Elucidating and Regulating the Acetoin Production Role of MicrobialFunctional Groups in Multispecies Acetic Acid Fermentation

Zhen-Ming Lu,a Na Liu,a Li-Juan Wang,a Lin-Huan Wu,a Jin-Song Gong,a Yong-Jian Yu,d Guo-Quan Li,d Jin-Song Shi,a,b

Zheng-Hong Xua,b,c

School of Pharmaceutical Science, Jiangnan University, Wuxi, People’s Republic of Chinaa; National Engineering Research Center of Solid-State Brewing, Luzhou, People’sRepublic of Chinab; Tianjin Key Laboratory for Industrial Biological Systems and Bioprocessing Engineering, Tianjin Institute of Industrial Biotechnology, Chinese Academyof Sciences, Tianjin, People’s Republic of Chinac; Jiangsu Hengshun Vinegar Industry Co., Ltd., Zhenjiang, People’s Republic of Chinad

ABSTRACT

Acetoin (3-hydroxy-2-butanone) formation in vinegar microbiota is crucial for the flavor quality of Zhenjiang aromatic vinegar,a traditional vinegar produced from cereals. However, the specific microorganisms responsible for acetoin formation in this cen-turies-long repeated batch fermentation have not yet been clearly identified. Here, the microbial distribution discrepancy in thediacetyl/acetoin metabolic pathway of vinegar microbiota was revealed at the species level by a combination of metagenomicsequencing and clone library analysis. The results showed that Acetobacter pasteurianus and 4 Lactobacillus species (Lactobacil-lus buchneri, Lactobacillus reuteri, Lactobacillus fermentum, and Lactobacillus brevis) might be functional producers of acetoinfrom 2-acetolactate in vinegar microbiota. Furthermore, A. pasteurianus G3-2, L. brevis 4-22, L. fermentum M10-3, and L. buch-neri F2-5 were isolated from vinegar microbiota by a culture-dependent method. The acetoin concentrations in two cocultures(L. brevis 4-22 plus A. pasteurianus G3-2 and L. fermentum M10-3 plus A. pasteurianus G3-2) were obviously higher than thosein monocultures of lactic acid bacteria (LAB), while L. buchneri F2-5 did not produce more acetoin when coinoculated with A.pasteurianus G3-2. Last, the acetoin-producing function of vinegar microbiota was regulated in situ via augmentation with func-tional species in vinegar Pei. After 72 h of fermentation, augmentation with A. pasteurianus G3-2 plus L. brevis 4-22, L. fermen-tum M10-3, or L. buchneri F2-5 significantly increased the acetoin content in vinegar Pei compared with the control group. Thisstudy provides a perspective on elucidating and manipulating different metabolic roles of microbes during flavor formation invinegar microbiota.

IMPORTANCE

Acetoin (3-hydroxy-2-butanone) formation in vinegar microbiota is crucial for the flavor quality of Zhenjiang aromatic vinegar,a traditional vinegar produced from cereals. Thus, it is of interest to understand which microbes are driving the formation ofacetoin to elucidate the microbial distribution discrepancy in the acetoin metabolic pathway and to regulate the metabolic func-tion of functional microbial groups in vinegar microbiota. Our study provides a perspective on elucidating and manipulatingdifferent metabolic roles of microbes during flavor formation in vinegar microbiota.

Solid-state fermentation (SSF) is one of the oldest and mosteconomical ways of producing and preserving foods which

may improve the nutritional values, sensory properties, and func-tional qualities of raw materials (1). The SSF processes of mostknown natural and industrial fermented foods, such as grape wine(2) and cheese (3), are driven by complex communities of micro-organisms. As such, studies on the formation and function of foodmicrobiota, especially as-yet-uncultivated microorganisms, dur-ing SSF processes are becoming increasingly important.

Traditional Chinese vinegars, referred to as cereal vinegars, areimportant seasoning and medicinal products in Chinese daily life(4). Solid-state acetic acid fermentation (AAF), an important stepin producing the flavor compounds of cereal vinegar, is a repeatedbatch fermentation process that proceeds for many centurieswithout spoilage (4). In an open work environment, microbes thatinhabit solid-state vinegar culture (termed Pei in Chinese) repro-ducibly metabolize nonautoclaved raw materials (e.g., sorghum,sticky rice, and wheat bran) and synthesize flavor compounds (5).Thus, the function of reproducible fermentation-based metabo-lism makes this acidic ecosystem (pH 3.0 to 3.5) amenable toadaptation for dissecting the formation and function of microbi-ota in food fermentation. Although many microbiological studies

have been conducted to reveal the diversity and formation of mi-crobial communities during the AAF of cereal vinegars (6–9), thegap between community assemblage and the function of this mi-crobial ecosystem still exists.

In vinegar microbiota, the utilization of ethanol and glucoseoriginating from raw materials leads to diverse flavors and theformation of bioactive compounds. 2,3,5,6-Tetramethylpyrazine(TTMP), termed ligustrazine in traditional Chinese medicine, ex-ists abundantly in the rhizome of Ligusticum wallichii. This alka-

Received 3 May 2016 Accepted 19 July 2016

Accepted manuscript posted online 22 July 2016

Citation Lu Z-M, Liu N, Wang L-J, Wu L-H, Gong J-S, Yu Y-J, Li G-Q, Shi J-S, Xu Z-H.2016. Elucidating and regulating the acetoin production role of microbialfunctional groups in multispecies acetic acid fermentation. Appl EnvironMicrobiol 82:5860 –5868. doi:10.1128/AEM.01331-16.

Editor: J. Björkroth, University of Helsinki

Address correspondence to Zheng-Hong Xu, zhenghxu@jiangnan.edu.cn.

Supplemental material for this article may be found at http://dx.doi.org/10.1128/AEM.01331-16.

Copyright © 2016, American Society for Microbiology. All Rights Reserved.

crossmark

5860 aem.asm.org October 2016 Volume 82 Number 19Applied and Environmental Microbiology

on April 18, 2020 by guest

http://aem.asm

.org/D

ownloaded from

loid has been widely used in China to treat cardiovascular andcerebrovascular diseases (10). Aside from its therapeutic effect,TTMP is also a food flavor agent with a pleasant tonality of nutty,roasty, and toasty (11). It exists widely in fermented foods, includ-ing cheese, rum, Chinese liquor, and soy sauce. In our previousstudy, a high content of TTMP (�500 mg/liter) was detected in5-year-aged Zhenjiang aromatic vinegar (12), a representative ce-real vinegar that is certified with a protected geographical indica-tion (PGI) (European Union no. 501/2012). Although TTMP ismainly accumulated during the aging process of vinegar, the pre-cursors of TTMP, including acetoin (3-hydroxy-2-butanone) anddiacetyl (2,3-butanedione), are biosynthesized in the AAF state(13). However, the mechanisms that underlie the formation ofTTMP precursors by acid-tolerant vinegar microbiota remainpoorly characterized.

The formation mechanism of TTMP is a contentious issue.Recently, a biochemical-chemical route for the synthesis of TTMPhas gained convincing experimental support (14, 15). Acetoin andammonium were demonstrated to be two key precursors ofTTMP. In the AAF of cereal vinegar, microorganisms inhabitingvinegar Pei can utilize ethanol and glucose as substrates to synthe-size acetoin through the diacetyl/acetoin metabolic pathway (seeFig. S1 in the supplemental material). 2-Acetolactate is an impor-tant precursor for the biosyntheses of the acetoin-diacetyl-2,3-butanediol group and the valine-leucine-isoleucine group (seeFig. S1). There are two possible routes for the origin of acetoin.The first is through the nonenzymatic decomposition of 2-aceto-lactate and the following biocatalysis by diacetyl reductase (DR);the other involves the direct transformation of 2-acetolactate byacetolactate decarboxylase (ALDC). The acetoin can be furthertransformed into 2,3-butanediol (2,3-BDO) by butanediol dehy-drogenase (BDH). A previous study showed that acetoin, diacetyl,and 2,3-BDO were the dominant volatile compounds in Zhenji-ang aromatic vinegar (16). Thus, it is of interest to understandwhich microbes are driving the formation of the acetoin-diacetyl-2,3-BDO group to elucidate the microbial distribution discrep-ancy in the diacetyl/acetoin metabolic pathway and to regulatemetabolic function of the functional microbial group in vinegarmicrobiota.

In this study, the microbial functional group driving acetoinformation in vinegar microbiota was predicted by a combinationof metagenomic sequencing and gene-targeted clone library anal-ysis. The species distribution discrepancy in the diacetyl/acetoinmetabolic pathway was revealed. Furthermore, functional specieswere isolated from vinegar microbiota by a culture-dependentmethod, and their acetoin-producing function was evaluated viamono- and coculture fermentation experiments. Last, the aceto-in-producing function of vinegar microbiota was regulated in situby augmenting functional species in vinegar Pei.

MATERIALS AND METHODSAcetic acid fermentation of Zhenjiang aromatic vinegar. AAF was car-ried out in an open work environment with nonautoclaved raw materials.Glutinous rice is the raw material in starch saccharification and alcoholfermentation of Zhenjiang aromatic vinegar, which are similar to the tech-niques used for rice wine production (17). The rice wine (6.3 m3) fromalcohol fermentation was mixed with wheat bran (2,550 kg) and rice hull(720 kg) in an AAF pool (0.8 m by 1.5 m by 11 m). Vinegar Pei on the 7thday from the last AAF batch was used as the starter (inoculum size, 10%)to initiate AAF. The AAF process lasted 18 days, and the temperature andhumidity of Pei were maintained at 40 to 46°C and 60 to 70%, respectively.

A sterilized cylinder-shaped sampler (Puluody, Xi’an, Shanxi, China) wasused to collect Pei on the 7th day (about 500 g) from top to bottom at thecenter of three parallel AAF pools. The Pei was homogenized thoroughlyin a sterile plastic bag and stored at �80°C immediately before furtheranalysis.

Genomic DNA extraction, library construction, and metagenomicsequencing. Our previous study revealed that the pattern of bacterialcommunity succession and flavor formation in vinegar Pei showed batch-to-batch uniformity, and the microbial structures of starters among dif-ferent AAF batches were highly similar (similarity of 90%) (5). Here, weused mixed vinegar Pei on the 7th day from three parallel AAF pools as arepresentative sample for metagenomic sequencing. Vinegar Pei sampleson the 7th day (about 500 g) were homogenized thoroughly in a sterileplastic bag. Then, the mixed Pei on the 7th day (10 g) was ground intopowder with liquid nitrogen, and 0.5 g of Pei powder was used for theextraction of genomic DNA with a PowerSoil DNA isolation kit (Mo BioLaboratories, Inc., Carlsbad, CA, USA). The concentration of total DNAwas measured using a DyNA Quant 200 fluorometer (Hoefer, San Fran-cisco, CA, USA). DNA purity was determined by A260/A280. DNA integritywas verified by 1% agarose gel electrophoresis under UV light. The DNAwas stored at �20°C before further processing.

DNA library preparation followed the manufacturer’s instructions(Illumina). The same workflow as described elsewhere was used to per-form cluster generation, template hybridization, isothermal amplifica-tion, linearization, blocking and denaturization, and hybridization of thesequencing primers. The base-calling pipeline (Illumina Pipeline version0.3) was used to process the raw fluorescent images and call sequences. Weconstructed one library (insert size, 330 bp) for the sample. The librarywas sequenced on an Illumina HiSeq 2000 platform and paired-end readswith approximate lengths of 100 bp were generated.

Taxonomic and functional assignment of metagenomic reads. Theraw reads in metagenomic sequencing files were trimmed using Trimmo-matic to remove adaptors and the reads with low quality (18). Taxonomicand functional assignment of trimmed reads was carried out usingMetaCV (19), which is a composition-based algorithm to classify shortmetagenomic reads (75 to 100 bp) into specific taxonomic and functionalgroups. For the taxonomic assignment, DNA reads were annotated withthe GenBank reference database. For the functional assignment, DNAreads were annotated with the KEGG reference database. As a result, thespecific organisms that participate in the diacetyl/acetoin metabolic path-way were identified.

Degenerate primer design, PCR, and clone library analysis. Degen-erate primers were designed to probe DR genes. A total of 32 proteinsequences known to be responsible for DR were acquired from GenBankand aligned using ClustalW. Conserved regions in the gene were identifiedwith Block Maker and then used to design consensus-degenerate hybridoligonucleotide primers (CODEHOP) (20). Primer specificity was vali-dated with genomic DNA prepared with a genomic DNA extraction kit(Generay, Shanghai, China) from pure cultures of 32 bacterial strains (seeTable S1 in the supplemental material). The degenerate primers set weredr-f (AGCTATAGTTACAGGGGCCgsncrrggnat) and dr-r (GACGATCCCTGGGCAGwanscrttnac). The amplicon size was 513 bp.

PCR was performed on a T100 thermal cycler (Bio-Rad, Hercules, CA,USA) with primers and Ex Taq polymerase (TaKaRa, Tokyo, Japan) in aworking volume of 25 �l. PCRs were performed at 95°C for 3 min, fol-lowed by 30 cycles at 95°C for 40 s, 54°C for 40 s, and 72°C for 40 s, and afinal extension at 72°C for 10 min. The PCR product was purified with anagarose gel extraction kit (Generay, Shanghai, China), cloned into T-vec-tor pMD19 (TaKaRa), and transformed into Escherichia coli JM109 cells.Randomly chosen clones were amplified and sequenced by a 3730XL DNAanalyzer (ABI, Carlsbad, CA, USA).

Isolation of acetic acid bacteria and lactic acid bacteria. Vinegar Pei(10 g) in the AAF was suspended in sterile physiological saline (90 ml)with glass beads in a 500-ml Erlenmeyer flask and incubated at 30°C for 30min with shaking at 200 rpm. Then the solution in the flask was serially

Acetoin Producers in Multispecies Vinegar Fermentation

October 2016 Volume 82 Number 19 aem.asm.org 5861Applied and Environmental Microbiology

on April 18, 2020 by guest

http://aem.asm

.org/D

ownloaded from

diluted, ranging from 10�2 to 10�5. For acetic acid bacteria (AAB) isola-tion, 200 �l of diluent was spread onto GYC agar, GYEC medium (9), ormodified YPM medium (1% soft calcium carbonate, 1.2% agar, 0.5%ethanol) (21). Small colonies with transparent circles and different colonymorphology were selected after incubation at 30°C for 2 to 3 days. Lacticacid bacteria (LAB) were isolated by the pour plate method with de Man-Rogosa-Sharpe (MRS) agar medium (22) or Elliker medium (23) with0.04% bromocresol purple as director. After 2 to 3 days of incubation at37°C, single colonies were picked up from the plates. The isolates which wereGram negative, catalase positive, and oxidase negative, had ellipsoidal-to-rod morphology, and grew individually, in pairs, or in short chains weresupposed to be AAB; the isolates which were Gram positive, catalase neg-ative, and oxidase-negative, had rod-to-coccoid morphology, and grewsingly, in pairs, or in short chains were supposed to be LAB.

For the AAB phenotypic diversity, the following tests were performed:ethanol tolerance (5%, 10%, 15%, 20% [vol/vol]), acetic acid tolerance(3%, 5% [wt/vol]), bacterial cellulose production, temperature-tolerantproperty (45°C), and growth on a single carbon source (24). For the LABphenotypic diversity, the following tests were performed: biogas, Voges-Proskauer (V-P), gelatin hydrolysis, high temperature resistance (40°Cand 45°C), arginine hydrolysis, hydrogen sulfide production, 7% and 10%NaCl tolerance, litmus milk, and sole carbon source to produce acid (1%soft calcium carbonate, 1.5% agar, and 2% sole carbon source: glucose,acetate, lactate, fructose, maltose, mannitol, sucrose, and glycerol; baseculture medium: 1% tryptone, 1% beef extract, 0.5% yeast extract, 0.2%K2HPO4, 0.058% MgSO4, 0.019% MnSO4, and 1% [vol/vol] Tween 80).

On the basis of the phenotypic characters, representative isolates ofAAB and LAB were selected for 16S rRNA gene sequencing with primer setP0 (GAGAGTTTGATCCTGGCTCAG) and P6 (CTACGGCTACCTTGTTACGA), which were located in the E. coli rRNA gene positions 27f and1495r, respectively (25). The sequencing analysis was performed by theSangon Biotech Co., Ltd. (Shanghai, China), and the sequencing resultswere subjected to a BLAST search at NCBI.

Phylogenetic trees based on the 16S rRNA gene sequences of AAB andLAB were constructed by using the maximum likelihood method (1,000times bootstrap) based on the general time reversible model. Evolutionaryanalyses were conducted in MEGA6.

Mono- and coculture fermentations of functional microbes. Mono-and coculture fermentations of four strains (Acetobacter pasteurianusG3-2, Lactobacillus buchneri F2-5, Lactobacillus brevis 4-22, and Lactoba-cillus fermentum M10-3) were carried out in 250-ml Erlenmeyer flaskscontaining 50 ml of MRS medium (Oxoid) supplemented with 5% etha-nol. Coculture flasks were inoculated with 0.2 ml of A. pasteurianus and0.2 ml of Lactobacillus sp. Monoculture controls were inoculated withvolumes identical to those for the coculture flasks. Each culture was incu-bated at 37°C and shaken for 6 h at 300 rpm every 12 h. Each experimentwas carried out at least three times and in triplicate each time. Duncan’smultiple-range test was used to determine the significant differences. Dif-ferences at a P level of �0.05 were considered statistically significant.

Quantitative real-time PCR (qPCR) was used to quantify the bio-masses of LAB and AAB in mono- and coculture fermentations. qPCRamplification and detection were performed in a Chromo4 real-time4-color 96-well PCR system (MJ Geneworks, USA) with a commercialmixture kit (SYBR Premix Ex Taq; TaKaRa, Dalian, China). Specific prim-ers and PCR conditions for quantification of LAB and AAB were reportedin previous studies (4).

Regulation of the acetoin-producing function of vinegar microbi-ota. A. pasteurianus G3-2 was inoculated aerobically in GYC medium (9)supplemented with 3% ethanol and incubated aerobically at 30°C for 24 hin a rotary shaker. Inocula of L. brevis 4-22, L. fermentum M10-3, and L.buchneri F2-5 were prepared in MRS medium (22) and incubated stati-cally at 30°C for 24 h. All of the strains were propagated twice to obtainfinal cultures. During culture, the transferred volume was 1% (vol/vol).Cells in the final cultures were spun down (8,000 � g, 10 min) and resus-pended in phosphate-buffered saline (PBS) solution. The cell concentra-

tions of the microbial suspension liquids were adjusted to 1012 CFU/mlusing optical density.

A total of 8 kg of vinegar Pei on the 7th day was collected from top tobottom at the center of the AAF pool (0.8 m � 1.5 m � 11 m) and mixedthoroughly. The mixed Pei (1 kg) was placed in a plastic bucket (14 cminside diameter [i.d.], 18 cm height). Suspension liquids of A. pasteuria-nus G3-2 (100 ml), L. brevis 4-22 (100 ml), L. fermentum M10-3 (100 ml),L. buchneri F2-5 (100 ml), A. pasteurianus G3-2 (50 ml) plus L. brevis 4-22(50 ml), A. pasteurianus G3-2 (50 ml) plus L. fermentum M10-3 (50 ml),and A. pasteurianus G3-2 (50 ml) plus L. buchneri F2-5 (50 ml) were addedinto the Pei in the plastic bucket, respectively. In the control group, 100 mlof PBS solution was added into the Pei. Vinegar Pei in the plastic bucketwas mixed once a day, and three replicates of the mixed Pei were sampledfrom three different points near the center of the plastic bucket for thedetermination of acetoin content. All experiment groups were sampledthree times using separate batches of Pei. Dunnett’s t test (two-sided) wasused to determine the significance.

Flavor metabolite analyses. Quantitative analyses of diacetyl, acetoin,2,3-BDO, and TTMP in vinegar Pei were performed using a GC-2010 gaschromatograph (Shimadzu Co., Kyoto, Japan) with a headspace autosam-pler (TurboMatrix 16; PerkinElmer Inc., USA). The column was a DB-23(60 m length, 0.32 mm i.d., 0.25 �m film thickness; Agilent Technologies,Santa Clara, CA, USA). Nitrogen was used as the carrier gas at a constantflow rate of 1.5 ml/min. The injector and detector temperatures were200°C and 250°C, respectively. The gas chromatograph oven temperaturewas maintained at 40°C for 5 min, raised at 10°C/min to 180°C, and heldfor 5 min. Contents of diacetyl, acetoin, 2,3-BDO, and TTMP in the Peiwere determined by the external standard method, with standard chemi-cals from Sigma-Aldrich Inc., Shanghai, China.

In the monoculture and coculture broths of functional microbes, con-tents of acetate and lactate were analyzed by reversed-phase high-perfor-mance liquid chromatography(HPLC) (Waters Atlantis T3 column, 4.6by 250 mm; UVD, 210 nm). The mobile phase was sodium dihydrogenphosphate at 20 mM (pH 2.7).

Accession number(s). Sequences of 16S rRNA gene have been sub-mitted to the GenBank database, and the accession numbers are fromKF030726 to KF030792.

RESULTSSpecies distribution discrepancy in the diacetyl/acetoin meta-bolic pathway. Various microorganisms participated in the deg-radation of substrates and the formation of flavors in the micro-bial community of Zhenjiang aromatic vinegar. In this study, twoseparate 9.3-Gbp sequence files resulted from the Illumina paired-end sequencer. The numbers of raw read pairs and trimmed readpairs were 40,302,838 and 38,936,447, respectively. Short metag-enomic sequence reads (75 to 100 bp) were classified into specifictaxonomic and functional groups by MetaCV, and the number ofannotated read pairs was 6,595,146. The diacetyl/acetoin meta-bolic pathway in the AAF ecosystem was reconstructed based onthe results of MetaCV.

The relationship between microorganisms and enzymes in thediacetyl/acetoin metabolic pathway is illustrated in Fig. 1, in whichDNA reads encoding enzymes are proportional to the diametersof bubbles. The read numbers of acetolactate synthase (ALS),ALDC, BDH, and ketol-acid reductoisomerase (KARI) genes were47,792, 11,048, 11,068, and 32, respectively. Here, ALS is part ofthe biosynthesis of branched-chain amino acids (see Fig. S1 in thesupplemental material). As shown in Fig. 1, various microorgan-isms harbored the ALS enzyme, including Euryarchaeota, Actino-bacteria, Bacteroidetes, Cyanobacteria, Elusimicrobia, Bacillales,Lactobacillus, Leuconostocaceae, Clostridia, Rhizobiales, Rhodobac-terales, Acetobacter, Burkholderiales, Betaproteobacteria, Entero-

Lu et al.

5862 aem.asm.org October 2016 Volume 82 Number 19Applied and Environmental Microbiology

on April 18, 2020 by guest

http://aem.asm

.org/D

ownloaded from

bacteriales, Pseudomonadales, and Deltaproteobacteria, and likelyparticipated in the formation of 2-acetolactate. Actinobacteria,Lactobacillus, Mollicutes, and Acetobacter likely participated in theformation of acetoin-diacetyl-2,3-BDO group (Fig. 1), while a fewmicroorganisms, mainly Acetobacter, might function as a KARIproducer.

Species-level diversities of ALS, ALDC, and BDH genes areshown in Fig. 2. L. buchneri (21.0%) and A. pasteurianus (5.8%)might be the major potential ALS producers. L. buchneri (26.5%),Lactobacillus reuteri (11.6%), A. pasteurianus (5.6%), L. fermen-tum (3.2%), and L. brevis (2.8%) might contribute to the produc-tion of ALDC. Diverse species such as Mycoplasma hominis(19.4%), Lactobacillus salivarius (5.3%), Corynebacterium efficiens(3.2%), Rhodococcus jostii (2.1%), and Clostridium lentocellum(1.9%) likely participated in the formation of 2,3-BDO. As forKARI, A. pasteurianus (62.5%) and Streptococcus infantariussubsp. infantarius (6.2%) might be the major potential producers.

The information about the DNA reads encoding enzyme DRwas not obtained from the MetaCV analysis result, which indi-cated that DR-producing microorganisms might be scarce (notabundant enough) in vinegar Pei on the 7th day. To understandthe phylogenetic diversity of DR producers, we analyzed vinegarmicrobiota by the clone library method using amplified fragmentsof the DR gene with degenerate primers. As shown in Fig. 2, theenzyme DR that metabolizes diacetyl into acetoin was mainly as-sociated with Bifidobacterium indicum and L. fermentum. It isworth mentioning that the degenerate primers used in this studylack some specificity since some strains known to contain the DRgene, such as L. helveticus (see Table S1 in the supplemental ma-terial), did not amplify with their primers. Thus, the DR variantsin vinegar Pei that do not map to known sequences might haveresulted in the underestimate of DNA reads encoding enzyme DR.

Isolation and identification of AAB and LAB. According tothe metagenomic sequencing results, A. pasteurianus, L. buchneri,L. fermentum, and L. brevis were determined to be potential func-tional producers for acetoin from 2-acetolactate in vinegar micro-biota (Fig. 2). Thus, we used the culture-dependent method toisolate these species from vinegar Pei. A total of 112 isolates, in-cluding 53 presumed AAB and 59 presumed LAB were picked upfrom the plates and purified at least two times by streaking forisolation. Based on physiological and biochemical tests, 35 AABstrains and 30 LAB strains were selected to be identified at thespecies level by 16S rRNA gene sequencing. Phylogenetic treesbased on the 16S rRNA gene and phenotypic characteristics ofAAB and LAB in vinegar Pei are shown in Fig. 3 and 4.

All of the AAB isolates were clustered into 16 groups (Fig. 3).Six isolates were clustered together with A. pasteurianus SKU1108,and 3 isolates were identical to Acetobacter pomorum. Phenotypictests showed that there is a high degree of variability for almost allthe traits considered among A. pasteurianus strains. Gluconaceto-bacter intermedius 1-6 and Gluconacetobacter xylinus (1-15 and1-17) could produce bacterial cellulose. LAB showed great diver-sity with 15 groups belonging to 8 Lactobacillus species, includingL. fermentum, L. pontis, L. casei/paracasei, L. hilgardii, L. buchneri,L. brevis, L. plantarum, and L. helveticus (Fig. 4).

Mono- and coculture fermentation of Acetobacter and Lac-tobacillus strains. Acetoin-producing functions of the isolated A.pasteurianus G3-2, L. brevis 4-22, L. fermentum M10-3, and L.buchneri F2-5 were evaluated in mono- and coculture fermenta-tion experiments (Table 1). Biomasses of A. pasteurianus G3-2, L.buchneri F2-5, L. brevis 4-22, and L. fermentum M10-3 in all of themono- and coculture fermentation experiments were on the sameorder of magnitude (1012 copies/ml), indicating the growth ofthese cells in the flask (Table 1).

FIG 1 Taxonomic distribution and enzyme reads for flavor formation in the diacetyl/acetoin metabolic pathway in the microbial community of Zhenjiangaromatic vinegar. The diameters of bubbles are proportional to the read numbers of enzymes. ALS, acetolactate synthase; BDH, butanediol dehydrogenase;ALDC, acetolactate decarboxylase.

Acetoin Producers in Multispecies Vinegar Fermentation

October 2016 Volume 82 Number 19 aem.asm.org 5863Applied and Environmental Microbiology

on April 18, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Compared to that in the control group (3.2 � 0.7 mg/liter), theacetoin concentration in the monoculture of A. pasteurianus G3-2(3.6 � 1.7 mg/liter) did not significantly increase in the MRS-ethanol medium (P � 0.05). L. fermentum M10-3 in the monocul-ture significantly enhanced its acetoin production (103.3 � 9.9mg/liter) (P � 0.05), while acetoin concentrations in the mon-ocultures of L. brevis 4-22, and L. buchneri F2-5 were not signifi-cantly different from that in the control group (P � 0.05). Theacetoin concentrations in two cocultures (L. brevis 4-22 plus A.pasteurianus G3-2, and L. fermentum M10-3 plus A. pasteurianusG3-2) were significantly higher than those in the LAB monocul-tures (P � 0.05). However, L. buchneri F2-5 did not produce moreacetoin when coinoculated with A. pasteurianus G3-2 (P � 0.05).

Compared with that in the monoculture of A. pasteurianusG3-2 (16.0 � 0.2 g/liter), the acetate concentration was signifi-cantly enhanced in the cocultures of L. fermentum M10-3 plus A.pasteurianus G3-2 (24.1 � 1.0 g/liter) (P � 0.05). However, ace-tate production in the coculture of L. brevis 4-22 plus A. pasteur-ianus G3-2 (6.3 � 1.7 g/liter) was significantly lower than that inthe monoculture of A. pasteurianus G3-2 (16.0 � 0.2 g/liter) (P �0.05).

All three LAB strains tested in this study produced lactate in theMRS-ethanol medium, while only 0.1 g/liter lactate was detectedin the monoculture of A. pasteurianus G3-2 (Table 1). Lactateconcentrations were increased in the cocultures of L. brevis 4-22plus A. pasteurianus G3-2 (3.7 � 0.2 g/liter) and L. buchneri F2-5

plus A. pasteurianus G3-2 (3.6 � 0.3 g/liter); however, they weredecreased in the cocultures of L. fermentum M10-3 plus A. pasteu-rianus G3-2 (0.5 � 0.0 g/liter).

Regulation of acetoin-producing function of vinegar micro-biota. Effects of functional microbe augmentation on the acetoincontent in vinegar Pei are shown in Fig. 5. In the bioaugmentationexperiment, the temperature of vinegar Pei in all groups variedbetween 44 to 47°C (data not shown). After 24 h of fermentation,the acetoin contents in all bioaugmented vinegar Pei were lowerthan that in the control group (Table 1). The acetoin content inthe vinegar Pei augmented with A. pasteurianus G3-2 plus L. fer-mentum M10-3 (3.3 � 0.7 mg/g Pei) was significantly lower thanthat in the control group (6.2 � 0.7 mg/g Pei) (P � 0.05). After 72h of fermentation, the acetoin contents in vinegar Pei that wasaugmented with A. pasteurianus G3-2 plus L. brevis 4-22 (12.5 �1.2 mg/g Pei), L. fermentum M10-3 (9.3 � 1.4 mg/g Pei), and L.buchneri F2-5 (15.4 � 2.6 mg/g Pei) were significantly increasedcompared with that in the control group (6.8 � 0.1 mg/g Pei)(Fig. 5).

DISCUSSION

The multispecies microbial community formed through cen-turies of repeated batch AAF accounts for the flavor quality ofcereal vinegar. However, the specific vinegar microorganismsresponsible for the flavor formation have not yet been identi-fied. Elucidation of the molecular mechanisms underlying the

Lactobacillus buchneri (19.1%)

unclassified Bacteria (13.9%)

Acetobacter pasteurianus (5.8%)

unclassified Lactobacillus (5.4%)

unclassified organisms (4.0%)

unclassified Bacilli (2.0%)

Lactobacillus buchneri NRRL B-30929 (1.9%)

unclassified Proteobacteria (1.6%)

uncultured Termite group 1 bacteriumphylotype Rs-D17 (1.3%)Crinalium epipsammum PCC 9333 (1.2%)

Bacteroides xylanisolvens XB1A (1.1%)

species <1% rela�ve abundance (42.9%)

ALSreads: 47792

(68.33%, 0.72% )

Lactobacillus buchneri (14.9%)

unclassified Bifidobacterium (13.3%)

Lactobacillus buchneri CD034 (11.6%)

Lactobacillus reuteri (11.6%)

unclassifed Bacteria (10.6%)

unclassified Lactobacillus (6.0%)

Acetobacter pasteurianus (5.6%)

Lactobacillus fermentum (3.2%)

Lactobacillus brevis (2.8%)

Rothia dentocariosa ATCC 17931 (1.6%)

Vibrio sp. Ex25 (1.3%)

Sphaerochaeta pleomorpha str. Grapes (1.0%)

species <1% rela�ve abundance (16.4%)

ALDCreads: 11048

(15.80%, 0.17%)

Mycoplasma hominis ATCC 23114 (19.4%)

unclassified organisms (18.2%)

unclassified Bacteria (11.1%)

unclassified Lactobacillus (5.4%)

Lactobacillus salivarius (5.3%)

unclassified Proteobacteria (4.7%)

Corynebacterium efficiens YS-314 (3.2%)

unclassied Acetobacteraceae (2.2%)

Rhodococcus jos�i RHA1 (2.1%)

Clostridium lentocellum DSM 5427 (1.9%)

Desulfotalea psychrophila LSv54 (1.6%)

Lactobacillus plantarum (1.4%)

Gluconobacter oxydans 621H (1.1%)

Lactobacillus reuteri (1.1%)

species <1% rela�ve abundance (21.4%)

BDHreads: 11068

(15.82%, 0.17%)

6425

33

3 3 1 1 1 1

DR

OTU1: Bifidobacterium indicum LMG 11587 = DSM 20214 [CP006018.1]

OTU2: Lactobacillus fermentum CECT 5716 [CP002033.1]

OTU3: Klebsiella oxytoca strain M5al [GQ253371.1]

OTU4: Enterobacter sacchari SP1 [CP007215.2]

OTU5: Pantoea vagans C9-1 [CP001893.1]

OTU6: Lactobacillus mucosae LM1 [CP011013.1]

OTU7: Klebsiella oxytoca E718 [CP003683.1]

OTU8: Ochrobactrum anthropi strain OAB [CP008820.1]

OTU9: Klebsiella pneumoniae subsp. pneumoniae KPNIH27 [CP007735.1]

OTU10: Enterobacter cloacae subsp. cloacae NCTC 9394 [FP929040.1]

FIG 2 Species-level diversities of ALS, ALDC, and BDH genes analyzed by metagenomic sequencing and the DR gene by clone library. Numbers in parenthesesshow the percentages of sequence reads in the total enzyme read. Numbers in brackets show the proportion of total enzyme reads in the diacetyl/acetoin metabolicpathway (including ALS, ALDC, and BDH) and the proportion of total enzyme reads in all the annotated reads. Numerals in the pie chart show the numbers ofclones. ALS, acetolactate synthase; ALDC, acetolactate decarboxylase; BDH, butanediol dehydrogenase; DR, diacetyl reductase.

Lu et al.

5864 aem.asm.org October 2016 Volume 82 Number 19Applied and Environmental Microbiology

on April 18, 2020 by guest

http://aem.asm

.org/D

ownloaded from

effects of vinegar microbiota has been complicated by difficul-ties in linking the metabolic functions associated with the mi-crobial community as a whole to individual microorganismsand activities. In this study, we linked the relative abundancesof members of the microbial community, estimated on thebasis of annotated read counts in the metagenome, to KEGG-based reconstructed diacetyl/acetoin metabolic pathway withthe objective of identifying potential functional producers ofacetoin. Various microorganisms that originated from thestarter, the raw materials, and the environment of AAF weredetected. Most taxa in Fig. 1, including archaeota (Crenar-chaeota and Euryarchaeota), have not been reported as acetoinproducers in vinegar microbiota in previous studies due to theinability to isolate them by a culture-dependent method. After theAAF phase is finished, the microorganisms in raw vinegar, includ-ing some conditional pathogenic bacteria (e.g., enterobacteria andRothia) are killed by decoction (5). It is also worth noting thatroughly half of the genes identified from whole-community met-agenomic sequencing encode products of unknown function, andexisting functional annotations are often incomplete or inaccu-rate (26). In this study, Mycoplasma hominis was presumed to bethe major source of BDH activity (19% of sequence reads in thetotal BDH enzyme read) (Fig. 2), yet Mycoplasma species areknown to be very fastidious commensal bacteria and pathogens atthe mucosa. Since Mycoplasma strains belong to the group of low-GC, Gram-positive bacteria, it is probable that these sequences

belong to microorganisms such as lactic acid bacteria and bacilli.Thus, as the information in the GenBank and KEGG referencedatabases is improved, the taxonomic and functional assignmentof metagenomic reads in this study will be more accurate.

According to the results of MetaCV analysis, no DNA readencoding DR enzyme was detected, which indicated that DR-pro-ducing microorganisms might be scarce (not abundant enough)in vinegar Pei on the 7th day. However, the numbers of DNA readsencoding ALS and ALDC were large. This result demonstratedthat a large proportion of acetoin in vinegar Pei on the 7th daymight be biosynthesized directly from 2-acetolactate. Actinobac-teria, Lactobacillus, Mollicutes, and Acetobacter likely participatedin the formation of acetoin, diacetyl, and 2,3-BDO (Fig. 1). Fur-ther analysis of the species-level diversities of ALS and ALDCgenes revealed that A. pasteurianus and 4 Lactobacillus species (L.buchneri, L. reuteri, L. fermentum, and L. brevis) might be the ma-jor potential producers of acetoin from 2-acetolactate in vinegarmicrobiota. Besides Lactobacillus, Mollicutes, and Acetobacter,many genera in Enterobacteriales (e.g., Klebsiella, Enterobacter, andSerratia), Cyanobacteria (e.g., Synechocystis), and Clostridia (e.g.,Clostridium) have been reported for their ability to produce ace-toin and 2,3-BDO (11, 27–29).

According to the annotation results of the metagenomicreads, some major acetoin producers, including A. pasteurianusG3-2, L. buchneri F2-5, L. fermentum M10-3, and L. brevis 4-22,were isolated from vinegar Pei by a culture-dependent method.

G3-3 (KF030742)G7-2 (KF030751)

G3-7 (KF030744)G7-5 (KF030753)

G3-2 (KF030741)G3-12 (KF030748)A. pasteurianus SKU1108 (AB499842.1)

G15-6 (KF030772)G17-12 (KF030784)

G15-7 (KF030774)A. pomorum (AJ001632.1)

E13-2 (KF030766)G17-13 (KF030786)

1-6 (KF030728)G. intermedius TF2 (NR 026435.1)

1-15 (KF030729)1-17 (KF030730)

G. xylinus strain L96 (JX283294)1-5 (KF030727)G7-3 (KF030791)99

59

60

28

100

97

65

8689

87

62

0.005

45º C

10%

Eth

anol

5% A

cetic

acid

Etha

nol

Glu

cose

Ace

tate

Lact

ate

Fruc

tose

Gly

cero

l

Man

nito

l

Sorb

itol

Sucr

ose

Mal

tose

Glu

tam

ine

Bac

teria

lcel

lulo

se

V-P

+ + + + + + + - - - - w - w - -

+ + - + - + + w - + - - - - - -+ + + + - + + - - - w w - - - -+ + - + + + + - - w w - - + - -- + - + + + + - - - - - - + - -- - - + + + + - - - - + - + - -

- - + w + + + - - - - - - - - -- - - + - + + - - + + + - + - -- - + + + - + - - + + - - - - -

+ - + + - + + - - - + - - - - -- - + + - + + w - - - + - - - -- - - + + + + - - - - - - - + +

- - - + + + + - - - - - - - + +- - - + + + + - - - - - - - + +

+ - - + + + + + + + + w - - - ++ - - + + + + + + + + - - - - +

FIG 3 A phylogenetic tree based on 16S rRNA gene sequences of acetic acid bacteria in vinegar Pei constructed by the maximum likelihood method. Numeralsat the nodes indicate bootstrap values (percentages) derived from 1,000 replications. All strains are Gram positive, catalase negative, and oxidase negative. �,positive; w, weak (for single carbon tests: �, produce acid; �, cannot produce acid; w, produce little acid; for glycerol and rhamnose tests: �, growth; �, cannotgrow; w, weak growth).

Acetoin Producers in Multispecies Vinegar Fermentation

October 2016 Volume 82 Number 19 aem.asm.org 5865Applied and Environmental Microbiology

on April 18, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Via mono- and coculture fermentation experiments, we foundlittle acetoin in the monocultures of A. pasteurianus G3-2 and L.brevis 4-22, but it existed in the coculture of A. pasteurianus G3-2plus L. brevis 4-22 (Table 1). In the study of Moens et al. (30), A.

pasteurianus 386B oxidized lactic acid into acetoin and acetic acidin cocoa pulp simulation medium. In this study, there was littlelactic acid in the MRS-ethanol medium supplemented with 5%ethanol (Table 1), which might be the reason that acetoin was

L. fermentum NRIC 0145 (AB362626.1)M10-4 (KF030759.1)

M10-5 (KF030760.1)M10-3 (KF030758.1)

E10-19 (KF030776.1)

L. pontis LTH 2587 (NR_036788.1)M17-3 (KF030752.1)M17-4 (KF030783.1)

E1-1 (KF030732.1)

M1-5 (KF030743.1)

L. paracasei DJ1 (DQ462440.1)L. casei ATCC 334 (NR_075032.1)

E10-1 (KF030764.1)

L. hilgardii YIT 0269 (AB429370.1)M3-4 (KF030792.1)

L. buchneri JCM 1115 (NR_041293.1)F2-5

L. brevis ATCC 367 (NR_075024.1)4-22

L. plantarum WCFS1 (NR_075041.1)M10-1 (KF030756.1)

L. helveticus MG5-1 (EF536362.1)GE1-2 (KF030740.1)M3-1 (KF030750.1)

Clostridium butyricum JCM 1391 (NR_113244.1)

100

100

100

57

100

98

6890

7599

40

30

49

17

7264

100

0.02

Glu

cose

Fruc

tose

Mal

tose

Sorb

itol

Man

nito

l

Sucr

ose

Gly

cero

l

Gas

pro

duct

ion

V-P

7%N

aCl

H2S

pro

duct

ion

W

W W

W

W W

W

W

W

FIG 4 A phylogenetic tree based on 16S rRNA gene sequences of lactic acid bacteria in vinegar Pei constructed by the maximum likelihood method. Numeralsat the nodes indicate bootstrap values (%) derived from 1,000 replications. All strains are Gram positive, catalase negative, and oxidase negative. �, positive; w,weak (for single carbon tests: �, produce acid; �, cannot produce acid; w, produce little acid; for glycerol and rhamnose tests: �, growth; �, cannot grow; w,weak growth).

TABLE 1 Concentrations of acetoin, acetate, and lactate in the monocultures and cocultures of isolated LAB and AABa

Group

Biomass (1012 copies/ml)b

Acetoin concn (mg/liter) Acetate concn (g/liter) Lactate concn (g/liter)Acetobacter Lactobacillus

Control 3.2 � 0.7 A 2.6 � 0.2 A 0.1 � 0.0 AA. pasteurianus G3-2 0.9 � 0.0 3.6 � 1.7 A 16.0 � 0.2 D 0.1 � 0.0 AL. brevis 4-22 0.4 � 0.1 3.1 � 1.4 A 9.2 � 0.2 C 2.8 � 0.1 CL. brevis 4-22 � A. pasteurianus G3-2 0.6 � 0.1 0.4 � 0.1 31.3 � 0.7 B 6.3 � 1.7 B 3.7 � 0.2 DL. fermentum M10-3 1.9 � 0.4 103.3 � 9.9 C 16.0 � 3.0 D 1.8 � 0.5 BL. fermentum M10-3 � A. pasteurianus G3-2 1.1 � 0.3 1.1 � 0.3 135.4 � 12.1 D 24.1 � 1.0e 0.5 � 0.0 AL. buchneri F2-5 0.2 � 0.1 5.9 � 0.3 A 10.0 � 0.0 C 3.0 � 0.1 CL. buchneri F2-5 � A. pasteurianus G3-2 0.8 � 0.1 0.3 � 0.1 6.8 � 0.9 A 9.8 � 0.3 C 3.6 � 0.3 Da Values are expressed as means � SD and compared by Duncan’s multiple-range test. Means in a column followed by different letters are significantly different at a P valueof �0.05.b 1012 copies of 16S rRNA gene per milliliter.

Lu et al.

5866 aem.asm.org October 2016 Volume 82 Number 19Applied and Environmental Microbiology

on April 18, 2020 by guest

http://aem.asm

.org/D

ownloaded from

hardly formed in the monoculture of A. pasteurianus G3-2.When coinoculated with L. fermentum M10-3, A. pasteurianusG3-2 likely utilized the lactic acid produced by Lactobacillusstrains to produce acetoin (Table 1). In the three isolated Lac-tobacillus strains, L. fermentum M10-3 produced more acetointhan the other two Lactobacillus strains (L. brevis 4-22 and L. bu-chneri F2-5) in coculture with A. pasteurianus G3-2 in the MRS-ethanol medium (Table 1). However, it could not be concludedthat L. fermentum M10-3 was the only major acetoin producerin vinegar Pei, because of the inability to isolate many othermicroorganisms by a culture-dependent method and the met-abolic difference of L. fermentum M10-3 in vitro and in situ. Itwas found that the acetoin productions of the same bacterialstrains were inconsistent between MRS-ethanol medium andvinegar Pei because of the differences in nutritional composi-tion and environmental conditions (Table 1 and Fig. 5).

In this study, a representative single sample, the Pei on the 7thday of AAF, was collected to determine metagenomic sequencing,acetoin metabolic pathway reconstruction, and a bioaugmenta-tion experiment. It stands to reason that the metabolic role of anygiven species in the context of the community may vary along withfermentation time. Our previous study showed different patternsof community assembly in different AAF stages of Zhenjiang aro-matic vinegar (5). For example, the relative abundance of Lacto-bacillus in the vinegar microbiota dramatically increased on thefirst day of AAF and then decreased gradually. However, the rela-tive abundance of Acetobacter kept increasing during the wholefermentation process (5). Thus, the bubble size representing therelative abundance of an enzyme gene in Fig. 1 and the speciesassembly of the enzyme gene in Fig. 2 might change along with thefermentation time. It will be of interest in the future to explore

the successions of taxonomic distribution and enzyme abun-dance in the diacetyl/acetoin metabolic pathway in the vinegarmicrobiota of Zhenjiang aromatic vinegar. Otherwise, as re-ported previously, endpoint metagenomes, which just tell uswhich organisms are present in the actual sample and whichhave been present at some point in the process but may havedied and left their DNA, are traces in the sample (31). As such,unraveling the dynamic expression of genes in vinegar micro-biota by metatranscriptomic and metaproteomic approaches isongoing in further studies.

To conclude, we provided a collection of genes from the knowndiacetyl/acetoin pathway by using deep sequencing of vinegar mi-crobiota, bridging an important gap, to accurately assess theflavor-producing potential of complex microbial communitiesfrom omics-derived data. Furthermore, according to the informa-tion on potential acetoin producers, we obtained A. pasteurianus,L. buchneri, L. fermentum, and L. brevis strains from vinegar Peiwith selective culture media. The acetoin-producing functions ofthese strains were evaluated in vitro. Last, the acetoin-producingfunctions of vinegar microbiota were regulated in situ by augmen-tation of A. pasteurianus G3-2 plus L. brevis, L. fermentum M10-3,and L. buchneri F2-5 in the vinegar Pei.

ACKNOWLEDGMENTS

This work was supported by two grants from the National NatureScience Foundation of China (no. 31271922 and 31530055), threegrants from the High Tech Development Program of China (863 Proj-ect) (no. 2012AA021301, 2013AA102106, and 2014AA021501), and agrant from the Ministry of Education of the People’s Republic of China(JUSRP51516).

0

2

4

6

8

10

12

14

16

18

20

0 24 48 72

Ace

toin

cont

ent (

mg/

g Pe

i)

Fermentation time (h)

Control

A. pasteurianus G3-2

L. brevis 4-22

A. pasteurianus G3-2 + L. brevis 4-22

L. fermentum M10-3

A. pasteurianus G3-2 + L. fermentum M10-3

L. buchneri F2-5

A. pasteurianus G3-2 + L. buchneri F2-5

24 h 48 h 72 h

**

**

*

**

FIG 5 Acetoin content in vinegar Pei in the acetic acid fermentation of Zhenjiang aromatic vinegar. Values are expressed as means � standard deviations andcompared by t test. *, P � 0.05 versus control group; **, P � 0.01 versus control group.

Acetoin Producers in Multispecies Vinegar Fermentation

October 2016 Volume 82 Number 19 aem.asm.org 5867Applied and Environmental Microbiology

on April 18, 2020 by guest

http://aem.asm

.org/D

ownloaded from

FUNDING INFORMATIONThis work, including the efforts of Zhen-Ming Lu, Jin-Song Gong, andZheng-Hong Xu, was funded by High Tech Development Program of China(863 Project) (2012AA021301, 2013AA102106, and 2014AA021501). Thiswork, including the efforts of Zhen-Ming Lu and Zheng-Hong Xu, wasfunded by National Natural Science Foundation of China (NSFC)(31271922 and 31530055). This work, including the efforts of Jin-SongShi, was funded by Ministry of Education of the People’s Republic ofChina (MOE) (JUSRP51516).

REFERENCES1. Hugenholtz J. 2013. Traditional biotechnology for new foods and

beverages. Curr Opin Biotechnol 24:155–159. http://dx.doi.org/10.1016/j.copbio.2013.01.001.

2. Bokulich NA, Thorngate JH, Richardson PM, Mills DA. 2014. Microbialbiogeography of wine grapes is conditioned by cultivar, vintage, and cli-mate. Proc Natl Acad Sci U S A 111:E139�E148. http://dx.doi.org/10.1073/pnas.1317377110.

3. Wolfe BE, Button JE, Santarelli M, Dutton RJ. 2014. Cheese rindcommunities provide tractable systems for in situ and in vitro studies ofmicrobial diversity. Cell 158:422– 433. http://dx.doi.org/10.1016/j.cell.2014.05.041.

4. Xu W, Huang ZY, Zhang XJ, Li Q, Lu ZM, Shi JS, Xu ZH, Ma YH. 2011.Monitoring the microbial community during solid-state acetic acid fer-mentation of Zhenjiang aromatic vinegar. Food Microbiol 28:1175–1181.http://dx.doi.org/10.1016/j.fm.2011.03.011.

5. Wang ZM, Lu ZM, Yu YJ, Li GQ, Shi JS, Xu ZH. 2015. Batch-to-batchuniformity of bacterial community succession and flavor formation in thefermentation of Zhenjiang aromatic vinegar. Food Microbiol 50:64 – 69.http://dx.doi.org/10.1016/j.fm.2015.03.012.

6. Li S, Li P, Feng F, Luo LX. 2015. Microbial diversity and their roles in thevinegar fermentation process. Appl Microbiol Biotechnol 99:4997–5024.http://dx.doi.org/10.1007/s00253-015-6659-1.

7. Nie Z, Zheng Y, Du H, Xie S, Wang M. 2015. Dynamics and diversity ofmicrobial community succession in traditional fermentation of Shanxiaged vinegar. Food Microbiol 47:62– 68. http://dx.doi.org/10.1016/j.fm.2014.11.006.

8. Wu JJ, Gullo M, Chen FS, Giudici P. 2010. Diversity of Acetobacterpasteurianus strains isolated from solid-state fermentation of cereal vine-gars. Curr Microbiol 60:280 –286. http://dx.doi.org/10.1007/s00284-009-9538-0.

9. Wu JJ, Ma YK, Zhang FF, Chen FS. 2012. Biodiversity of yeasts, lacticacid bacteria and acetic acid bacteria in the fermentation of “Shanxi agedvinegar,” a traditional Chinese vinegar. Food Microbiol 30:289 –297. http://dx.doi.org/10.1016/j.fm.2011.08.010.

10. Liao SL, Kao TK, Chen WY, Lin YS, Chen SY, Raung SL, Wu CW, LuHC, Chen CJ. 2004. Tetramethylpyrazine reduces ischemic brain injuryin rats. Neurosci Lett 372:40 – 45. http://dx.doi.org/10.1016/j.neulet.2004.09.013.

11. Xiao ZJ, Lu JR. 2014. Strategies for enhancing fermentative production ofacetoin: a review. Biotechnol Adv 32:492–503. http://dx.doi.org/10.1016/j.biotechadv.2014.01.002.

12. He ZY, Ao ZH, Wu J, Li GQ, Tao WY. 2004. Study on the mensurationof tetramethylpyrazine in Zhenjiang vinegar and its generant mechanism.Chin Condiment 2:36 –39.

13. Xu W, Xu QP, Chen JH, Lu ZM, Xia R, Li GQ, Xu ZH, Ma YH. 2011.Ligustrazine formation in Zhenjiang aromatic vinegar: changes duringfermentation and storing process. J Sci Food Agric 91:1612–1617. http://dx.doi.org/10.1002/jsfa.4356.

14. Rizzi GP. 1988. Formation of pyrazines from acyloin precursors undermild conditions. J Agric Food Chem 36:349 –352. http://dx.doi.org/10.1021/jf00080a026.

15. Xiao ZJ, Hou XY, Xin L, Xi LJ, Zhao JY. 2014. Accelerated green process

of tetramethylpyrazine production from glucose and diammonium phos-phate. Biotechnol Biofuels 7:106. http://dx.doi.org/10.1186/1754-6834-7-106.

16. Yu YJ, Lu ZM, Yu NH, Xu W, Li GQ, Shi JS, Xu ZH. 2012. HS-SPME/GC-MS and chemometrics for volatile composition of Chinese traditionalaromatic vinegar in the Zhenjiang region. J Inst Brew 118:133–141. http://dx.doi.org/10.1002/jib.20.

17. Li YD, Zhang WP, Zheng DQ, Zhou Z, Yu WW, Zhang L, Feng LF,Liang XL, Guan WJ, Zhou JW, Chen J, Lin ZG. 2014. Genome evolutionof Saccharomyces cerevisiae under Chinese rice wine fermentation. Ge-nome Biol Evol 6:2516 –2526. http://dx.doi.org/10.1093/gbe/evu201.

18. Bolger AM, Lohse M, Usadel B. 2014. Trimmomatic: a flexible trimmerfor Illumina sequence data. Bioinformatics 30:2114 –2120. http://dx.doi.org/10.1093/bioinformatics/btu170.

19. Liu J, Wang H, Yang H, Zhang Y, Wang J, Zhao F, Qi J. 2013.Composition-based classification of short metagenomic sequenceselucidates the landscapes of taxonomic and functional enrichment ofmicroorganisms. Nucleic Acids Res 41:e3. http://dx.doi.org/10.1093/nar/gks828.

20. Rose TM, Henikoff JG, Henikoff S. 2003. CODEHOP (COnsensus-DEgenerate Hybrid Oligonucleotide Primer) PCR primer design. NucleicAcids Res 31:3763–3766. http://dx.doi.org/10.1093/nar/gkg524.

21. Schüller G, Hertel C, Hammes WP. 2000. Gluconacetobacter entanii sp.nov., isolated from submerged high-acid industrial vinegar fermenta-tions. Int J Syst Evol Microbiol 50:2013–2020. http://dx.doi.org/10.1099/00207713-50-6-2013.

22. Man JCD, Rogosa MA, Sharpe ME. 1960. A medium for the cultivationof lactobacilli. J Appl Microbiol 23:130 –135.

23. Elliker PR, Anderson AW, Hannesson G. 1956. An agar culture mediumfor lactic acid streptococci and lactobacilli. J Dairy Sci 39:1611–1612. http://dx.doi.org/10.3168/jds.S0022-0302(56)94896-2.

24. Swings J, Gillis M, Kersters K. 1992. Phenotypic identification of aceticacid bacteria. Appl Environ Microbiol 29:103–110.

25. Di Cello F, Bevivino A, Chiarini L, Fani R, Paffetti D, Tabacchioni S,Dalmastri C. 1997. Biodiversity of Burkholderia cepacia population iso-lated from the maize rhizosphere at different plant growth stages. ApplEnviron Microbiol 63:4485– 4493.

26. Alivisatos AP, Blaser MJ, Brodie EL, Chun M, Dangl JL, Donohue TJ,Dorrestein PC, Gilbert JA, Green JL, Jansson JK, Knight R, Maxon ME,McFall-Ngai MJ, Miller JF, Pollard KS, Ruby EG, Taha SA, UnifiedMicrobiome Initiative Consortium. 2015. A unified initiative to harnessEarth’s microbiomes. Science 350:507–508. http://dx.doi.org/10.1126/science.aac8480.

27. Ji XJ, Huang H, Ouyang PK. 2011. Microbial 2,3-butanediol production:a state-of-the-art review. Biotechnol Adv 29:351–364. http://dx.doi.org/10.1016/j.biotechadv.2011.01.007.

28. Maestri O, Joset F. 2000. Regulation by external pH and stationarygrowth phase of the acetolactate synthase from Synechocystis PCC6803.Mol Microbiol 37:828 – 838. http://dx.doi.org/10.1046/j.1365-2958.2000.02048.x.

29. Tan Y, Liu ZY, Liu Z, Li FL. 2015. Characterization of an acetoinreductase/2,3-butanediol dehydrogenase from Clostridium ljungdahliiDSM 13528. Enzyme Microb Technol 79-80:1–7. http://dx.doi.org/10.1016/j.enzmictec.2015.06.011.

30. Moens F, Lefeber T, De Vuyst L. 2014. Oxidation of metabolites high-lights the microbial interactions and roles of Acetobacter pasteurianus dur-ing cocoa bean fermentation. Appl Environ Microbiol 80:1848 –1857.http://dx.doi.org/10.1128/AEM.03344-13.

31. Hua ZS, Han YJ, Chen LX, Liu J, Hu M, Li SJ, Kuang JL, Chain PS,Huang LN, Shu WS. 2015. Ecological roles of dominant and rare pro-karyotes in acid mine drainage revealed by metagenomics and metatran-scriptomics. ISME J 9:1280 –1294. http://dx.doi.org/10.1038/ismej.2014.212.

Lu et al.

5868 aem.asm.org October 2016 Volume 82 Number 19Applied and Environmental Microbiology

on April 18, 2020 by guest

http://aem.asm

.org/D

ownloaded from