Transcript
Page 1: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

Standardization of Standardization of Pedigree CollectionPedigree Collection

Page 2: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

Genetics of Alzheimer’s Genetics of Alzheimer’s DiseaseDisease

Alzheimer’s Disease

Gene 1 Gene 2

Environmental Factor 1

Environmental Factor 2

Page 3: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

Genetic Approaches to Genetic Approaches to Gene Identification In Gene Identification In Alzheimer’s DiseaseAlzheimer’s Disease

Page 4: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

Identifying genes for complex Identifying genes for complex diseasedisease

Association Test candidate gene Collect sample of

affected and control subjects

Compare frequency of a genetic polymorphism in 2 samples

Linkage Test entire

genome Collect families

with multiple affected members

Affected Control

Page 5: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

Linkage vs. AssociationLinkage vs. Association Linkage

Measures the segregation of alleles and a phenotype within a family

Detected over large physical distances

Association Measures preferential segregation of a

particular allele with a phenotype across families

Detected over shorter distances

Page 6: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

Meiosis and LinkageMeiosis and Linkage

Gamete formation Meiosis I: Homologous

chromosomes pair Crossing over occurs

Genes that are physically close together are more likely to be coinherited

Genes that are physically far apart on the chromosome are less likely to be coinherited

Page 7: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

Linkage ApproachLinkage Approach

Seeks to identify, IN FAMILIES, chromosomal regions that are consistently transmitted to affected individuals. Identify these regions using ‘markers’ Find a marker which is ‘linked’ to the

disease

Page 8: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

Linkage: Autosomal Linkage: Autosomal DominantDominant

Page 9: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

Traditional Linkage Traditional Linkage ApproachApproach

Successful in the identification of genes for Alzheimer’s disease

Amyloid precursor protein (APP)

Presenilin I (PS1) Presenilin II (PS2)

Page 10: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

Further Genetic StudiesFurther Genetic Studies

Clearly, most families with Alzheimer’s disease do not have a clear pattern of Mendelian inheritance

Already, one susceptibility gene has been identified whose alleles can either increase or decrease the risk of AD

There are certainly other genes which are to be identified

Page 11: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

How to tackle finding How to tackle finding these other genes?these other genes?

Page 12: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

Genetics of Alzheimer’s Genetics of Alzheimer’s DiseaseDisease

Alzheimer’s Disease

Gene 1 Gene 2

Environmental Factor 1

Environmental Factor 2

Page 13: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

Linkage in Complex Linkage in Complex DiseaseDisease

Identify families with multiple affected members Increases the likelihood that genes are

important in disease susceptibility in that family

Pattern of inheritance less certain Collect family members to follow

segregation of disease and marker alleles

Page 14: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

Identity By Descent (IBD)Identity By Descent (IBD)

Allele 1 AGCTCACACACACACACACACAATCGAllele 2 AGCTCACACACACACACAATCGTCGAAllele 3 AGCTCACACACACAATCGTCGACCGCAllele 4 AGCTCACACACAATCGTCGACCGCGG

Page 15: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

Linkage AnalysisLinkage Analysis

Employ nonparametric linkage methods Identify chromosomal regions that are

preferentially transmitted within a family to the affected individuals.

Method is not based on recombination but on IBD marker allele sharing

Page 16: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

Analysis of Affected Analysis of Affected RelativesRelatives

Look for chromosomal regions shared in common by affected relatives in the same family. Presume that affected individuals in

the same family will have some similar susceptibility genes.

Look at patterns across families to determine if the same chromosomal region is being shared.

Page 17: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

Genome Screen ApproachGenome Screen Approach

Evaluate the entire genome Analyze markers located at regular

intervals throughout the genome Identify regions that are

consistently shared by affected relatives

Marker

s

Page 18: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

Association StudiesAssociation Studies Once a chromosomal region has

been identified which is linked to AD, additional studies are necessary to identify the causative gene

Association studies typically test for linkage disequilibrium rather than linkage. Linkage disequilibrium extends over

shorter distances. Often employ SNPs.

Page 19: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

Association StudiesAssociation Studies Studies of linkage disequilibrium

can study: Transmission of alleles throughout a

family consisting of affected and unaffected individuals.

Compare allele frequencies between affected and unaffected individuals.

Many new methods are being developed to more effectively test for linkage disequilibrium.

Page 20: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

AD Genetics Initiative AD Genetics Initiative GoalsGoals

Identification of genes contributing to Mendelian forms of AD are very important. Provide insight into important pathways Provide potential candidate genes to

examine in non-Mendelian forms of disease

This study seeks to identify the genes contributing to non-Mendelian forms of AD.

Page 21: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

Design of the AD Design of the AD Genetics InitiativeGenetics Initiative

Page 22: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

Appropriate Families for Appropriate Families for StudyStudy

At least 2 living siblings with LOAD (onset > 60 years)

At least 1 other living related family member who :

Has AD (onset > 50 years)

Or

Is unaffected (> 60 years)

Page 23: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

Appropriate Families for Appropriate Families for StudyStudy

Who should be collected in this family? Why? If parents in generation I are

alive, they should be collected.

Collection of the parents will allow allele sharing to be determined more definitely in studies of the siblings in generation II.

More definitive allele sharing produces more definite linkage results -> more power to find genes for AD

II

IIII

Page 24: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

Appropriate Families for Appropriate Families for StudyStudy

Who should be collected in this family? Why? Collect all siblings in generation II

(AD and non-AD)

This is particularly important if the parents in generation I are deceased

Study allele sharing in generation II.

Studies can compare allele sharing among the AD siblings and the discordant siblings

Can evaluate linkage disequilibrium.

II

IIII

Page 25: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

Deceased Family MembersDeceased Family Members Testing markers in the parents and

offspring of a deceased person makes it possible to estimate what the individual must have inherited

Page 26: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

Reconstruction Reconstruction

Estimating a missing person’s likely genotype is termed ‘reconstruction’.

This is the principal being employed in the identification of specimens in many forensic cases.

Page 27: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

Power to ReconstructPower to Reconstruct

The power to reconstruct a missing genotype is dependent on how many closely related family members can be sampled.

The important people to sample are the offspring of a deceased, affected individual.

Page 28: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

Appropriate Families for Appropriate Families for StudyStudy

Who should be collected in this family? Why? Offspring of the individuals in

generation II can be important for genetic studies.

Do any individuals in generation III have symptoms of memory loss or AD? If so, collect them.

Are any of the individuals in generation III over the age of 60 years? Longitudinal follow-up of these individuals may identify new cases of AD.

II

IIII

Page 29: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

Appropriate Families for Appropriate Families for StudyStudy

Who should be collected in this family? Why? If any offspring in generation

III are collected, it is important to also collect both their parents, when possible.

The individual in blue is important when determining which alleles the offspring in generation III have inherited from her affected father.

II

IIII

IIIIII

Page 30: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

Appropriate Families for Appropriate Families for StudyStudy

Who should be collected in this family? Why? Did anyone in the family have

an autopsy and is tissue still available?

Collect information about these individuals and consider obtaining these materials, if possible.

II

IIII

Page 31: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

Who to collect?Who to collect?

A commonly asked question is who should I collect a blood sample from in a genetic study?

The answer is all genetically informative individuals!

Page 32: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

Who is genetically Who is genetically informativeinformative

Genetic analysis seeks to study the transmission of marker alleles throughout the family. When we can determine the

inheritance of all marker alleles unambiguously, we have the greatest power to find genes for disease!

Unaffected individuals may be very important for collection.

Page 33: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

Who is genetically Who is genetically informativeinformative

Collect affected individuals

Collect as many individuals with a • as are willing to participate

Page 34: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

Who is genetically Who is genetically informativeinformative

Insert pedigree with affected siblings + aunt

go through who to collect

summarize at bottom of slide

• Collect affected individuals

Collect as many individuals with a • as are willing to participate

Page 35: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

Which are the best Which are the best families?families?

Families with the largest number of affected individuals. Strong family history suggests more

genetic. Unaffected individuals in families with

many affected individuals are also very important, particularly if they are examined clinically.

Page 36: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

Who is genetically Who is genetically informativeinformative

Collect all affected individuals

Collect any living connecting relatives

Collect any unaffected siblings

Page 37: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

Which are the best Which are the best families?families?

Cooperative Families Families eager to participate in

research will typically complete the study faster.

Provide annual follow-up information more easily.

Assist in research if additional information/samples are needed.

Important to remain in contact with families and provide them with information about the study

Page 38: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

Who to CollectWho to Collect

Collect the parents in generation I, if available

Collect all siblings in generation II (affected and unaffected)

Collect any individuals in generation III with memory loss

Collect any individuals in generation III > 60 years

Query for any other affected cousins, half siblings, aunts, uncles??

II

IIII

IIIIII

Page 39: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

When in Doubt??When in Doubt??

Contact Susan LaRusse who will Contact Susan LaRusse who will help sites identify the critical help sites identify the critical individuals in their pedigrees.individuals in their pedigrees.

Page 40: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor

Top Related