Drosophila ISWI regulates the association of histone H1 with interphase

chromosomes in vivo

Giorgia Siriaco*, Renate Deuring*, Mariacristina Chioda†, Peter B. Becker† and John W.

Tamkun*

*Department of Molecular, Cell and Developmental Biology

University of California, Santa Cruz

Santa Cruz, CA 95064, USA

†Adolf-Butenandt-Institute, Molecular Biology

Munich Center of Integrated Protein Science

Ludwig-Maximilians-University

80336 Munich, Germany

Genetics: Published Articles Ahead of Print, published on April 20, 2009 as 10.1534/genetics.109.102053

2

Running head:

Drosophila ISWI regulates H1 assembly

Key words and phrases:

Histone H1

ISWI

chromatin remodeling

Higher-order chromatin structure

Chromatin assembly

Corresponding author:

John W. Tamkun

350 Sinsheimer Labs

Department of Molecular, Cell and Developmental Biology

University of California, Santa Cruz

Santa Cruz, CA 95064 USA

Phone: (831) 459-3179

FAX: (831) 459-3139

email: tamkun@biology.ucsc.edu

3

ABSTRACT

Although tremendous progress has been made toward identifying factors that regulate

nucleosome structure and positioning, the mechanisms that regulate higher-order

chromatin structure remain poorly understood. Recent studies suggest that the ISWI

chromatin-remodeling factor plays a key role in this process by promoting the assembly

of chromatin containing histone H1. To test this hypothesis, we investigated the

function of H1 in Drosophila. The association of H1 with salivary gland polytene

chromosomes is regulated by a dynamic, ATP-dependent process. Reducing cellular

ATP levels triggers the dissociation of H1 from polytene chromosomes and causes

chromosome defects similar to those resulting from the loss of ISWI function. H1

knockdown causes even more severe defects in chromosome structure and a reduction

in nucleosome repeat length, presumably due to the failure to incorporate H1 during

replication-dependent chromatin assembly. Our findings suggest that ISWI regulates

higher-order chromatin structure by modulating the interaction of H1 with interphase

chromosomes.

The packaging of DNA into chromatin is critical for the organization and regulation of

eukaryotic genes. The basic unit of chromatin structure – the nucleosome – can be

packaged in 30 nm fibers and increasingly compact structures. Higher-order chromatin

structure influences many aspects of gene expression, including transcription factor

binding, enhancer-promoter interactions, and the organization of chromatin into

4

functional domains. Histone H1 and related linker histones are important determinants

of higher-order chromatin structure. These abundant, basic proteins share a common

structure consisting of a globular winged helix DNA-binding domain flanked by a short

N-terminal segment and a C-terminal domain of approximately 100 amino acids (BROWN

2003). The winged helix domain of H1 binds the nucleosome near the site of DNA entry

and exit; the flanking domains interact with core and linker DNA to promote the

formation and packaging of 30 nm fibers in vitro (MAIER et al. 2008; ROBINSON and

RHODES 2006).

In vitro studies suggest that nucleosomal arrays have an intrinsic propensity to fold into

30 nm fibers which are stabilized by association of H1 (CARRUTHERS et al. 1998).

However, the function of H1 in vivo is not well understood. In lower eukaryotes, proteins

related to H1 play surprisingly subtle roles in chromosome organization and gene

expression (GODDE and URA 2008). In higher eukaryotes, the study of H1 function has

been complicated by the presence of multiple, functionally redundant H1 subtypes

(KHOCHBIN 2001). H1 expression has been partially reduced in nematodes, frogs and

mice (GODDE and URA 2008). A partial reduction in H1 levels has limited effects on

gene expression in mice, but leads to the formation of nucleosome arrays that are less

compact than normal (FAN et al. 2005). The immunodepletion of H1 from Xenopus

extracts results in the assembly of elongated metaphase chromosomes that fail to align

and segregate properly (MARESCA et al. 2005). These findings suggest that H1 plays

an important role in chromosome organization. Since it has not been possible to

5

completely eliminate H1 in any higher eukaryote, its function in vivo remains a topic of

considerable debate.

The association of H1 with chromatin is highly dynamic. In both Tetrahymena and

mammals, H1 is rapidly exchanged between chromatin fibers (DOU et al. 2002; MISTELI

et al. 2000; LEVER et al. 2000; CATEZ et al. 2006). The dissociation of H1 from chromatin

is thought to disrupt 30 nm fibers and provide an opportunity for transcription factors or

other regulatory proteins to access DNA. The association of H1 with chromatin is

influenced by H1 phosphorylation, core histone acetylation, and competition with other

chromatin-binding proteins (CATEZ et al. 2006). However, little is known about either the

mechanism of H1 exchange or how this process is regulated in vivo.

One of the best candidates for a factor that regulates H1 assembly is Drosophila ISWI.

ISWI is the ATPase subunit of multiple chromatin-remodeling complexes – including

CHRAC, NURF and ACF - that slide nucleosomes and alter the spacing of nucleosome

arrays (BOUAZOUNE and BREHM 2006). ACF also promotes the assembly of chromatin

containing H1 in vitro (LUSSER et al. 2005). Although ISWI is not required for H1

expression in vivo, the loss of ISWI function leads to the decondensation of mitotic and

polytene chromosomes accompanied by the loss of H1 (CORONA et al. 2007). Based on

these observations, we proposed that ISWI regulates chromosome structure by

promoting H1 assembly (CORONA et al. 2007). To test this hypothesis and clarify the

function of histone H1 in vivo, we investigated phenotypes resulting from the loss of H1

6

in Drosophila.

RESULTS

H1 is essential for Drosophila development:

Unlike other higher eukaryotes, Drosophila contains only one H1 subtype (His1) that is

highly related to mammalian H1. Classical genetic approaches cannot be used to study

His1 since more than 100 copies of this gene are present in the Drosophila genome.

We therefore used RNA interference (RNAi) to study His1 function. Strains bearing a

transgene encoding a His1 hairpin-loop RNA under the control of a GAL4-inducible

promoter (UAS-His1-dsRNA) were generated by P element-mediated transformation.

To induce the expression of this transgene, transformants were crossed to strains

bearing a daughterless-GAL4 (da-GAL4) transgene that is ubiquitously expressed at

high levels. The expression of the His1 hairpin RNA under the control of the da-GAL4

driver resulted in death during late larval or early pupal stages, indicating that H1 is

essential for development (Table 1). We were unable to completely eliminate His1

expression in imaginal discs or larval neuroblasts, but occasionally observed interphase

nuclei with highly disorganized chromatin in these tissues, accompanied by a severe

reduction in the number of metaphase chromosomes (data not shown). These data

suggest that H1 is essential for progression through mitosis.

Histone H1 is a major determinant of chromosome structure in vivo:

7

We next analyzed phenotypes resulting from H1 knockdown in the larval salivary gland.

Repeated rounds of DNA replication in the absence of cytokinesis in this tissue leads to

the formation of polytene chromosomes that serve as a useful model for interphase

chromosomes. The expression of His1 dsRNA in the salivary gland led to a significant

reduction in H1 levels (Figure 1A) accompanied by highly penetrant changes in

chromosome structure (Figure 1C, D, F). Similar phenotypes resulted from the

expression of three independent insertions of the UAS-His1-dsRNA transgene, but were

never observed in larvae bearing only the da-GAL4 driver or UAS-His1-dsRNA

transgene (Figure 1B and data not shown). The most common phenotype resulting

from His1 knockdown was the broadening of chromosome arms without an obvious

disruption of their banding pattern (Figure 1C-D). The increase in chromosome size

was not due to extra rounds of replication, since the DNA content of chromosomes of

control larvae and larvae expressing His1 dsRNA were similar (Figure 1E).

Decondensed regions of chromatin and ectopic contacts between chromosome arms

were occasionally observed (data not shown). In extreme cases, the banding pattern

was completely disrupted and individual arms were no longer distinguishable (Figure

1F). The chromosome defects resulting from His1 knockdown were not limited to

euchromatin, as evidenced by the dispersion of the heterochromatic chromocenter

(Figure S1). H1 is thus a major determinant of chromosome structure in vivo.

Similar chromosome defects result from the loss of H1 and ISWI function:

8

To clarify the functional relationship between ISWI and histone H1, we compared

phenotypes resulting from their loss of function. We previously demonstrated that ISWI

plays a global role in chromatin compaction that is antagonized by the acetylation of

lysine 16 of the histone H4 tail (H4K16) (CORONA et al. 2002; DEURING et al. 2000).

The male X chromosome – which is acetylated on H4K16 by the dosage compensation

complex – is therefore particularly sensitive to the loss of ISWI function. The partial loss

of ISWI function leads to the decondensation of the male X chromosome (Figure 1B, D,

and G) accompanied by the loss of H1 (CORONA et al. 2007). A further reduction in

ISWI function (due to the expression of the dominant-negative ISWIK159R protein) leads

to the decondensation of all chromosomes (Figure 1B, H) accompanied by the loss of

H1 (CORONA et al. 2007).

The spectrum of chromosome defects resulting from the loss of ISWI function and H1

are similar, but not identical. The X chromosome of ISWI mutant males appears much

broader than normal, but usually retains its banding pattern (Figure 1D and G). H1

knockdown caused similar defects (Figure 1C, D and G) but did not have as

pronounced an effect on chromosome length (Figure 1B, C). In general, the expression

of His1 dsRNA led to a much greater increase in the size of polytene chromosomes

than the expression of ISWIK159R (compare Figure 1F to 1H). This may be due to a

reduction in DNA replication in larvae expressing ISWIK159R (Figure 1I). Overall, the

similarities between the phenotypes resulting from the loss of His1 and ISWI function

9

support our proposal that ISWI regulates chromatin structure by promoting the

incorporation of H1 into chromatin.

To verify that H1 acts downstream of ISWI to regulate chromatin structure, we examined

whether the loss of H1 altered either the expression of ISWI or its association with

chromatin. The expression of His1 dsRNA dramatically reduced the expression of H1 in

salivary gland nuclei without decreasing the overall level of ISWI protein (Figure 2A).

We also failed to observe obvious differences in the level of ISWI associated with the

polytene chromosomes of larvae expressing His1 dsRNA and control larvae (Figure 2B,

C). Thus, H1 does not appear to modulate chromosome structure by altering the

expression of ISWI or its association with chromatin.

Histone H1 undergoes rapid, replication-independent exchange in vivo:

How does ISWI promote the association of H1 with chromatin? ISWI can promote the

assembly of nucleosome arrays containing H1 in vitro (LUSSER et al. 2005; MAIER et al.

2008), suggesting that it may be required for replication-coupled chromatin assembly in

vivo. ISWI could also promote H1 incorporation via a replication-independent

mechanism, since H1 undergoes rapid, ATP-dependent exchange throughout the cell

cycle in other organisms (CATEZ et al. 2006). As a first step toward distinguishing

between these possibilities, we used fluorescence recovery after photobleaching

(FRAP) to analyze interactions between H1 and chromosomes in a strain expressing

CFP-tagged histone H1. We found that the majority of H1 associated with

10

chromosomes undergoes rapid exchange in vivo (Figure 3A). As observed in

mammalian cells (MISTELI et al. 2000), approximately half the H1 underwent exchange

within 50 seconds. This exchange must be replication independent due to short

duration of our experiment and the fact that only two to three rounds of DNA replication

occur over 48 hours in the salivary glands of third instar larvae (RODMAN 1967).

Furthermore, treatment of salivary glands with aphidicolin, an inhibitor of DNA

replication, did not affect the rate of H1 exchange (Figure 3A). H1 exchange therefore

occurs independently of replication-coupled chromatin assembly in this tissue.

H1 knockdown decreases nucleosome repeat length:

The above findings indicated that ISWI might promote the association of H1 with

chromatin during either replication-coupled chromatin assembly or replication-

independent H1 exchange. To help distinguish between these possibilities, we

compared changes in nucleosome repeat length (NRL) resulting from the loss of H1 and

ISWI function. Incorporation of H1 during de novo chromatin assembly increases the

average distance between nucleosomes and there is a strong correlation between NRL

and the amount of H1 incorporated during chromatin assembly (BLANK and BECKER

1995; ROUTH et al. 2008; WOODCOCK et al. 2006). Thus, the reduced expression of H1 -

or factors that promote replication-coupled H1 assembly - should cause a significant

decrease in NRL. By contrast, the loss of factors required for replication-independent

H1 exchange should have little or no effect on NRL, since this process occurs after

genome-wide nucleosome density has been established. We previously demonstrated

11

that the loss of ISWI function has no apparent effect on NRL in the larval salivary gland,

even though it leads to the loss of H1 from chromosomes (CORONA et al. 2007). By

contrast, reducing the level of H1 in the salivary gland via expression of His1 dsRNA

leads to a reproducible 14 base pair decrease in NRL from 172 to 158 base pairs

(Figure 3B). These data suggest that ISWI is not required for replication-dependent H1

assembly in salivary gland nuclei.

ATP is required for the association of histone H1 with interphase chromosomes:

If ISWI is required for replication-independent H1 assembly, a reduction in cellular ATP

levels should lead to the loss of H1 from chromosomes. To test this prediction, we

monitored the association of histone H1-CFP with polytene chromosomes by live

analysis following exposure to inhibitors of oxidative phosphorylation. Within one hour

of azide treatment, H1-CFP was detected in the nucleoplasm in more than 90% of

nuclei (Figure 3C, second panel); this was never observed in untreated salivary glands.

In approximately 15% of nuclei, all the H1-CFP had dissociated from chromosomes and

was found in the nucleoplasm (Figure 3C, third panel). Similar results were obtained

with other inhibitors of oxidative phosphorylation, including antimycin A and rotenone

(data not shown). By contrast, azide treatment had no effect on the association of a

tagged core histone, H2AvD-GFP (CLARKSON and SAINT 1999), with chromosomes

(Figure 3C, fourth panel). Since ATP-depletion affects many cellular processes, it is

possible that azide treatment triggers the dissociation of H1 from polytene

chromosomes via an ISWI-independent mechanism. However, our data suggest that

12

replication-independent H1 assembly is an energy-dependent process that is subject to

regulation by ISWI or other factors.

Characterization of chromosome defects resulting from the loss of H1 and ISWI

in living cells:

Live analysis revealed that the dissociation of H1 from chromosomes following

treatment with inhibitors of oxidative phosphorylation was not accompanied by obvious

changes in nuclear diameter or chromosome volume (Figure 3C). This was surprising,

since traditional methods for fixing and squashing polytene chromosomes showed that

the loss of H1 significantly increased the size of polytene chromosomes (see above).

To gain a more accurate impression of the relative roles of H1 and ISWI in chromosome

organization, we visualized chromosomes in living cells expressing H2AvD-GFP. The

expression of His1 dsRNA caused a two to five fold increase in their volume (Figure 4A,

B, E, G-I). This increase was not due to extra rounds of replication, since the DNA

content of chromosomes of control larvae and larvae expressing His1 dsRNA were

similar (Figure 1E). Interestingly, we never observed obvious changes in the banding

pattern of chromosomes following H1 knockdown in living cells, even when the

chromosome volume increased dramatically (Figure 4H, I). Thus, His1 RNAi caused

much greater changes in salivary gland polytene chromosome structure than ATP

depletion, even though both conditions led to a significant reduction in the level of H1

associated with chromatin.

13

Live analysis of salivary gland nuclei expressing H2AvD-GFP also revealed differences

between the chromosome defects resulting from the expression of His1 dsRNA and the

dominant-negative ISWIK159R protein. The expression of ISWIK159R did not cause

obvious changes in chromosome size (Figure 4C, D, F), even though these

chromosomes contain reduced levels of H1 (CORONA et al. 2007). Indeed, when

normalized for DNA content, the volume of chromosomes of control larvae and larvae

expressing ISWIK159R were indistinguishable (Figure 4G). The banding pattern of

polytene chromosomes was often disrupted, however, and we frequently observed

“holes” which may represent regions of decondensed chromatin (Figure 4C, D, H, J).

These defects are similar to those observed following the treatment of salivary glands

with inhibitors of oxidative phosphorylation (compare Figures 3C and 4D).

DISCUSSION

Our findings provide direct evidence that H1 is a major determinant of interphase

chromosome structure and support our proposal that ISWI regulates higher-order

chromatin structure by promoting the association of H1 with chromatin. The

incorporation of H1 during replication-coupled chromatin assembly has a particularly

dramatic effect on chromatin compaction. After chromatin has been assembled, the

continued association of H1 with chromosomes, while important, appears to have more

subtle effects on chromosome structure.

14

An independent analysis of phenotypes resulting from the knock down of Drosophila

His1 by RNAi was recently reported (LU et al. 2009). Consistent with our data, the

authors of this study found that histone H1 is essential for Drosophila development.

However, they observed relatively mild defects in salivary gland polytene chromosome

structure following H1 knock down. These defects appear similar to the weakest

phenotypes we observed following H1 knockdown (Figure 1C), which may reflect

differences in the extent of H1 knock down achieved in our studies. Based on the

analysis of fixed polytene chromosomes squashes following H1 depletion, Lu et al.

concluded that H1 is required for the alignment of sister chromatids in polytene

chromosomes (LU et al. 2009). Although we observed an even stronger disruption of

the banding pattern of polytene chromosomes squashes following H1 knock down, we

rarely observed such defects via live analysis. Our data therefore argue against a major

role for H1 in sister chromatid alignment and illustrate the importance of using live

analysis to study factors involved in the regulation of higher-order chromatin structure.

The incorporation of H1 during replication-coupled chromatin assembly increases the

average distance between nucleosomes, thus leading to a decrease in genome-wide

nucleosome density (WOODCOCK et al. 2006). Accordingly, we observed a significant

decrease in NRL following H1 knockdown (Figure 3B). By contrast, the loss of ISWI

function leads to a dramatic reduction in the level of H1 associated with chromosomes

without causing obvious changes in NRL (CORONA et al. 2007). These data strongly

suggest that ISWI promotes the association of H1 with salivary gland polytene

15

chromosomes via a replication-independent mechanism. It remains possible that an

additional role for ISWI in replication-coupled H1 assembly escaped detection in our

genetic studies due to the failure to completely eliminate ISWI function during the stages

of salivary gland development when the bulk of DNA replication occurs. Further

experiments, including the analysis of fast-acting conditional ISWI alleles, will be

required to address this issue.

How does ISWI promote the association of H1 with chromatin? By altering the

structure, accessibility or fluidity of chromatin, ISWI may facilitate the binding of H1 to

chromatin during dynamic exchange. Consistent with this possibility, we found that

inhibitors of oxidative phosphorylation leads to the dissociation of H1 from polytene

chromosomes accompanied by its accumulation in the nucleoplasm. Alternatively,

ISWI may stabilize the binding of H1 to chromatin by influencing its phosphorylation. H1

is phosphorylated in most organisms, including Drosophila (VILLAR-GAREA and IMHOF

2008). In both Tetrahymena and mammals, the phosphorylation of H1 weakens its

association with chromatin, leading to an increased frequency of H1 exchange (DOU et

al. 2002; CONTRERAS et al. 2003). Thus, ISWI may indirectly promote the association of

H1 with chromatin by altering the level or activity of a H1 kinase or phosphatase.

The chromatin of stem cells is hyperdynamic, with both histone H1 and other chromatin-

associated proteins undergoing highly elevated rates of exchange (MESHORER and

MISTELI 2006). This property of pluripotent cell types appears to be functionally

16

important, since a mutant form of H1 that tightly binds chromatin blocks stem cell

differentiation (MESHORER et al. 2006). These findings suggest that ISWI and other

factors that regulate the association of H1 with chromatin may play important roles in

the regulation of cellular pluripotency and differentiation. This possibility is intriguing in

light of recent studies implicating ISWI in both nuclear reprogramming and stem cell

self-renewal (KIKYO et al. 2000; XI and XIE 2005).

Previous studies have shown that the dosage compensation machinery antagonizes

ISWI function via the acetylation of its nucleosome substrate on H4K16 (CORONA et al.

2002; SHOGREN-KNAAK et al. 2006). Furthermore, increased linker histone exchange has

been observed in active chromatin enriched in core histone acetylation (MISTELI et al.

2000). It is therefore tempting to speculate that the dynamic association of H1 with

chromatin is modulated by the interplay of chromatin-remodeling and modifying

enzymes, thus providing a straightforward mechanism for creating rapid, readily

reversible changes in higher-order chromatin structure and gene expression. Further

work will be required to test this hypothesis and clarify the molecular mechanisms that

regulate the association of H1 with chromatin in vivo.

17

MATERIALS AND METHODS

Drosophila stocks and crosses:

Flies were raised on cornmeal, agar, yeast and molasses medium, supplemented with

methyl paraben and propionic acid. The GAL4 system (BRAND et al. 1994) was used to

drive the expression of His1-RNAi and ISWIK159R. da-GAL4 is expressed broadly at all

stages of development (GERBER et al. 2004). For viability studies, UAS-His1-dsRNA

males were crossed to da-GAL4 or Df(1)w67c2 females and the progeny were scored

for survival to adulthood. All crosses were carried out at 29° unless otherwise indicated.

Generation of transgenic strains bearing UAS-His1-dsRNA transgenes:

The Drosophila His1 coding region was amplified from Canton S genomic DNA by PCR

using the primers 5ʼ-CGAATTCGACAGTTGAGAAGAAAGTGGTCC-3ʼ and 5ʼ-

GGGTGGCCATCTTGGCCGTAGTCTTCGCT-3ʼ or 5ʼ-

CCGCTCGAGACAGTTGAGAAGAAAGTGG-3ʼ and 5ʼ-

GGGTGGCCTAGATGGCCGTAGTCTTCGCTT-3ʼ. The resulting PCR products were

digested with Sfi1 and ligated to form an inverted repeat flanked by EcoR1 and Xho1

sites. The inverted repeats were cleaved with EcoR1 and Xho1 and subcloned into

pUAST. BLAST searches revealed that the His1 fragment in this construct is not

sufficiently related to other regions of the Drosophila genome to generate off-target

effects. Transformants were generated by P-element mediated transformation using the

Df(1)w67c2 strain. Homozygous viable transformants used in the study include UAS-

18

His1-dsRNA-8-4 and UAS-His1-dsRNA-13-1 on the X chromosome and UAS-His1-

dsRNA-10-3 on chromosome 3.

Generation of H1-Flag-CFP transgenic strains:

The coding sequence for Drosophila His1 was amplified by PCR from a cDNA clone

using the primers 5ʼ-GCTATGCTATGCGGCCGCATGTCTGATTCTGCAGTT-3ʼ and 5ʼ-

CATACCGGTCTTGTCGTCGTCGTCCTTGTAGTCCTTTTTGGCAGCCGTAG-3ʼ. The

sequence of CFP was amplified by PCR using the primers 5ʼ-

GCTATGCTATGCGGCCGCACCGGTATGGTGAGCAAGGGCGA-3ʼ and 5ʼ-

CACTAGTTACTTGTACAGCTCGTCCATG-3ʼ. The PCR products were cloned in the

pCR2.1-TA Topo vector (Invitrogen). The H1 insert was digested with SpeI and NotI and

subcloned into pBS-SK. The CFP fragment was digested with AgeI and SpeI and cloned

into pBS-dH1 using the same restriction sites. The H1-flag-CFP fusion was digested

with NotI and SpeI and subcloned downstream of a constitutively expressed α-tubulin

promoter in pCaSpeR4 (generously provided by Konrad Basler). The construct was

sequenced and used to generate a y w strain bearing a homozygous viable insertion on

the third chromosome by P element-mediated transformation.

Analysis of polytene chromosome structure:

Salivary glands of third instar larvae were dissected in 0.7% NaCl and fixed in 1.85%

formaldehyde/ 45% acetic acid as previously described (CORONA et al. 2007). To

analyze the effect of H1 knockdown on chromosome structure, da-GAL4 females were

19

mated to P[w+, UAS-His1-dsRNA-8-4]/Y males. To analyze the effect of ISWIK159R

expression on chromosome structure, H2AvD-GFP females were mated to w; P[w+,

eyGAL4], P[w+, UAS-ISWIK159R-HA-6His]11-4/ TM3 males at 18°. Chromosome

preparations were analyzed using a Zeiss Axioskop 2 plus fluorescent microscope

equipped with an Axioplan HRm CCD camera and Axiovision 4.2 software [Zeiss]. For

DNA quantification, images were captured using identical exposure times. Chromosome

boundaries were identified and the sum pixel intensity within chromosomes was

calculated using Volocity software (Release 4.2.1; www.improvision.com). Antibodies

used in this study are affinity-purifed rabbit anti-ISWI(TSUKIYAMA et al. 1995), rabbit anti-

H3K9me3 [Abcam, ab8898] and rabbit anti-H4Ac(tetra) [Active Motif, 39179].

Electrophoresis and protein blotting:

To analyze the effect of H1 knockdown on nucleosome repeat length, da-GAL4 females

were mated to P[w+, UAS-His1-dsRNA-8-4]/Y males. Salivary gland protein extracts

were prepared from third-instar larvae and analyzed by protein blotting as described

previously (CORONA et al. 2007) using affinity-purified rabbit antibodies against ISWI

(TSUKIYAMA et al. 1995) and rabbit polyclonal antibodies against H1(NER and TRAVERS

1994) and H3 [Abcam, ab1791].

Analysis of salivary gland chromatin by micrococcal nuclease digestion:

Salivary gland chromatin was extracted from P[w+, UAS-His1-dsRNA-8-4]/+; da-GAL4/+

or control da-GAL4/+ third-instar larvae and partially digested with micrococcal nuclease

20

as described previously (CORONA et al. 2007). Images were obtained using a GelDoc

camera and QuantityOne software [Bio-Rad Laboratories]. Separate experiments were

carried out at least three times and gave highly reproducible results.

Confocal microscopy and FRAP analysis:

For live analysis of polytene chromosome phenotypes resulting from the loss of ISWI or

H1 function, or ATP depletion, one or two representative nuclei were chosen to be

analyzed per gland. In general, the appearance of nuclei within a single salivary gland

was very reproducible. Thus, the imaged nuclei are representative of a much larger

number of nuclei observed in several glands. Nuclei at the tip of the gland were

analyzed whenever possible to ensure consistent results. To analyze the effect of H1

knockdown on chromosome structure in living cells, da-GAL4, H2AvD-GFP females

were mated to P[w+, UAS-His1-dsRNA-8-4]/Y males. To analyze the effect of ISWIK159R

expression on chromosome structure in living cells, H2AvD-GFP females were mated to

P[w+, eyGAL4], P[w+, UAS-ISWIK159R-HA-6His]11-4/ TM3 males at 18°. Live polytene

chromosome nuclei were imaged using an inverted microscope [DM IRB, Leica

Microsystems] equipped with a laser confocal imaging system [TCS SP2, Leica

Microsystems]. 3D reconstruction and volume calculations of 0.5 µm sections of

polytene nuclei were performed by Volocity software (Release 4.2.1,

www.improvision.com). The change in chromatin compaction was established by

calculating the ratio of volume to DNA. The ratio of control samples was normalised to

1. FRAP analysis of salivary gland nuclei was carried out using an inverted microscope

21

[DM IRB, Leica Microsystems] equipped with a laser confocal imaging system [TCS

SP2, Leica Microsystems]. Images were acquired and analyzed using the FRAP

application of the Leica Microsystems confocal software version 2.61. Salivary glands

were dissected from third-instar larvae and incubated in Schneiderʼs insect medium

[Sigma] containing 50µg/ml aphidicolin [Sigma], or the equivalent volume of DMSO, for

4 hrs. Glands were then transferred to a coverslip and covered in mineral oil for FRAP

analysis. For each experiment, ten single imaging scans were acquired followed by

fifteen bleach pulses of 600 ms within a square region of interest (ROI) measuring 6 x

6µm. Images were then collected every 0.6 seconds (10 images), every 3 seconds (10

images) and every 5 seconds (30 images). For imaging, the laser power was attenuated

to 16% of the bleach intensity. A second ROI measuring 6 x 6µm within the same

polytene nucleus was used to normalize fluorescence values against background.

FRAP recovery curves were generated and analyzed using Microsoft Excel. The

recovery curves described represent the average values of 8 or more experiments.

To investigate ATP dependence of H1 exchange, salivary glands were treated with

agents that block oxidative phosphorylation. Salivary glands were dissected from third-

instar larvae expressing H2AvD-GFP or H1-CFP, and incubated for 1 hour in 1X PBS

containing 100mM sodium azide [Sigma], 100µM antimycin A [Sigma], or 2 hours in 1X

PBS containing 250mM rotenone [MP Biomedicals, LLC]. Control glands were

incubated for 1 hour in 1X PBS. Glands were then transferred to a coverslip and

covered in mineral oil for live analysis. 1µm sections of whole salivary gland nuclei were

acquired. 17 azide-treated H1-CFP and 10 azide-treated H2AvD-GFP nuclei were

22

analyzed. For untreated control experiments, 11 H1-CFP and 6 H2AvD-GFP nuclei were

analyzed. Similar treatments have been shown to reduce ATP levels in Drosophila

salivary glands by two to four fold within two hours (LEENDERS et al. 1974).

23

ACKNOWLEDGEMENTS

We thank the Bloomington Stock Center for the strains and Grant Hartzog, Susan

Strome, Rohinton Kamakaka and the members of our laboratories for numerous helpful

discussions. This work was supported by National Institutes of Health grant GM49883 to

JWT.

24

FIGURE LEGENDS

FIGURE 1. Loss of histone H1 alters chromosome structure. (A) Reduced histone H1

expression is observed in the salivary glands of P[w+, UAS-His1-dsRNA-8-4]/+; da-

GAL4/+ larvae, compared to control da-GAL4/+ larvae, as assayed by protein blotting.

Protein sizes can be determined by refering to molecular weight markers alongside the

gel. (B-D, F-H) Polytene chromosomes stained with DAPI. Control da-GAL4/+

chromosomes (B) exhibit normal morphology while His1 RNAi leads to chromosome

decondensation (C-D, F). (D) A magnification of the boxed regions of panels B, C and

G. P[w+, UAS-His1-dsRNA-8-4]/+; da-GAL4/+ chromosomes and the male Iswi1/Iswi2 X

chromosome are decondensed relative to the control chromosome, but the banding

pattern is maintained. (E) Quantification of DNA in P[w+, UAS-His1-dsRNA-8-4]/+; da-

GAL4/+ and control da-GAL4/+ chromosomes . (F) Individual chromosome arms are no

longer distinguishable in some nuclei. (G) The male X chromosome (arrowhead) is

decondensed in Iswi1/Iswi2 larvae. (H) Expression of ISWIK159R leads to disorganized

chromatin (arrowhead) and decondensation (arrow) of all chromosomes. (I)

Quantification of DNA in P[w+, eyGAL4], P[w+, UAS-ISWIK159R-HA-6His]11-4/ H2AvD-

GFP and control H2AvD-GFP/TM3 chromosomes. Bars, 20 µm.

FIGURE 2. Histone H1 is not required for the expression of ISWI or its binding to

chromatin. (A) Levels of ISWI protein are not affected in the salivary glands of P[w+,

UAS-His1-dsRNA-8-4]/+; da-GAL4/+ larvae, compared to control da-GAL4/+ larvae, as

25

assayed by protein blotting. A comparable blot was probed with antibodies against

histone H3 as a control. Protein sizes can be determined by referring to molecular

weight markers alongside the gel. (B, C) Polytene chromosomes of da-GAL4/+ (B) and

P[w+, UAS-His1-dsRNA-8-4]/+; da-GAL4/+ (C) larvae were stained with an antibody

against ISWI. Polytene chromosomes were prepared and processed in parallel, and

images were captured using identical exposure times.

FIGURE 3. Histone H1 is rapidly exchanged in salivary gland nuclei and increases

NRL. (A) Quantitative analysis of FRAP experiments. The recovery curve for

aphidicolin-treated nuclei shown in dark grey; the recovery curve for control DMSO-

treated nuclei in light grey. Salivary glands were incubated in aphidicolin or DMSO for

four hours prior to FRAP analysis. (B) Partial micrococcal nuclease digestion of

chromatin isolated from salivary glands of da-GAL4/+ and P[w+, UAS-His1-dsRNA-8-

4]/+; da-GAL4/+ larvae. Loss of histone H1 leads to a reduction in NRL compared to

control. DNA fragment sizes can be determined by refering to the 100bp ladder

alongside the gel. (C) Examples of phenotypes resulting from azide treatment of nuclei

expressing H1-CFP or H2AvD-GFP; dashed line identifies the nuclear boundary.

Histone H1 dissociates from chromosomes and appears in the nucleoplasm. Azide

treatment had no effect on H2AvD association with chromosomes. Bars, 20 µm.

FIGURE 4. Loss of histone H1 increases chromosome volume. (A-D, H-J) Live analysis

of nuclei expressing H2AvD-GFP reveals decondensation of P[w+, UAS-His1-dsRNA-8-

26

4]/+; da-GAL4, H2AvD-GFP/+ chromosomes (B) compared to da-GAL4, H2AvD-GFP/+

chromosomes (A). (D) P[w+, eyGAL4], P[w+, UAS-ISWIK159R-HA-6His]11-4/ H2AvD-GFP

chromosomes show disorganized chromatin structure but no increase in chromosome

volume compared to control H2AvD-GFP/TM3 chromosomes (C). Bars, 20 µm. (E)

Volume quantification of P[w+, UAS-His1-dsRNA-8-4]/+; da-GAL4, H2AvD-GFP/+ and

control da-GAL4, H2AvD-GFP/+ chromosomes. (F) Volume quantification of P[w+,

eyGAL4], P[w+, UAS-ISWIK159R-HA-6His]11-4/ H2AvD-GFP and control H2AvD-

GFP/TM3 chromosomes. (G) Quantification of the change in chromatin compaction

relative to control, established by calculating the ratio of volume to DNA for each

nucleus. The ratio of control samples was normalized to 1. (H-J) A magnification of

arms from H2AvD-GFP/TM3 chromosomes (H), P[w+, UAS-His1-dsRNA-8-4]/+; da-

GAL4, H2AvD-GFP/+ chromosomes (I) and P[w+, eyGAL4], P[w+, UAS-ISWIK159R-HA-

6His]11-4/ H2AvD-GFP chromosomes (J). Bars, 5 µm.

27

TABLE 1. His1 is essential for development.

Survival to adulthood Cross

Females Males

da-GAL4 x P[w+, UAS-His1-dsRNA-8-4]/Y 0 44

Df(1)w x P[w+, UAS-His1-dsRNA-8-4]/Y 78 85

da-GAL4 x P[w+, UAS-His1-dsRNA-13-1]/Y 0 127

Df(1)w x P[w+, UAS-His1-dsRNA-13-1]/Y 94 121

da-GAL4 x P[w+; UAS-His1-dsRNA-10-3] 0 0

Df(1)w x P[w+; UAS-His1-dsRNA-10-3] ND ND

Homozygous da-GAL4 or Df(1)w virgin females were mated to males bearing UAS-His1-dsRNA

transgenes on the X (8-4, 13-1) or third chromosome (10-3) at 29° and scored for survival to adulthood. In

all cases, lethality occurred at the late larval or early pupal stages. ND – not determined.

28

LITERATURE CITED

BLANK, T. A., and P. B. BECKER, 1995 Electrostatic mechanism of nucleosome spacing. J

Mol Biol 252: 305-313.

BOUAZOUNE, K., and A. BREHM, 2006 ATP-dependent chromatin remodeling complexes

in Drosophila. Chromosome Res 14: 433-449.

BRAND, A. H., A. S. MANOUKIAN and N. PERRIMON, 1994 Ectopic expression in

Drosophila. Methods Cell Biol 44: 635-654.

BROWN, D. T., 2003 Histone H1 and the dynamic regulation of chromatin function.

Biochem Cell Biol 81: 221-227.

CARRUTHERS, L. M., J. BEDNAR, C. L. WOODCOCK and J. C. HANSEN, 1998 Linker histones

stabilize the intrinsic salt-dependent folding of nucleosomal arrays: mechanistic

ramifications for higher-order chromatin folding. Biochemistry 37: 14776-14787.

CATEZ, F., T. UEDA and M. BUSTIN, 2006 Determinants of histone H1 mobility and

chromatin binding in living cells. Nat Struct Mol Biol 13: 305-310.

CLARKSON, M., and R. SAINT, 1999 A His2AvDGFP fusion gene complements a lethal

His2AvD mutant allele and provides an in vivo marker for Drosophila

chromosome behavior. DNA Cell Biol 18: 457-462.

CONTRERAS, A., T. K. HALE, D. L. STENOIEN, J. M. ROSEN, M. A. MANCINI, et al., 2003 The

dynamic mobility of Histone H1 is regulated by Cyclin/CDK phosphorylation. Mol

Cell Biol 23: 8626-8636.

29

CORONA, D. F., C. R. CLAPIER, P. B. BECKER and J. W. TAMKUN, 2002 Modulation of ISWI

function by site-specific histone acetylation. EMBO Rep 3: 242-247.

CORONA, D. F., G. SIRIACO, J. A. ARMSTRONG, N. SNARSKAYA, S. A. MCCLYMONT et al.,

2007 ISWI regulates higher-order chromatin structure and histone H1 assembly

in vivo. PLoS Biol 5: e232.

DEURING, R., L. FANTI, J. A. ARMSTRONG, M. SARTE, O. PAPOULAS et al., 2000 The ISWI

chromatin-remodeling protein is required for gene expression and the

maintenance of higher order chromatin structure in vivo. Mol Cell 5: 355-365.

DOU, Y., J. BOWEN, Y. LIU and M. A. GOROVSKY, 2002 Phosphorylation and an ATP-

dependent process increase the dynamic exchange of H1 with chromatin. J Cell

Biol 158:1161-1170.

FAN, Y., T. NIKITINA, J. ZHAO, T. J. FLEURY, R. BHATTACHARYYA et al., 2005 Histone H1

depletion in mammals alters global chromatin structure but causes specific

changes in gene regulation. Cell 123: 1199-1212.

GERBER, M., J. C. EISSENBERG, S. KONG, K. TENNEY, J. W. CONAWAY et al., 2004 In vivo

requirement of the RNA polymerase II elongation factor elongin A for proper gene

expression and development. Mol Cell Biol 24: 9911-9919.

GODDE, J. S., and K. URA, 2008 Cracking the enigmatic linker histone code. J Biochem

143: 287-293.

KHOCHBIN, S., 2001 Histone H1 diversity: bridging regulatory signals to linker histone

function. Gene 271: 1-12.

30

KIKYO, N., P. A. WADE, D. GUSCHIN, H. GE, A. P. WOLFFE, 2000 Active remodeling of

somatic nuclei in egg cytoplasm by the nucleosomal ATPase ISWI. Science

289:2360-2632.

LEENDERS, H. J., A. KEMP, J. F. KONINKX and J. ROSING, 1974 Changes in cellular ATP,

ADP and AMP levels following treatments affecting cellular respiration and the

activity of certain nuclear genes in Drosophila salivary glands. Exp Cell Res 86:

25-30.

LEVER, M. A., J. P. H. TH'NG, X. SUN and M. J. HENDZEL, 2000 Rapid exchange of

histone H1.1 on chromatin in living human cells. Nature 408:873-876.

LU, X., S. N. WONTAKAL, A. V. EMELYANOV, P. MORCILLO, A. Y. KONEV et al., 2009 Linker

histone H1 is essential for Drosophila development, the establishment of

pericentric heterochromatin, and a normal polytene chromosome structure.

Genes Dev.

LUSSER, A., D. L. URWIN and J. T. KADONAGA, 2005 Distinct activities of CHD1 and ACF

in ATP-dependent chromatin assembly. Nat Struct Mol Biol 12: 160-166.

MAIER, V. K., M. CHIODA and P. B. BECKER, 2008 ATP-dependent chromatosome

remodeling. Biol Chem 389: 345-352.

MARESCA, T. J., B. S. FREEDMAN and R. HEALD, 2005 Histone H1 is essential for mitotic

chromosome architecture and segregation in Xenopus laevis egg extracts. J Cell

Biol 169: 859-869.

MESHORER, E. and T. MISTELI, 2006 Chromatin in pluripotent embryonic stem cells and

differentiation. Nat Rev Mol Cell Biol 7:540-546

31

MESHORER, E., D. YELLAJOSHULA, E. GEORGE, P. J. SCAMBLER, D. T. BROWN et al., 2006

Hyperdynamic plasticity of chromatin proteins in pluripotent embryonic stem cells.

Dev Cell 10:105-116.

MISTELI, T., A. GUNJAN, R. HOCK, M. BUSTIN and D. T. BROWN, 2000 Dynamic binding of

histone H1 to chromatin in living cells. Nature 408: 877-881.

NER, S. S., and A. A. TRAVERS, 1994 HMG-D, the Drosophila melanogaster homologue

of HMG 1 protein, is associated with early embryonic chromatin in the absence of

histone H1. Embo J 13: 1817-1822.

ROBINSON, P. J., and D. RHODES, 2006 Structure of the '30 nm' chromatin fibre: a key

role for the linker histone. Curr Opin Struct Biol 16: 336-343.

RODMAN, T. C., 1967 DNA replication in salivary gland nuclei of Drosophila

melanogaster at successive larval and prepupal stages. Genetics 55: 375-386.

ROUTH, A., S. SANDIN and D. RHODES, 2008 Nucleosome repeat length and linker histone

stoichiometry determine chromatin fiber structure. Proc Natl Acad Sci U S A 105:

8872-8877.

SHOGREN-KNAAK, M., H. ISHII, J. M. SUN, M. J. PAZIN, J. R. DAVIE et al., 2006 Histone H4-

K16 acetylation controls chromatin structure and protein interactions. Science

311: 844-847.

TSUKIYAMA, T., C. DANIEL, J. TAMKUN and C. WU, 1995 ISWI, a member of the

SWI2/SNF2 ATPase family, encodes the 140 kDa subunit of the nucleosome

remodeling factor. Cell 83: 1021-1026.

32

VILLAR-GAREA, A. and A. IMHOF, 2008 Fine mapping of posttranslational modifications of

the linker histone H1 from Drosophila melanogaster. PLoS ONE 3:1-12.

WOODCOCK, C. L., A. I. SKOULTCHI and Y. FAN, 2006 Role of linker histone in chromatin

structure and function: H1 stoichiometry and nucleosome repeat length.

Chromosome Res 14: 17-25.

XI, R. and T. XIE, 2005 Stem cell self-renewal controlled by chromatin remodeling

factors. Science 310:1487-1489