cF

r

tbeG

Effect of CC Chemokine Receptor 2 CCR2 Blockade on SerumC-Reactive Protein in Individuals at Atherosclerotic Risk and With

a Single Nucleotide Polymorphism of the MonocyteChemoattractant Protein-1 Promoter Region

Jim Gilbert, MDa,*, Julie Lekstrom-Himes, MDb, Debra Donaldson, MDc, Yih Lee, PhDd,Mingxiu Hu, PhDd, Jing Xu, PhDd, Tim Wyant, MDd, and Michael Davidson, MDe,f, for the

MLN1202 Study Group†

CC chemokine receptor 2 (CCR2), expressed on the surface of circulating monocytes, andits ligand monocyte chemoattractant protein–1 (MCP-1; also known as CC-chemokineligand 2) are present in atherosclerotic plaques and may have important roles in endothelialmonocyte recruitment and activation. MLN1202 is a highly specific humanized monoclonalantibody that interacts with CCR2 and inhibits MCP-1 binding. The aim of this random-ized, double-blind, placebo-controlled study was to measure reductions in circulating levelsof high-sensitivity C-reactive protein, an established biomarker of inflammation associatedwith coronary artery disease, on MLN1202 treatment in patients at risk for atheroscleroticcardiovascular disease (>2 risk factors for atherosclerotic cardiovascular disease andcirculating high-sensitivity C-reactive protein >3 mg/L). Additionally, patients were geno-typed for the 2518 A¡G polymorphism in the promoter of the MCP-1 gene to investigatethe correlation between this polymorphism and reduced C-reactive protein levels withMLN1202 treatment. Patients who received MLN1202 exhibited significant decreases inhigh-sensitivity C-reactive protein levels, beginning at 4 weeks and continuing through 12weeks after dosing. Patients with A/G or G/G genotypes in the MCP-1 promoter hadsignificantly greater reductions in high-sensitivity C-reactive protein levels than patientswith the wild-type A/A genotype. In conclusion, MLN1202 treatment was well tolerated inthis patient population and resulted in significant reductions in high-sensitivity C-reactive

protein levels. © 2011 Elsevier Inc. All rights reserved. (Am J Cardiol 2011;107:906–911)

Numerous inflammatory biomarkers have been clinicallyassociated with the development and progression of athero-sclerotic cardiovascular disease, and among these, C-reac-tive protein (CRP) has been prospectively validated.1–4

Monocyte chemoattractant protein–1 (MCP-1; also knownas CC-chemokine ligand 2) is an emerging inflammatorybiomarker of atherosclerotic cardiovascular disease5–8 and

aArchemix Corporation, Cambridge, Massachusetts; bXiphos Pharma-euticals, Inc., Watertown, Massachusetts; cGenentech, Inc., South Sanrancisco, California; dMillennium Pharmaceuticals, Inc., Cambridge,

Massachusetts; eUniversity of Chicago Pritzker School of Medicine; andfRadiant Research, Chicago, Illinois. Manuscript received July 9, 2010;evised manuscript received and accepted November 3, 2010.

This study was sponsored and conducted by Millennium Pharmaceu-icals, Inc., Cambridge, Massachusetts. Drs. Lee, Hu, and Xu are employedy Millennium Pharmaceuticals, Inc. Dr. Lekstrom-Hines has equity own-rship in Millennium Pharmaceuticals, Inc., and Coley Pharmaceuticalroup, Wellesley, Massachusetts.

*Corresponding author: Tel: 617-475-2359.E-mail address: jgilbert@archemix.com (J. Gilbert).

† The MLN1202 Study Group includes Gordon Conner (Birmingham,Alabama), Bryan Poque (Boise, Idaho), Travis Ellison (Greer, South Car-olina), Monica Pierson (Overland Park, Kansas), James Zavoral (Edina,Minnesota), Stephen Halpern (Santa Rosa, California), Randall Severance

(Chandler, Arizona), and Darrell Fiske (Stuart, Florida).

0002-9149/11/$ – see front matter © 2011 Elsevier Inc. All rights reserved.doi:10.1016/j.amjcard.2010.11.005

is a major ligand for CC chemokine receptor 2 (CCR2).CCR2 is found on the surface of monocytes and otherimmune cells. In vitro studies and animal models of athero-sclerosis indicate that recruitment of monocytes via MCP-1has an important causal role in this disease.5,9 MCP-1 bloodlevel at the time of an acute coronary syndrome event waspredictive of future events in the Orbofiban in Patients WithUnstable Coronary Syndromes–Thrombolysis In Myocar-dial Infarction 16 (OPUS-TIMI 16) trial.10 In addition,serial measurement of MCP-1 in the larger Aggrastat toZocor (A to Z) study of patients with acute coronary syn-dromes showed significant, independent predictive value ofbaseline and on-treatment MCP-1 levels that was additive tothe prognostic information provided by CRP and other clin-ical risk indicators.11 MCP-1 levels are genetically deter-mined, and single-nucleotide polymorphisms (SNPs) of theMCP-1 promoter (synonymously identified as either -2578A�G or -2518 A�G) have been associated with increasedMCP-1 expression12 and an increased risk for atheroscle-rotic cardiovascular disease.7,13–15 Thus, along with CRP,MCP-1 may be an attractive therapeutic target in the pri-mary and secondary prevention of atherosclerotic cardio-vascular disease. MLN1202 is a human monoclonal an-tibody directed against CCR2, the receptor for MCP-1,and is in clinical development for the treatment of vari-

ous inflammatory disorders. This study was designed to

www.ajconline.org

NSOR

907Preventive Cardiology/CCR2 Blockade and CRP Reduction

test the hypothesis that blockade of CCR2 by MLN1202would reduce serum CRP levels in patients with riskfactors for atherosclerotic cardiovascular disease and todetermine if SNPs of the MCP-1 promoter could bepredictive of response.

Methods

Men and women aged �35 years were eligible for en-rollment if they had �2 risk factors for atheroscleroticcardiovascular disease, and high-sensitivity CRP levels�3.0 mg/L on �1 occasion within the preceding 12 months,the most recent value being �2 weeks before enrollment.Patients receiving lipid-lowering therapy were required tohave been taking stable doses for �2 months before enroll-ment. Patients were excluded if they had histories of stroke,coronary artery disease, or congestive heart failure; neo-plasms; or any chronic infection or inflammatory condition.

This randomized, double-blind, placebo-controlled studywas conducted at 8 study centers from August 16, 2005, toApril 5, 2006. Eligible subjects were randomized centrallyin a 1:1 ratio to receive MLN1202 10 mg/kg or matchingplacebo as a single intravenous infusion (Figure 1). Ran-domization was not stratified by any baseline characteris-tics. Venipuncture samples for laboratory assessments wereobtained at screening, predose, and on days 3, 8, 15, 29, 43,57, 71, 85, and 113.

CRP, lipid profiles, and standard clinical chemistry andhematology analyses were performed at Covance CentralLaboratories (Indianapolis, Indiana). An enzyme-linked im-munosorbent assay was used to measure serum MCP-1levels (MCP-1 Quantikine Kit; R&D Systems, Minneapolis,Minnesota). The upper and lower limits of quantitation were2,000 and 20 pg/mL, respectively. The inter- and intra-assayvariability was �6% and �7%, respectively.

MLN1202 serum concentrations were measured by en-zyme-linked immunosorbent assay (developed internally atMillennium Pharmaceuticals, Inc., Cambridge, Massachu-setts) at PPD Development (Richmond, Virginia). CCR2saturation was assessed by indirectly measuring the abilityof MLN1202 to inhibit binding and internalization of thefluorescence-labeled functional ligand of CCR2, MCP-1, onCD14� monocytes and memory CD4� T cells (CD4�/CD45RO�) in a ligand-internalization assay. Deoxyribonu-

Figure 1. CO

cleic acid for SNP genotyping was isolated from whole-

blood samples collected at baseline. Deoxyribonucleic acidsample concentration and purity were determined at Cova-nce Central Laboratories. Polymorphisms in the MCP-1promoter (rs102461 [dbSNP, http://www.ncbi.nlm.nih.gov/SNP]) corresponding to MCP-1-2518 (also previouslycalled MCP-1-2578) were determined using the TaqManassay (Applied Biosystems, Inc., Foster City, California)and the following context sequence: GAGCAGAAGTGGGAGGCAGACAGCT[A/G]TCACTTTCCAGAAGACTTTCTTTTC.

The study was conducted in compliance with the Decla-ration of Helsinki and was consistent with Good ClinicalPractice guidelines. The investigational review board ateach site approved the study, and all patients gave writteninformed consent.

The primary efficacy end point was the change inmedian CRP level from baseline to day 57. The changesin CRP levels in SNP-positive subjects (A/G and G/Gcombined) were compared with those in SNP-negativesubjects (A/A genotype). Secondary efficacy end pointsincluded the number of days from baseline until the first1.0 mg/L decrease in CRP level and changes from base-line to other study visits.

The intent-to-treat population, defined as all randomizedsubjects who received any study drug (MLN1202 or pla-cebo) and who had baseline and �1 postbaseline efficacyassessment, was used for the primary efficacy analyses. Forpatients who did not have day 57 measurements, the lastobservation was carried forward in the primary analysis.The pharmacokinetic and pharmacodynamic population wasdefined as all subjects who received the dose of study drugand for whom pharmacokinetic and pharmacodynamic datafor a designated time point were available. The safety pop-ulation was defined as all subjects who received study drugtreatment (MLN1202 or placebo).

Because CRP levels are known to be highly skewed, theprimary end point was based on the median change in CRP,and Wilcoxon’s rank-sum test was used for the primaryanalysis of the primary efficacy end point. Analyses ofcovariance on log-transformed data were the secondaryanalyses of the primary end point, adjusting for baselineCRP level as a covariate. All primary and secondary anal-yses for CRP change were prespecified at the 1-sided sig-

T diagram.

nificance level of 0.05. An exploratory subgroup analysis

(

908 The American Journal of Cardiology (www.ajconline.org)

was conducted to assess the effect of MCP-1 SNP type onthe primary end point.

Between-group comparisons of Kaplan-Meier curveswere made using a stratified log-rank test adjusting forbaseline CRP as a dichotomous variable (�5.0 vs �5.0mg/L). Cox regression modeling was used to adjust forbaseline CRP as a continuous variable. It was anticipatedthat the change in CRP from baseline to day 57 would beapproximately 1.0 mg/L for the MLN1202 dose group andthat there would be no change in CRP level for the placebogroup. To detect the treatment difference with a 1-sided �level of 0.05 and 80% power using Wilcoxon’s rank-sumtest, 54 subjects per group would be needed on the basis ofsimulations. Serum concentration versus time data for theMLN1202 group were subjected to noncompartmental anal-ysis using WinNonlin version 5.0 (Pharsight Corporation,

Table 1Patient baseline characteristics

Variable Placebo MLN1202(n � 54) (n � 54)

Men 20 (37%) 14 (26%)Women 34 (63%) 40 (74%)Black 6 (11%) 7 (13%)White 46 (85%) 46 (85%)Other 2 (4%) 1 (2%)Age (years) 63.3 � 9.4 58.6 � 10.0Body mass index (kg/m2) 32.7 � 7.1 33.9 � 7.2High-sensitivity CRP (mg/L) 6.2 (4.6–8.2) 5.8 (4.1–10.0)SNP of MCP-1 promoter*

Positive (AG or GG) 29 (53.7%) 27 (51.9%)Negative (AA) 25 (46.3%) 25 (48.1%)

Serum MCP-1 level (pg/mL)Positive (AG or GG) 508 � 157 462 � 142Negative (AA) 496 � 151 452 � 179

Risk factors for atheroscleroticcardiovascular disease

Age 48 (89%) 37 (69%)Body mass index �30 kg/m2 32 (59%) 41 (76%)Current or past smoker (�20

packs/year)14 (26%) 16 (30%)

History of hypertension 38 (70%) 26 (48%)History of

hypercholesterolemia36 (67%) 40 (74%)

Diabetes mellitus 9 (17%) 8 (15%)Medication use

Lipid-lowering therapy 21 (39%) 25 (46%)Angiotensin-converting

enzyme inhibitors15 (28%) 4 (7%)

Angiotensin receptorblockers

6 (11%) 4 (7%)

Nonsteroidal anti-inflammatory drugs

21 (39%) 20 (37%)

Aspirin and other antiplateletagents†

23 (43%) 17 (31%)

� blockers 6 (11%) 8 (15%)Corticosteroids 1 (2%) 4 (7%)

Data are expressed as number (percentage), mean � SD, or medianinterquartile range).

* Excludes 2 subjects with no data.† Clopidogrel.

Mountain View, California).

Results

A total of 243 subjects were screened, of whom 112 wererandomized to receive study drug. Two subjects in eachtreatment group were randomized in error and discontinuedbefore receiving the single dose of MLN1202 or placebo.The remaining 108 subjects (54 in each group) constitutedthe intent-to-treat population for analyses of baseline andefficacy data and the safety population for analyses ofsafety. Two subjects, 1 in the placebo group and 1 in theMLN1202 group, withdrew consent before completing allstudy procedures. The remaining 106 subjects, 53 subjectsin each treatment group, completed the study. Baselinedemographic characteristics of the intent-to-treat populationare listed in Table 1. Most patients in each group werewomen, with 11% more women in the placebo group than inthe MLN1202 group. The percentages of subjects who had

Figure 2. Median change from baseline in CRP level throughout thepostdose observation period.

Table 2C-reactive protein absolute values and their difference at baseline andday 57 postdose

Variable Placebo MLN1202 p Value*(n � 54) (n � 54)

Baseline†

Mean � SD (mg/L) 8.2 � 7.7 8.6 � 7.1Median (mg/L) 6.2 5.8

Day 57Mean � SD (mg/L) 7.7 � 6.0 8.5 � 10.0

Mean � SD change (mg/L) �0.5 � 5.3 �0.2 � 8.2Mean percentage change �

SD (mg/L)1.5 � 38.5 16.8 � 159.8

Median (mg/L) 6.0 5.2Median of changes‡ (mg/L) 0.2 �1.4 0.027Median percentage change

(%)2.5 �24.2 0.009

* From Wilcoxon’s rank-sum test (1 sided).† Baseline CRP was derived by averaging the screening visit CRP

measured between screening and the CRP value on day 1 before dose.‡ Represents the median of individual changes in CRP from baseline to

day 57.

histories of hypertension or who were being treated with

rabcnmn

909Preventive Cardiology/CCR2 Blockade and CRP Reduction

angiotensin-converting enzyme inhibitors were also greaterin the placebo group. The mean age in the placebo groupwas 4.7 years greater than in the MLN1202 group (p �0.01, t test), although post hoc analyses of the primary endpoint did not show any interaction between age and treat-ment effect. Baseline characteristics were otherwise similarbetween the 2 treatment groups. In contrast to previousobservations, SNP-negative and SNP-positive patients hadsimilar MCP-1 levels at baseline (Table 1).

In the intent-to-treat population, the median change inCRP from baseline to day 57 was 0.2 mg/L in the placebogroup, compared with �1.4 mg/L in the MLN1202 group(p � 0.027, Wilcoxon’s rank-sum test; Table 2). Thedifference in the median change in CRP between theMLN1202 and placebo groups was statistically signifi-cant (p �0.05) from 4 weeks through 12 weeks postdose(Figure 2). A total of 36 (67%) subjects in the placebogroup and 46 (85%) in the MLN1202 group experienced1.0 mg/L reductions in CRP level. The median time to a1.0 mg/L decrease in CRP level was 30 days in theplacebo group and 16 days in the MLN1202 group (p �0.018, 1-sided Cox regression model after adjusting for

Figure 3. Median percentage change from baseline in CRP level by treat-ment group according to MCP-1 A/A or A/G � G/G genotype.

Figure 4. Patients with high-sensitivity CRP (hsCRP) �3 mg/L by treat-ment group and by MCP-1 A/A or A/G � G/G genotype.

baseline CRP values). a

Although the study was not designed to test for thepresence of a subgroup effect, female gender and body massindex �30 kg/m2 were identified as potentially relevantbaseline covariates in a multivariate analysis, both of whichwere associated with a greater treatment effect. CRP levelsduring the 12-week observation period were not affected bythe use of lipid-lowering agents. Neither did MLN1202treatment have any discernible effect on lipid levels, glyce-mic control, or other biomarkers of cardiovascular risk.Mean baseline serum interleukin-6 levels were 2.7 � 1.5and 2.9 � 1.6 pg/mL in the placebo and MLN1202 groups,respectively, and there were no significant changes duringthe study.

Post hoc analyses were conducted using repeated-mea-surement random-effect models to summarize the relationbetween baseline MCP-1 level and change in CRP in the logscale from baseline after day 29 through day 85 and tosummarize the relation between MCP-1 SNP and MCP-1level in the log scale from day 8 to day 85. Other covariatesincluded in the models were baseline CRP or baselineMCP-1 levels, treatment group, and treatment-by-time in-teractions. There were no significant associations betweenbaseline MCP-1 and CRP change in the log scale (p � 0.84)or between MCP-1 SNP type and MCP-1 level in the logscale (p � 0.49).

The CRP response according to treatment group andgenotype is shown in Figure 3. In patients with the A/Agenotype, there was no significant difference in CRP changefrom baseline between the MLN1202 and placebo treatmentgroups (p � 0.50, Wilcoxon’s test on ranks of CRP changefrom baseline). In contrast, in patients with either the A/G orthe G/G genotype, the median change in CRP level frombaseline at day 57 was an increase of 0.5 mg/L in theplacebo group, compared with a decrease of 1.6 mg/L in theMLN1202 group (p � 0.0102). Similarly, the median per-centage change in CRP from baseline to day 57 in A/G �G/G subjects was also significantly different (p � 0.0085)between subjects receiving placebo (�8.7%) and those re-ceiving MLN1202 (�26.6%).

Post hoc analyses on the proportion of patients with high-sensitivity CRP �3 mg/L by treatment group and by MCP-1A/A or A/G � G/G genotype were also conducted (Figure 4).From day 15 through 113, a consistently higher proportion ofMLN1202-treated patients with MCP-1 A/G � G/G genotypehad high-sensitivity CRP �3 mg/L compared with those withthe MCP-1 A/A genotype. The proportion of placebo-treated patients with high-sensitivity CRP �3 mg/L wassimilar for those with the A/A or A/G � G/G MCP-1genotype.

Inhibition of the CCR2-binding site by MLN1202 cor-responded with decreases in CRP and increases in serumMCP-1 levels. After a single dose of MLN1202, mean Cmaxand T1/2 were 261 � 52 �g/mL and 8.2 � 2.5 days,espectively. MLN1202 administration caused an immedi-te and sustained reduction in unoccupied CCR2 receptorsy �90% for 43 to 57 days postdose. Maximal MCP-1oncentrations occurred at 3 days postdose and persisted atear maximal levels for approximately 43 days. The maxi-al MCP-1 levels were similar for SNP-positive and SNP-

egative subjects. Mean circulating monocytes decreased

fter MLN1202 administration and reached a nadir of 33%

ft

clMi

gma

tsaeToa

oM

ttSmtdg

910 The American Journal of Cardiology (www.ajconline.org)

lower than baseline at day 8 before returning to baselinelevels by the end of study.

The most commonly reported treatment-emergent ad-verse events in the MLN1202 group were nasopharyngitis(22% of subjects), headache (9%), and upper respiratorytract infection (7%). The most commonly reported treat-ment-emergent adverse events in the placebo group werenasopharyngitis (15%), headache (13%), upper respiratorytract infection (11%), and arthralgia (9%). Two subjects inthe placebo group, but none in the MLN1202 group, hadserious adverse events. No patient developed human anti-human antibody, and no infusion reactions were reported.

Discussion

Despite increasing evidence that inflammation is a keydriver of atherosclerotic cardiovascular disease, there are nospecific immunomodulatory agents for its prevention andtreatment. Although it is generally accepted that increasedCRP levels are predictive of increased risk for the develop-ment and progression of atherosclerotic cardiovascular dis-ease, evidence that changes in CRP level lead to the primaryprevention of coronary events is inconclusive.16,17 In-creased CRP is believed to arise from interleukin-6 elabo-rated by monocytes that have been recruited into athero-sclerotic lesions by MCP-1.18–22 However, interleukin-6levels were not different between the MLN1202-treated andplacebo subjects, suggesting that the observed decreases inCRP were independent of interleukin-6. SNPs of the MCP-1promoter have been identified, and the rs1024611 polymor-phism (�2518 A�G) has been reported to be associatedwith an increase in MCP-1 expression12 (a finding that wasnot confirmed in this study) and an increased risk for ath-erosclerotic cardiovascular disease.7,13–15 It has also beenreported that CRP can drive increases in MCP-1,23 so that aeed-forward loop may exist to sustain vascular inflamma-ion once it has been initiated.

MLN1202 was associated with a reversible decrease inirculating monocytes and an increase in serum MCP-1evels. This is consistent with the major effect of infused

CP-1 in humans, which is the recruitment of monocytesnto the circulation.24 The increase in MCP-1 is potentially

due to decreased receptor-mediated clearance of MCP-1,which appears to play a major role in the regulation ofMCP-1 levels in humans.25 In mice, CCR2 antagonism hasalso been shown to prevent egress of CCR2-sensitive mono-cytes from the bone marrow.26,27 These observations sug-est that CCR2 antagonism may have a dual effect ononocytes by inhibiting their release into the circulation

nd also migration into peripheral inflammatory lesions.As a phase 2 study, it was not large enough to stratify for

he baseline covariates that may have confounded the re-ults. In addition, although MLN1202 is expected to blockll ligands for CCR2, only MCP-1 was assessed, so theffect of MLN1202 on other ligands of CCR2 are unknown.he prespecified primary analysis was based on the lastbservation carried forward, although a more completenalysis yielded similar findings.

The results of this study demonstrates that CCR2 antag-nism by MLN1202 reduced serum CRP. The effect of

LN1202 on CRP level was independent of background

herapy (e.g., statins or other lipid-lowering drugs), al-hough it was restricted to patients carrying the A/G or G/GNP in the MCP-1 promoter. This finding supports theolecular epidemiologic association between these geno-

ypes and increased risk for atherosclerotic cardiovascularisease. More studies are required to confirm the hypothesesenerated by these provocative observations.

1. Willerson JT, Ridker PM. Inflammation as a cardiovascular risk factor.Circulation 2004;109:II2–II10.

2. Ridker PM. C-reactive protein and the prediction of cardiovascularevents among those at intermediate risk: moving an inflammatoryhypothesis toward consensus. J Am Coll Cardiol 2007;49:2129–2138.

3. Tsimikas S, Willerson JT, Ridker PM. C-reactive protein and otheremerging blood biomarkers to optimize risk stratification of vulnerablepatients. J Am Coll Cardiol 2006;47(suppl):C19–C31.

4. Ridker PM, Brown NJ, Vaughan DE, Harrison DG, Mehta JL. Estab-lished and emerging plasma biomarkers in the prediction of firstatherothrombotic events. Circulation 2004;109(suppl):IV6–IV19.

5. Charo IF, Taubman MB. Chemokines in the pathogenesis of vasculardisease. Circ Res 2004;95:858–866.

6. Deo R, Khera A, McGuire DK, Murphy SA, Meo Neto Jde P, MorrowDA, de Lemos JA. Association among plasma levels of monocytechemoattractant protein-1, traditional cardiovascular risk factors, andsubclinical atherosclerosis. J Am Coll Cardiol 2004;44:1812–1818.

7. Flex A, Gaetani E, Papaleo P, Straface G, Proia AS, Pecorini G, TondiP, Pola P, Pola R. Proinflammatory genetic profiles in subjects withhistory of ischemic stroke. Stroke 2004;35:2270–2275.

8. Frangogiannis NG, Dewald O, Xia Y, Ren G, Haudek S, Leucker T,Kraemer D, Taffet G, Rollins BJ, Entman ML. Critical role of mono-cyte chemoattractant protein-1/CC chemokine ligand 2 in the patho-genesis of ischemic cardiomyopathy. Circulation 2007;115:584–592.

9. Charo IF, Ransohoff RM. The many roles of chemokines and chemo-kine receptors in inflammation. N Engl J Med 2006;354:610–621.

10. de Lemos JA, Morrow DA, Sabatine MS, Murphy SA, Gibson CM,Antman EM, McCabe CH, Cannon CP, Braunwald E. Associationbetween plasma levels of monocyte chemoattractant protein-1 andlong-term clinical outcomes in patients with acute coronary syn-dromes. Circulation 2003;107:690–695.

11. de Lemos JA, Morrow DA, Blazing MA, Jarolim P, Wiviott SD,Sabatine MS, Califf RM, Braunwald E. Serial measurement of mono-cyte chemoattractant protein-1 after acute coronary syndromes: resultsfrom the A to Z trial. J Am Coll Cardiol 2007;50:2117–212.

12. Rovin BH, Lu L, Saxena R. A novel polymorphism in the MCP-1 generegulatory region that influences MCP-1 expression. Biochem BiophysRes Commun 1999;259:344–348.

13. Szalai C, Duba J, Prohászka Z, Kalina A, Szabó T, Nagy B, HorváthL, Császár A. Involvement of polymorphisms in the chemokine systemin the susceptibility for coronary artery disease (CAD). Coincidence ofelevated Lp(a) and MCP-1 -2518 G/G genotype in CAD patients.Atherosclerosis 2001;158:233–239.

14. Tucci M, Quatraro C, Frassanito MA, Silvestris F. Deregulated ex-pression of monocyte chemoattractant protein-1 (MCP-1) in arterialhypertension: role in endothelial inflammation and atheromasia. J Hy-pertens 2006;24:1307–1318.

15. Kim MP, Wahl LM, Yanek LR, Becker DM, Becker LC. A monocytechemoattractant protein-1 gene polymorphism is associated with oc-cult ischemia in a high-risk asymptomatic population. Atherosclerosis2007;193:366–372.

16. Ridker PM, Cannon CP, Morrow D, Rifai N, Rose LM, McCabe CH,Pfeffer MA, Braunwald E. C-reactive protein levels and outcomesafter statin therapy. N Engl J Med 2005;352:20–28.

17. Helfand M, Buckley DI, Freeman M, Fu R, Rogers K, Fleming C,Humphrey LL. Emerging risk factors for coronary heart disease: asummary of systematic reviews conducted for the U.S. PreventiveServices Task Force. Ann Intern Med 2009;151:496–507.

18. Ganapathi MK, May LT, Schultz D, Brabenec A, Weinstein J, SehgalPB, Kushner I. Role of interleukin-6 in regulating synthesis of C-re-active protein and serum amyloid A in human hepatoma cell lines.

Biochem Biophys Res Commun 1988;157:271–277.

911Preventive Cardiology/CCR2 Blockade and CRP Reduction

19. Ganter U, Arcone R, Toniatti C, Morrone G, Ciliberto G. Dual controlof C-reactive protein gene expression by interleukin-1 and interleu-kin-6. EMBO J 1989;8:3773–3779.

20. Castell JV, Gómez-Lechón MJ, David M, Fabra R, Trullenque R,Heinrich PC. Acute-phase response of human hepatocytes: regulationof acute-phase protein synthesis by interleukin-6. Hepatology 1990;12:1179–1186.

21. Li SP, Goldman ND. Regulation of human C-reactive protein geneexpression by two synergistic IL-6 responsive elements. Biochemistry1996;35:9060–9068.

22. Li SP, Liu TY, Goldman ND. cis-acting elements responsible forinterleukin-6 inducible C-reactive protein gene expression. J BiolChem 1990;265:4136–4142.

23. Zhang Y, Wahl LM. Synergistic enhancement of cytokine-inducedhuman monocyte matrix metalloproteinase-1 by C-reactive protein and

oxidized LDL through differential regulation of monocyte chemotacticprotein-1 and prostaglandin E2. J Leukoc Biol 2006;79:105–113.

24. Mayr FB, Spiel AO, Leitner JM, Firbas C, Schnee J, Hilbert J,Derendorf H, Jilma B. Influence of the Duffy antigen on pharmaco-kinetics and pharmacodynamics of recombinant monocyte chemoat-tractant protein (MCP-1, CCL-2) in vivo. Int J Immunopathol Phar-macol 2009;22:615–625.

25. Mayr FB, Spiel AO, Leitner JM, Firbas C, Kliegel T, Jilma-StohlawetzP, Derendorf H, Jilma B. Duffy antigen modifies the chemokineresponse in human endotoxemia. Crit Care Med 2008;36:159–165.

26. Serbina NV, Pamer EG. Monocyte emigration from bone marrowduring bacterial infection requires signals mediated by chemokinereceptor CCR2. Nat Immunol 2006;7:311–317.

27. Rollins BJ. Release the hounds! A chemokine elicits monocytes frombone marrow. Nat Immunol 2006;7:230–232.