone code
Modification Histone
H3K4 H3K9 H3K14 H3K27 H3K79 H4K20 H2BK5
me1
me2
me3
ac
GGCGGGATTGCGCGTTAGATCGCGCGCTTATGCTAGCCGCGCTGATAGCGGCGGGATTGCGCGTTAGATCGCGCGCTTATGCTAGCCGCGCTGATAGC
CH3CH3 CH3 CH3 CH3CH3CH3 CH3
GCTATCAGCGCGGCTAGCATAAGCGCGCGATCTAACGCGCAATCCCGCC
CH3CH3 CH3CH3CH3 CH3 CH3CH3
DNA methylation -> inactive
Bisulfite sequencing
GGCGGGATTGCGCGTTAGATCGCGCGCTTATGCTAGCCGCGCTGATAG
CH3 CH3 CH3
CH3 CH3
Bisulfite treatment
GGUGGGATTGUGUGTTAGATCGCGCGUTTATGUTAGUCGCGUTGATAG
Sequence and compare to reference
Promoters and enhancers
- TF-binding at promoters and enhancers is necessary for transcription
- Combinations of epigenetic marks affect the ability and probability of TF-binding at these sites
ChIP-seq for histone mods & TF-binding
DNA
DNA-binding protein
Shear the genome
Crosslink
Covalent bond
Antibody
Pull down the protein with an antibody
Remove crosslinks and wash
Sequence fragments
ACGCTGACTAGAATCAATGGCTTCTCTTCGCATATGGCTGACTA
Open/closed chromatin
Open chromatin is transcriptionally active.Closed chromatin is inactive.
DNase hypersensitivity
Sequence and compare to reference
DNase treatment
Purify
Methods of gene regulation
Method of regulation Detection Method
Histone modifications ChIP-seq
Transcription factor binding ChIP-seq
Open/closed chromatin DNase sensitivity
DNA methylation Bisulfite sequencing
Current data
The future
A subset of cell types
- Only a subset of available data is displayed in Ensembl.- We display cell types that have, at a minimum:
- CTCF binding- DNase or FAIRE data- H3K4me3, H3K27me3, H3K36me3 data
- We display all TFBS and histone modification data known in these cell types.
- We process these data to predict activity.
- Further data can be added using track hubs.
Processing the data
- The raw data is taken from the various sources.- This is processed to predict the positions of regulatory
features, such as promoters, enhancers and insulators.- The activity of these features is predicted in the different
cell types.
- All of this can be viewed in the genome browser.
Raw data
Transcription Factor ATranscription Factor BTranscription Factor CHistone mod1Histone mod2Histone mod3
Searching for patterns
known promoter
known promoter
known promoter
Segmentation
Transcription Factor ATranscription Factor BTranscription Factor C
Histone mod1Histone mod2Histone mod3
MultiCell features
Cell type 1
Cell type 2
Cell type 4
Cell type 3
Cell-specific features
Cell type 1
Cell type 2
Cell type 4
Cell type 3
MultiCell
We do not…- …link promoters/enhancers/insulators or any other
regulatory features to genes. We allow you see what is where and make your own inferences.
- …link regulatory features to gene expression. We have cell-line specific regulation data and tissue specific expression data – make of it what you will.
Regulatory data is incredibly complex and still in relative infancy. There is no comprehensive database of regulation data.
Hands on
- We’re going to look at the region of a gene LIMD2 to find regulatory features and explore what cells types they are active in and what evidence there is to show this.
This webinar courseDate Webinar topic Instructor
6th April Introduction to Ensembl Helen Sparrow
13th April Ensembl genes Emily Perry
20th April Data export with BioMart Victoria Newman
27th April Variation data in Ensembl and the Ensembl VEP Victoria Newman
4th May Comparing genes and genomes with Ensembl Compara Ben Moore
11th May Finding features that regulate genes – the Ensembl Regulatory Build Ben Moore
18th May Uploading your data to Ensembl and advanced ways to access
Ensembl data
Emily Perry
Course exercises
http://www.ebi.ac.uk/training/online/course/ensembl-browser-webinar-series-2016
This text will be replaced by a YouTube (link to YouKu too) video of the webinar
and a pdf of the slides.
The “next page” will be the exercises
A link to exercises and their solutions will appear in the page
hierarchy
Get help with the exercises
• Use the exercise solutions in the online course
• Join our Facebook group and discuss the exercises with everybody (see the online course for the link)
• Email us: [email protected]
Help and documentationCourse online http://www.ebi.ac.uk/training/online/subjects/11
Tutorials www.ensembl.org/info/website/tutorials
Flash animations
www.youtube.com/user/EnsemblHelpdesk
http://u.youku.com/Ensemblhelpdesk
Email us [email protected]
Ensembl public mailing lists [email protected], [email protected]
Follow us
www.facebook.com/Ensembl.org
@Ensembl
www.ensembl.info
Publications
Aken, BL. et al
Ensembl 2017
Nucleic Acids Research
http://europepmc.org/articles/PMC5210575
Xosé M. Fernández-Suárez and Michael K. SchusterUsing the Ensembl Genome Server to Browse Genomic Sequence Data.Current Protocols in Bioinformatics 1.15.1-1.15.48 (2010)www.ncbi.nlm.nih.gov/pubmed/20521244
Giulietta M Spudich and Xosé M Fernández-SuárezTouring Ensembl: A practical guide to genome browsingBMC Genomics 11:295 (2010)www.biomedcentral.com/1471-2164/11/295
Javier Herrero et al
Ensembl Regulation Resources
Database (Oxford) 2016: bav119
https://academic.oup.com/database/article-lookup/doi/10.1093/database/bav119
http://www.ensembl.org/info/about/publications.html
Ensembl 2017
Ensembl Acknowledgements
Training materials
• Ensembl training materials are protected by a CC BY license • http://creativecommons.org/licenses/by/4.0/• If you wish to re-use these materials, please credit Ensembl for
their creation• If you use Ensembl for your work, please cite our papers • http://www.ensembl.org/info/about/publications.html