Molecular phylogeny of earthworms (Annelida : Crassiclitellata)based on 28S, 18S and 16S gene sequences
Samuel W. JamesA,C and Seana K. DavidsonB
ADepartment of Biology, 143 Biology Building, University of Iowa, Iowa City, IA 52242-1324, USA.BDepartment of Civil and Environmental Engineering, University of Washington, Benjamin Hall Building,616 Northlake Place, Seattle, WA 98195-5014, USA.
CCorresponding author. Email: [email protected]
Abstract. Relationships among, and content of, earthworm families have been controversial and unstable.Herewe analysemolecular data from 14 Crassiclitellata families represented by 54 genera, the non-crassiclitellate ‘earthworms’ of theMoniligastridae, plus several clitellate outgroups. Complete 28S and 18S gene sequences and a fragment of the 16S geneanalysed separately or in concatenated Bayesian analyses indicate that most previously proposed suprafamilial taxawithin the Crassiclitellata are para- or polyphyletic. There is strong support for the Metagynophora, which consists ofthe Crassiclitellata andMoniligastridae. Themost basal within-Clitellata branch leads to the small families Komarekionidae,Sparganophilidae, Kynotidae, and Biwadrilidae, found in widely separated areas. A clade composed of Lumbricidae,Ailoscolecidae, Hormogastridae, Criodrilidae and Lutodrilidae appears near the base of the tree, but Criodrilidaeand Biwadrilidae are not closely related because the former is sister to the Hormogastridae +Lumbricidae clade. TheGlossoscolecidae is here separated into two families, the Glossoscolecidae s.s. and the Pontoscolecidae (fam. nov.). TheMegascolecidae is monophyletic within a clade including all acanthodrilid earthworms. There is strong support forthe Benhamiinae (Acanthodrilidae s.l.) as sister to Acanthodrilidae +Megascolecidae, but taxon sampling within otheracanthodrilid groups was not sufficient to reach further conclusions. The resulting trees support revised interpretations ofmorphological character evolution.’
Received 31 March 2011, accepted 6 March 2012, published online 6 August 2012
Introduction
Over the last 120 years, various classifications of earthwormshave been proposed and debated usingmorphological characters,sometimes in an evolutionary context, but rarely with anyexplicit analysis of character data, resulting in intuitiveconclusions (e.g. Michaelsen 1900; Stephenson 1930; Gates1972). This, coupled with the lack of a fossil record, has ledworkers in the field to reach diverse conclusions from the samebasic data, and to generally dismiss any character set thoughtto be ‘adaptive,’ or subject to selection based on environmentalcharacteristics. In contrast, Struck et al. (2011) found that afundamental lifestyle difference within Annelida was congruentwith their Expressed Sequence Tag (EST)-based phylogeny.However other ecological differences have not yet beenconfirmed at shallower branching points. Such a project doesnot look promising in the context of the current paper, becausemost earthworm families span a range of ecological niches.
The history of family and suprafamilial concepts in theCrassiclitellata Jamieson, 1988 (earthworms in general) revealsrecurrent problems in homology assumptions and ad hochypotheses of the importance of certain characters or suites ofcharacters, all complicated by the fact that different sets ofcharacters give conflicting signals. Erséus (2005) critiqued the
history of intuitive and formal phylogenetic arguments in theClitellataMichaelsen, 1919, and reached conclusions with whichwe agree: modern techniques of phylogenetic research have hadinsufficient impact on the approaches used with Clitellata. Someexceptions are Jamieson (1988) and Jamieson et al. (2002), inwhich morphological and molecular data, respectively, wereformally analysed and the results applied to define higher taxawithin earthworms.
Recent work has also attempted to reconsider morphologicalcharacter states in relation to (palaeo)biogeography to helpdefine families and classifications within the earthworms, suchas that of Omodeo (1998, 2000), Sims (1980), Gates (1972), andBlakemore (2000, 2008). Gates (1972) did a considerableservice by criticising the classical system (Michaelsen 1900;Stephenson 1930) for its dependence on reproductive characters,its denigration of somatic characters, and its fallaciousevolutionary reasoning. Sims (1980) proposed definitions ofthe superfamilies Megascolecoidea (Acanthodrilidae,Megascolecidae, Octochaetidae, Ocnerodrilidae, Eudrilidae),Lumbricoidea (Lumbricidae, Hormogastridae, Lutodrilidae,Ailoscolecidae and Sparganophilidae) and Glossoscolecoidea(Glossoscolecidae, Kynotidae Almidae, and Microchaetidae)based largely on ovarian morphology and the budding of the
Journal compilation � CSIRO 2012 www.publish.csiro.au/journals/is
CSIRO PUBLISHING
Invertebrate Systematics, 2012, 26, 213–229http://dx.doi.org/10.1071/IS11012
oocytes (Gates 1976). Two other superfamilies, Criodriloidea andBiwadriloidea, are monogeneric, while the Komarekionidae areplacedbySims(1980) in theAiloscolecidaeandtheTumakidaehadnot yet been discovered.
Omodeo (2000) proposed a Lumbricoidea containingLumbricidae, Hormogastridae, Lutodrilidae, Glossoscolecidae,Kynotidae (as within Microchaetidae), Ailoscolecidae andCriodrilidae (which included Sparganophilidae, Lutodrilidae,Komarekionidae, and maybe Biwadrilidae), Almidae andGlyphidrilidae. He placed the Eudrilidae in its ownsuperfamily Eudriloidea, and his Megascolecoidea consistedof Acanthodrilidae, Megascolecidae, Octochaetidae, andOcnerodrilidae. Omodeo’s (2000) detailed but informalanalysis of character evolution concluded that Crassiclitellataare polyphyletic, stemming from 2 or 3 different non-crassiclitellate ancestors. He derived Eudriloidea fromAlluroididae-like ancestors based on a hypothesised homologyof euprostates present in both groups, and considered theMoniligastridae (terrestrial non-crassiclitellates of earthwormdimensions) as belonging to this lineage. The Lumbricoideaare derived from something resembling modern Haplotaxidae,a more or less classical position, and the Megascolecoidea couldbe derived from the same ancestor as theEudriloidea or a differentbut related ancestor.
An enduring problem within the Megascolecoidea is thatof multiple nephridia (meronephry) in earthworms of thefamilies Acanthodrilidae and/or Octochaetidae (which familyis used depends on the interpretation of the nephridia). TheOctochaetidae (type genus Octochaetus Beddard, 1892 fromNew Zealand) includes only meronephric species withacanthodrilin male terminalia. The acanthodrilin maleterminalia are composed of male pores and separate prostaticpores in the same or adjacent segments, generally in the rangeof segments 17–20. Prostate glands are usually tubular.Classically, the Octochaetidae had only tubular prostates,but Exxus wyensis Gates, 1959 and Neotrigaster rufa(Gates, 1962) introduced genera with racemose prostates, acharacteristic previously associated only with some genera ofMegascolecidae. Blakemore (2000, 2008) proposed the Exxidae,which became the home of octochaetid genera with racemoseprostates.
Lee (1959) made a fairly clear case for multiple independentorigins of acanthodrilin meronephry by pointing out themorphological similarities between members of New Zealandgenus pairs in which one member was meronephric and theother not; the set of pairs included Octochaetus. This argumentdid not get the traction it deserved. Lee’s conclusions havesince gained support from Jamieson et al. (2002) and Dyneand Jamieson (2004), which demonstrated that theOctochaetidae was polyphyletic. Other acanthodrilid generawith multiple nephridia, and therefore classically assigned tothe Octochaetidae, are found in Africa, the north Neotropics andSouth Asia. The Octochaetidae concept has survived in oneform or another to this day, albeit with recognition thatmodifications are probably needed (Blakemore 2005). Onesuch modification is that of Csuzdi (1996), who proposed theBenhamiinae to accommodate the acanthodrilid genera withstalked calciferous glands in some or all of segments 14–17,but including holonephric genera with the same gland type. This
mirrors Lee’s hypothesis thatmeronephry is not phylogeneticallyinformative within the New Zealand acanthodrilids.
The above review of earthworm systematics is provided toassist those unfamiliar with the history of the debates and thediversity of forms to followour results.Wedonot intend this as anexhaustive review, but only as an introduction that can be used asa starting point for further study of the role of morphology inthe classification of earthworms. For purposes of the currentpaper, we would like to evaluate Crassiclitellata phylogenywith molecular data and subsequently reconsider morphologyin light of the molecular phylogenetic results. The present paperis an attempt to build on the earlier molecular phylogenies ofClitellata (particularly that of Jamieson et al. 2002) by expandingthe sequence length and the breadth of taxonomic coveragewithin the Crassiclitellata. The nuclear genes encoding the 28Sand 18S rRNAs, the mitochondrial 12S and 16S rRNAs, and thecytochrome oxidase subunit I (COI) genes have proven usefulfor phylogenetic analyses of the Clitellata (Jamieson et al. 2002;Bely and Wray 2004; Erséus and Källersjö 2004). However, themitochondrial genes are less appropriate to resolution ofdeep branching in the group, so we devoted more effort to the28S and 18S genes. We will use these genes plus a short sectionof the mitochondrial 16S gene to infer relationships among allfamilies of the Crassiclitellata. The 18S gene will be used to inferrelationships among Crassiclitellata and several oligochaetousClitellata (sensu Erséus 2005) outgroups including theMoniligastridae and Enchytraeidae.
Materials and methods
Taxon sampling
Material was collected from several genera each (except themonogeneric families) in all Crassiclitellata families plus theMoniligastridae, following the taxonomies of Jamieson et al.(2002) and Blakemore (2000, 2008). The families and speciesrepresented are shown in Table 1. We collected in the USA,France, Spain, Andorra, Romania, Hungary, Gabon, Kenya,South Africa, Madagascar, Thailand, the Philippines, Brazil,Fiji, the Antilles, Japan, and Australia. Where it was possible,samples were obtained across geographic disjunctionsin families. 18S gene sequences from the oligochaetousClitellata families Tubificidae, Haplotaxidae, Capilloventridae,Phreodrilidae, Enchytraeidae, and Lumbriculidae, plusrepresentatives of the Hirudinida, Acanthobdellida andBranchiobdellida, were retrieved from GenBank.
The taxa sampled and GenBank accession numbers for thesequences are shown in Table 1. All diverse families wererepresented by several species and in most cases by severalgenera, while the monotypic families Ailoscolecidae,Komarekionidae, Lutodrilidae, and Biwadrilidae wererepresented by their only known species. We were unable toobtain material of the monotypic Syngenodrilidae, theAlluroididae, Criodrilidae and the monotypic Tumakidae. Thefirst two are not Crassiclitellata, and the Syngenodrilidae ismorphologically close to the Moniligastridae, which we wereable to obtain. The Kenyan type locality of Syngenodriluslamuensis (Smith & Green, 1917) no longer exists in naturalform, and nearby locations had only Eudrilidae and Dichogasterspp. Ten-year-old tissues of Lutodrilus multivesiculatus
214 Invertebrate Systematics S. W. James and S. K. Davidson
Table 1. Taxon sample and GenBank accession numbersAsterisks indicate taxa belonging to the Octochaetidae of some authorities
Family Individual number, taxon ID Location 18S 28S 16S
Acanthodrilidae 0113 Dichogaster sp. FJ22* Fiji HQ728872 HQ728984 JF267864Acanthodrilidae 0120 Dichogaster sp. Mart2sA18s* Martinique HQ728870Acanthodrilidae 0145 Dichogaster sp.* Dominica HQ728990 JF267865Acanthodrilidae 0147 Dichogaster sp. DomMM18s* Dominica HQ728871Acanthodrilidae 0225 Neotrigaster rufa* Puerto Rico HQ728887 HQ728982 JF267866Acanthodrilidae 0339 Dichogaster saliens* Brazil HQ728874 HQ728988 JF267867Acanthodrilidae 0414 Dipocardia conoyeri USA HQ728888 HQ728983 JF267868Acanthodrilidae 0828 Acanthodrilidae sp. MG Madagascar HQ728890 HQ728986 JF267870Acanthodrilidae 0904 Diplotrema sp. Australia HQ728889 HQ728987 JF267871Acanthodrilidae 1042 Benhamiona sp. Gh* Ghana HQ728991 JF267872Acanthodrilidae 1058 Benhamia sp. Gh* Ghana HQ728880 HQ728992 JF267873Acanthodrilidae 1062 Millsonia sp. Gh* Ghana HQ728881 HQ728993 JF267874Acanthodrilidae 1127 Dichogaster sp. Ke3_5* Kenya HQ728873 HQ728989 JF267875Acanthodrilidae 1212 Dichogaster sp. Ga5_2* Gabon HQ728875 HQ728994 JF267876Ailoscolecidae 0662 Ailoscolex lacteospumosus France HQ728907 HQ728934 JF267908Almidae 0881 Glyphidrilus sp. Thailand HQ728894 HQ728961 JF267919Almidae 1112 Almidae sp. Ke Kenya HQ728895 HQ728997 JF267921Biwadrilidae 0589 Biwadrilus bathybates Japan HQ728920 HQ728949 JF267906Criodrilidae Criodrilus lacuum AY365461 AY048492 GU901783Eudrilidae 1060 Hyperiodrilus sp. Gh Ghana HQ728925 HQ728960 JF267877Eudrilidae 1115 Polytoreutus finni Kenya HQ728926 HQ728958 JF267878Eudrilidae 1117 Eudriloides sp. Ke Kenya HQ728924 HQ728959 JF267879Eudrilidae 1221 Hyperiodrilus africanus Gabon HQ728927 HQ728995Glossoscolecidae 0222 Estherella sp. EY2 Puerto Rico HQ728896 HQ728951 JF267882Glossoscolecidae 0234 Pontoscolex spiralis Puerto Rico HQ728898 HQ728954 JF267883Glossoscolecidae 0315 Andiorrhinus sp. PG Brazil HQ728897 HQ728953 JF267884Glossoscolecidae 0320 Fimoscolex sp. PG Brazil HQ728891 HQ728966 JF267885Glossoscolecidae 0322 Urobenus brasiliensis Brazil HQ728899 HQ728955 JF267886Glossoscolecidae 0327 Goiascolex sp. Brazil HQ728952 JF267887Glossoscolecidae 0329 Rhinodrilus sp. Brazil HQ728956Glossoscolecidae 0330 Glossoscolex paulistus Brazil HQ728892 HQ728967 JF267888Glossoscolecidae 0855 Atatina sp. Brazil HQ728900 HQ728957 JF267890Glossoscolecidae 0862 Glossodrilus sp. Ecuador HQ728893 HQ728968 JF267889Hormogastridae 0598 Hormogaster gallica Spain HQ728912 HQ728932 JF267891Hormogastridae 0622 Vignysa popi France HQ728911 HQ728933 JF267892Hormogastridae 0632 Hemigastrodrilus monicae France HQ728908 HQ728935 JF267893Komarekionidae 0844 Komarekiona eatoni USA HQ728922 HQ728944 JF267913Kynotidae 0821 Kynotus sp. r1 Madagascar HQ728947 JF267909Kynotidae 0823 Kynotus sp. w Madagascar HQ728917 HQ728945 JF267910Kynotidae 0825 Kynotus sp. lgW Madagascar HQ728918 HQ728946 JF267911Kynotidae 0826 Kynotus sp. r2 Madagascar HQ728919 HQ728948 JF267912Lumbricidae 0399 Bimastos zeteki USA HQ728901 HQ728940 JF267922Lumbricidae 0405 Eisenoides_carolinensis USA HQ728903 HQ728939 JF267923Lumbricidae 0592 Zophoscolex zhangi France HQ728906 HQ728937 JF267924Lumbricidae 0717 Lumbricus polyphemus Hungary HQ728904 HQ728938 JF267925Lumbricidae 0781 Allolobophora mehadiensis Romania HQ728905 HQ728936Lumbricidae 0813 Octodrilus complanatus Cyprus HQ728902 HQ728941 JF267926Lumbricidae Lumbricus terrestris AJ272183Lutodrilidae 0957 Lutodrilus multivesiculatus USA HQ728910Megascolecidae 0004 Archipheretima pandanophila Philippines HQ728882 HQ728975 JF267894Megascolecidae 0007 Pheretima sp. 092_1 Philippines HQ728883 HQ728976 JF267927Megascolecidae 0244 Perionyx excavatus USA HQ728977 JF267900Megascolecidae 0389 Arctiostrotus sp. USA HQ728884 HQ728979 JF267895Megascolecidae 0391 Toutellus sp. USA HQ728981 JF267896Megascolecidae 0835 Perionyx sp. MG Madagascar HQ728978 JF267899Megascolecidae 0903 Terriswalkerius sp. Australia HQ728886 HQ728974 JF267897Megascolecidae 0917 Driloleirus sp. USA HQ728885 HQ728980 JF267898Microchaetidae 0500 Tritogenia lunata USA HQ728916 HQ728950 JF267880
(continued next page )
Molecular phylogeny of earthworms Invertebrate Systematics 215
McMahan, 1974 did not yield full 28S sequences, and we couldnot locate new material.
Specimens of each field-distinguishable species werepreserved at the time of collection with fixatives appropriatefor preserving DNA and morphology of the earthworms.Voucher specimens were fixed in neutral buffered 4%formaldehyde – 0.17 M NaCl (PFA: Koshiba et al. 1993)before being transferred to 80% ethanol for transport andlong-term storage at �20�C. Specimens collected for DNA
extraction were preserved in 95% ethanol, 3 volumes pervolume of earthworm, which was changed two or three timesuntil the material was stiff. Vouchers were deposited in theKansas University Natural History Museum and/or repatriatedto institutions of other nations as required by their laws.
DNA extraction, gene amplification and sequencingBodywall tissue samples of earthwormswere extracted by one ofthreemethods: (1) DNAeasy TissueKit (Qiagen) according to the
Table 1. (continued )
Family Individual number, taxon ID Location 18S 28S 16S
Microchaetidae 0506 Proandricus thornvillensis South Africa HQ728915 HQ728996 JF267881Microchaetidae 0508 Parachilota sp. South Africa HQ728985 JF267869Microchaetidae 0511 Microchaetus papillatus South Africa HQ728914 HQ728999Microchaetidae 0516 Geogenia pandoana South Africa HQ728913 HQ729000 JF267901Moniligastridae 0868 Drawida sp. bl Thailand HQ728930 HQ728964 JF267916Moniligastridae 0871 Drawida sp. w Thailand HQ728928 HQ728962 JF267917Moniligastridae 0873 Drawida sp. br Thailand HQ728929 HQ728963 JF267918Ocnerodrilidae 0233 Ocnerodrilidae sp. PR Puerto Rico HQ728876 HQ728969 JF267905Ocnerodrilidae 0240 Gordiodrilus elegans USA HQ728879 HQ728973 JF267902Ocnerodrilidae 0341 Nematogenia sp. Brazil HQ728877 HQ728971 JF267903Ocnerodrilidae 0343 Kerriona sp. Brazil HQ728878 HQ728970 JF267904Ocnerodrilidae 0555 Ocnerodrilidae sp. South Africa HQ728972Sparganophilidae 0411 Sparganophilus sp. GA USA HQ728921 HQ728942 JF267907Sparganophilidae 0846 Sparganophilus sp. G2 USA HQ728943 JF267914Sparganophilidae 0848 Sparganophilus sp. LA USA HQ728923 HQ728998 JF267915
Clitellata outgroup taxaEnchytraeidae 0892 Enchytraeidae sp. USA HQ728931 HQ728965 JF267920Enchytraeidae Grania variochaeta AY365459Enchytraeidae Grania americana AY040686Enchytraeidae Buchholzia fallax AF411895Enchytraeidae Fridericia tuberosa AF209453Enchytraeidae Marionina sublitoralis AY365458Lumbriculidae Stylodrilus heringianus AF411907Lumbriculidae Eclipidrilus frigidus AY040692Lumbriculidae Rhynchelmis tetratheca AY365464Lumbriculidae Lumbriculus variegatus AF209457Haplotaxidae Haplotaxis gordioides AY365456Tubificidae Tubificoides bermudae AF209467Tubificidae Smithsonidrilus hummelincki AF209465Tubificidae Thalassodrilides gurwitschi AF209466Tubificidae Nais communis AF411878Tubificidae Pristina longiseta AF411875Tubificidae Heterodrilus decipiens AF209455Tubificidae Pectinodrilus molestus AF209462Tubificidae Bathydrilus litoreus AF209452Tubificidae Heronidrilus heronae AF209454Tubificidae Bothrioneurum vejdovsky AF411908Phreodrilidae Antarctodrilus proboscidea AY365465Phreodrilidae Insulodrilus bifidus AF411906Propappidae Propappus volki AY365457Capilloventridae Capilloventer australis AY365455Branchiobdellidae Cirrodrilus sapporensis AF310698Acanthobdellidae Acanthobdella peledina AY040680Cambarincolidae Cambarincola pamelae AF310695Branchiobdellidae Branchiobdella parasita AF310690Erpobdellidae Erpobdella japonica AF116000Glossiphoniidae Glossiphonia complanata AF099943Glossiphoniidae Helobdella stagnalis AF115986Haemopidae Haemopis caeca AY040687
216 Invertebrate Systematics S. W. James and S. K. Davidson
manufacturer’s instructions, (2) by sending tissues to theCanadian Centre for DNA Barcoding for extraction andpurification according to their protocols (Ivanova et al. 2006a,2006b), or (3) lysis in 300mL of a solution of 100mM NaCl,100mM Tris-Cl, 25mM EDTA, 0.5% SDS at pH 8 plus 2mLproteinase-K (20mgmL–1), followed by protein precipitationwith 100mL 4M guanidine thiocyanate in 0.1 M Tris-Cl pH 7.5,centrifugation (5min., 13 000 rpm), and precipitation of theDNA from the supernatant with 300 mL cold isopropanol(�20�C), recentrifugation and a wash with 300mL 70%ethanol. The DNA was air-dried at ambient temperature andresuspended in 10mM Tris–Cl pH 8.0.
The nuclear 18S and 28S rRNA genes and a section of themitochondrial 16S gene were amplified with PCR primers (*)(listed inTable 1), using 1mLofDNA template, 2mLof 4mgmL–1
Bovine Serum Albumin Fraction V (Fisher BP1605), 1 mL ofDMSO, 0.58mL of each primer solution (10 p.m. mL–1), 1.4mLultrapure water and 7.29mL Qiagen HotStarTaq master mix with1.17mL CoralLoad dye in a total reaction volume of 15mL. Thethermocycle profile consisted of 4min at 94�C, then 35 cycles of20 s at 94�C, 20 s at 47�C and 105 s at 72�C, followed by 7min offinal extension at 72�C. The 28S gene was copied in twooverlapping sections of 1800–2000 bp using two primer pairslisted in Table 2 using an initial denaturation of 4min at 94�C,then 35 cycles of 30 s at 94�C, 30 s at 60�C and 90 s at 72�C,followed by 10min at 72�C. The ~460-bp 16S gene fragmentused the following profile: initial denaturation of 4min at 95�C,
then 35 cycles of 60 s at 94�C, 60 s at 48�C and 60 s at 72�C,followed by 7min at 72�C.
All primers used in sequencing are given in Table 1. Allsequencing was done at the University of Kansas BiodiversityInstitute Molecular Phylogeny Laboratory on an ABI 3730Applied Biosystems genetic analyser or on the ABI 3130xlmachine. Sequence assembly was done manually from tracefiles viewed in FINCHTV 1.4.0 (Geospiza, Inc.), assembled astext files, strand reads aligned in CLUSTAL 2.0 (Larkin et al.2007) and checked for errors and ambiguities by revisiting thetrace files. The resulting consensus sequences were alignedin CLUSTAL 2.0 with default settings and manually editedin BIOEDIT 7.0 (Hall 1999) to remove length/alignmentambiguous regions and singleton one-base indels (these couldbe the result of base call errors not detected earlier in the process).Stringent editing of length-variable regions was applied tosequences such that unalignable regions were eliminated fromthe data matrix.
Phylogenetic analysesWe used a standard procedure for all analyses, unless otherwisenoted. Substitution models were selected by the AkaikeInformation Criterion (AIC: Akaike 1973) as implemented inJModeltest 0.1 (Posada 2008) with use of PHYML (Guindon andGascuel 2003). The best models all contained invariant site andgamma parameters, and the GTR+ I +G model was chosen for
Table 2. Primers used for PCR (*) and sequencing (all)
Primer Sequence Source
18sA* AAC CTG GTT GAT CCT GCC AGT Medlin et al. (1988)18sL AGT TAA AAA GCT CGT AGT TGG Medlin et al. (1988)18sC CGG TAA TTC CAG CTC CAA TAG Medlin et al. (1988)18sY GTT GGT GGA GCG ATT TGT CTG Medlin et al. (1988)18sB* AGG TGA ACC TGC GGA AGG ATC Medlin et al. (1988)18sO AAG GGC ACC ACC AGG AGT GGA G Medlin et al. (1988)28sC* ACCCGCTGAATTTAAGCAT Jamieson et al. (2002)28sD2 TCCGTGTTTCAAGACGG Jamieson et al. (2002)Po28F1 TAAGCGGAGGAggaAAAGAAAC Struck et al. (2006), modified with gga insert28F5 CAAGTACCGTGAGGGAAAGTTG Passamaneck et al. (2004)Po28F2 CGACCCGTCTTGAAACACGG Struck et al. (2006)28R6 CAACTTTCCCTCACGGTACTTG Passamaneck et al. (2004)Po28R5 CCGTGTTTCAAGACGGGTCG Struck et al. (2006)28F1 GGGACCCGAAAGATGGTGAAC Passamaneck et al. (2004)Po28R4 GTTCACCATCTTTCGGGTCCCAAC Struck et al. (2006)28ee ATCCGCTAAGGAGTGTGTAACAACTCACC Hillis and Dixon (1991)28ff* GGTGAGTTGTTACACACTCCTTAGCGG Hillis and Dixon (1991)Po28R3* GCTGTTCACATGGAACCCTTCTCC Struck et al. (2006)28F4 CGCAGCAGGTCTCCAAGGTGAACA GCCTC Passamaneck et al. (2004)28R2 GAGGCTGTKCACCTTGGAGACCTG CTGCG Passamaneck et al. (2004)28v AAGGTAGCCAAATGCCTCGTCATC Hillis and Dixon (1991)28R3 GATGACGAGGCATTTGGCTACC Passamaneck et al. (2004)Po28R2 CCTTAGGACACCTGCGTTA Struck et al. (2006)28F6 CAGACCGTGAAAGCGTGGCCTATC GATCC Passamaneck et al. (2004)Po28R1 GAACCTGCGGTTCCTCTCG Struck et al. (2006)R3264.2 TTCTGACTTAGAGGCGTTCAG Passamaneck et al. (2004), modified here28MSR* ACTTTCAATAGATCGCAG Mallatt and Sullivan (1998)16sAr* CGCCTGTTTATCAAAAACAT Palumbi (1996)16sBr* CCGGTCTGAACTCAGATCACGT Palumbi (1996)
Molecular phylogeny of earthworms Invertebrate Systematics 217
all genes, given the model options available in MrBayes 3.1(Ronquist and Huelsenbeck 2003). All gene trees andconcatenated analyses were done in MrBayes 3.1 with defaultpriors and three heated, one cold Markov chains, runningeach analysis from two random starting points for 20� 106
generations, sampling trees every 10 000 generations anddiscarding the first 20% as burn-in. The temperature was set to0.10 inorder to improve chainmixing.Eachanalysiswas repeatedand the outputs combined in TRACER 1.5 (Rambaut andDrummond 2009), with which we evaluated sampling of theparameter distributions and convergence of the Bayesian runs.MrBayes jobswere runon theCIPRES server (http://www.phylo.org/portal2/).
18S gene trees were used to check the monophyly of theCrassiclitellata with broad taxon sampling within the Clitellata.A duplicate set of 18S analyses using the less stringentalignment editing was performed. 28S gene sequences wereanalysed separately to confirm consistency of the treetopologies (Crassiclitellata +Moniligastridae only) between the18S and 28S datasets.
The 18S and 28S sequences were concatenated and run inpartitioned Bayesian analyses, as were the three gene sequences(18S, 28S, 16S). In both cases the partitionswere unlinked and theGTR+ I +G model’s parameters were estimated separately bygene. For the three-gene dataset we ran a Maximum Likelihood(ML) 1000 bootstrap resampling analysis inRAxML (Stamatakis2006) as implemented on the CIPRES server, using the GTR+Gsubstitution model and three data partitions. Maximumparsimony analysis of the 18S + 28S + 16S dataset was done inPAUP* (Swofford 2002) using TBR and 500 bootstrapresamplings. We also did several Maximum Parsimony (MP)analyses in TNT (Goloboff et al. 2003, 2008), implementingsectorial search (RSS and XSS options), ratchet, and tree fusing(3 rounds, TBR) in various combinations. The final analysis usedthese three search types and 1000 symmetric resamplings.
In order to test Sims’ (1980) hypotheses of monophyly ofhis Lumbricoidea and Glossoscolecoidea suprafamilial groups,and Omodeo’s (2000) hypotheses of Lumbricoidea andEudrilidae +Moniligastridae, we ran separate Bayesiananalyses of the 18S plus 28S data matrix with topologicalconstraints for monophyly of the respective taxon sets for eachauthor’s concept of higher classification. Thus there was a ‘Simsconstraint’ run and an ‘Omodeo constraint’ run. Except for thetopological constraints, all other settings were the same as in themain analyses, but with only 2� 106 generations each. Finally,an unconstrained analysis of 2� 106 generations was also run.The constrained trees’ statistics and the short unconstrained treestatistics were compared with Bayes factors (Kass and Raftery1995; Nylander et al. 2004).
Results
Phylogenies
The18Sand28SgenesofClitellata areGC-rich, as expected fromother animal taxa. Length-variable regions were not numerous orcomplex, and alignments of the 18S (1748 bp) and 28S (3170 bp)gene sequences were straightforward. The 16S fragment hadproportionately more length-variable regions and substitutions,leading to reduction during editing to 454 total nucleotides.
All MrBayes runs converged well and, with sufficientgeneration numbers, produced nearly normally distributedparameter estimates via TRACER (Rambaut and Drummond2009). The ML and MP analyses are summarised inconjunction with the three gene dataset results below. Theseparate 18S and 28S gene analyses (Figs 1 and 2respectively) returned similar topologies, differing in only oneor two placements. The 18S gene tree (Fig. 1) indicates that theCrassiclitellata (clade posterior probability PP = 0.80) is sister tothe Moniligastridae (PP = 1.0), and that these two groups form aclade (PP = 1.0) (the Metagynophora of Jamieson 1988) nestedwithin the other Clitellata. Haplotaxis gordioides (Hartmann,1821) is the sister to this clade, butwith no support (PP = 0.53), soit is better to consider the basal relationships within Clitellataas unresolved.
In a compromise dictated by our having full data for anenchytraeid, but not Haplotaxis, all other trees were rootedwith the Enchytraeidae. In the following summary of results,all node labels refer to the same bipartitions across the trees.
The 28S gene tree (Fig. 2) has a modestly well supportedCrassiclitellata (node A, PP = 0.94). In the 18S + 28S combinedanalysis (Fig. 3) the main body of Crassiclitellata,Moniligastridae, and the Sparganophilidae +Komarekionidae +Biwadrilidae +Kynotidae clade formed a basal tritomy, but allinternal nodal posterior probabilitieswere high (>0.95)with a fewexceptions. Nodal support was slightly higherwith 18S alone and28S alone. Weak nodes within the Crassiclitellata, regardless ofthe inclusion of the 16S gene (included in Fig. 4), were the same.Node B, connecting Sparganophilidae +Komarekionidae toBiwadrilidae +Kynotidae, has no support (PP< 0.80) in allcombined analyses but has weak support in the 28S gene tree(PP = 0.88). The sister group relationship of Sparganophilidaeand Komarekionidae is strong (node K, PP = 1.0) in all analyses.The sister-group relationship of Biwadrilidae and Kynotidae isstrongly supported in the 28S gene tree (Fig. 2; PP = 1.0) but isunsupported in the combined analyses and the 18S gene tree.The Hormogastridae + Lumbricidae clade (Node D) has strongsupport in the 28S gene tree and the 18S + 28S combined analysis(Figs 2 and 3 Node D; PP = 1.0) in whichHemigastrodrilus is thesister taxon to the Lumbricidae (Figs 2 and 3; PP> 0.98). In thesetwo trees the Hormogastridae is paraphyletic, but in Fig. 4 theplacement of Hemigastrodrilus is unresolved. The only othernode with PP < 0.9 in all analyses is node G connecting theAlmidae as sister taxon to all higher-branching clades.
Except for the basally placed branches leading to theSparganophilidae +Komarekionidae +Biwadrilidae +Kynotidaegroup and the Lumbricidae +Hormogastridae +Criodrilidae,most other nodes (E to J) lead to a single-family lineage splitfrom the main lineage, with uppermost diverging familiesMegascolecidae, Acanthodrilidae and ‘Octochaetidae’ (markedwith asterisks) and Benhamiinae grouping as closely related. TheAcanthodrilidae is paraphyletic by the nesting ofMegascolecidaewithin an Acanthodrilidae (s.l.) clade. The 28S gene tree (Fig. 2)had a monophyletic Megascolecidae (Node M, PP = 1.0) anda paraphyletic Acanthodrilidae composed of a polytomy.Within the acanthodriline worms a more resolved topologywas obtained from the combined analyses (Fig. 3, 18S + 28S;Fig. 4, 18S + 28S + 16S), consisting of the Benhamiinae (Node L,PP = 0.87 or PP = 1.0 respectively in Figs 3 and 4), a NewWorld
218 Invertebrate Systematics S. W. James and S. K. Davidson
acanthodriline clade (PP = 1.0; Diplocardia, Neotrigaster)and a Southern Hemisphere acanthodriline clade (PP = 1.0;Diplotrema, Acanthodrilidae sp. from Madagascar).
The ML analysis of the full dataset in RAxML returned atopology virtually identical to that of the Bayesian analysis
(Fig. 4), with one exception, that Biwadrilus was placed as thesister to the clade (Kynotus (Komarekiona (Sparganophilus)))rather than as sister to Kynotus. However, in both ML andBayesian analyses the nodes involved (node B andneighbouring node) are unresolved. In all other nodes on theML tree support values are comparable to or lower than thoseof the Bayesian analysis, and are included on Fig. 4.
MP analyses in PAUP* and TNT returned a topology stronglysupportive of the Crassiclitellata (Fig. 5; 99.8% and 100%,PAUP* and TNT respectively) and of the family-level groupsindicated in Fig. 4, but with poor resolution of the basalrelationships among families or sets of families. The PAUP*tree was 6906 steps long, compared to the 6834 steps from TNTbut the topologies were the same, allowing for consensus treecollapse of nodes of<50%support. TheAlmidae isweaklyplacedas sister to the Pontoscolecidae rather than in an intermediateposition between the latter family and the Glossoscolecidae,while the Glossoscolecidae is sister (~80%) to the cladeindicated at Node I of Fig. 4. The Criodrilus–Hormogastridae–Lumbricidae clade (99%) is supported but internal relationshipsare not, with even the Lumbricidae at a feeble 70% or 49%support. Although the Megascolecidae has strong support,relationships among the Acanthodrilidae and Megascolecidaerepresented here are unresolved, the two sets of Acanhthodrilidaeare moderately supported (70–86%) and the combined clade ofthese two families plus the Benhamiinae is 84% or 94%. TheMP analyses agree with the ML analysis on the placement ofBiwadrilus, with similar support levels.
Tests of phylogenetic hypotheses using constrainedtopologies
BayesFactor (BF) calculations (Kass andRaftery 1995;Nylanderet al. 2004) indicate very strong support (BF > 150: Kass andRaftery 1995) for the null hypothesis given by the unconstrainedtrees (Table 3) compared with the trees given by the analysesconstrained for the classifications of Sims (1980) and Omodeo(2000). Omodeo’s superfamily Lumbricoidea includesGlossoscolecidae among others in the Sims Glossoscolecoidea,as well as his expanded Criodrilidae (Omodeo 2000). The otherconstraint in the Omodeo trees was to enforce monophyly of theEudrilidae +Moniligastridae, in keeping with his hypothesis(Omodeo 2000) that the Crassiclitellata is polyphyletic at leastby the independent origin of theEudrilidae fromMoniligastridae-like ancestors.With a BF of 68.52, Omodeo’s concept is stronglyrejected in favour of that of Sims, but both are inferior to theunconstrained tree.
Discussion
Clitellata relationships
The resolution of the Crassiclitellata based on our expanded setof gene characters also contributed a little to understanding ofthe broader Clitellata relationships. The 18S rRNA genetree offers strong support for the Moniligastridae as the sistertaxon to the Crassiclitellata, and thus for the monophyly ofthe Metagynophora of Jamieson (1988). Erséus and Källersjö(2004) and Siddall et al. (2001) had essentially the same result,monophyly of Metagynophora, without any moniligastrids intheir datasets. Erséus and Källersjö (2004) and Siddall et al.
1.0
1.0
1.0
1.0
0.74 0.570.61
0.531.0
1.0
0.80
1.0
1.0
1.0
1.0
1.0
1.0
0.90
0.67
0.80
1.0
0.64
0.83
0.86
1.0
1.0
0.99
1.0
Branchiobdellida
Hirudinida
LumbriculidaeAcanthobdellida
Enchytraeidae
Proppapus volkiPhreodrilidae
Tubificidae
Eudrilidae
Benhamiinae
Ocnerodrilidae
Acanthodrilidae
Megascolecidae
Glossoscolecidae
Almidae
"Glossoscolecidae"
LutodrilidaeCriodrilidaeLumbricidaeHormogastridaeAiloscolecidae
Microchaetidae
KynotidaeKomarekionidaeSparganophilidae
Biwadrilus bathybatesMoniligastridae
Capilloventer australisHaplotaxis gordioides
0.03
Fig. 1. 18S gene tree Bayesian phylogram showing relationships amongearthworm families. Branch lengths are drawn proportional to the expectednumber of substitutions per site and measured with the scale bar. Numbersabove nodes are posterior probabilities.
Molecular phylogeny of earthworms Invertebrate Systematics 219
1.01.0
1.01.0
1.0
1.0
1.0
1.00.95
1.0
0.88
1.0
1.01.0
1.00.64
0.551.0
0.64
0.94
0.92
0.93
0.74
1.0
1.01.0
1.0
1.0
1.0
1.0
1.0
1.0
0.98
0.95
0.85
0.91
0.99
0.94
1.01.0 0.72
1.0
1.0
1.0
0.90
0.95
0.59
1.0
0.1
1.0
0.960.78
1.0
1.0
0.99
0.52
0.89
72.0
0.75
0.99
1.0
0.970.95
A
B
C
D
E
F
H
G
I
J
Drawida sp. w
Drawida sp. brDrawida sp. bl
Sparganophilus sp. G1
Sparganophilus sp. LSparganophilus sp. G2
Komarekiona eatoniKynotus sp. w1
Kynotus sp. w2Kynotus sp. r2
Kynotus sp. r1
Biwadrilus bathybatesTritogenia lunata
Proandricus thornvillensisMicrochaetus papillatusGeogenia pandoana
Estherella sp.Goiascolex sp.Andiorrhinus sp.Urobenus brasiliensis
Rhinodrilus sp.Pontoscolex spiralisAtatina sp.
"Glossoscolecidae"
Glossoscolecidae
KK
K
Polytoreutus finniHyperiodrilus africanus
Eudriloides sp.Hyperiodrilus sp.Ocnerodrilidae sp.
Ocnerodrilidae sp.
Kerriona sp.Nematogenia sp.
Gordiodrilus elegansTerriswalkerius sp.
Archipheretima pandoanaPheretima sp.
Perionyx excavatusPerionyx sp. MG
Arctiostrotus sp.Driloleirus sp.Toutellus sp.
Neotrigaster rufa*Diplocardia conoyeriDichogaster sp. Fiji*
Dichogaster sp. Dom*Dichogaster saliens*Dichogaster sp. Kenya*
Dichogaster sp. Gabon*Benhamia sp.*
Millsonia sp.*Parachilota sp.
Diplotrema sp.Acanthodrilidae sp. MG
Benhamiona sp.*Fimoscolex sp.Glossoscolex paulistusGlossodrilus sp.
Glyphidrilus sp.Alma sp.
Enchytraeidae sp.
0.04
Hemigastrodrilus monicaeAllolobophora mehadiensis
Lumbricus polyphemusEisenoides carolinensisBimastos zeteki
Octodrilus complanatusZophoscolex zhangi
Hormogaster gallicaVignysa popi
Ailoscolex lacteospumosus
Benhamiinae
Benhamiinae
M
L
Fig. 2. 28S gene tree Bayesian phylogram showing relationships among earthworm families. Branch lengths are drawnproportional to the expected number of substitutions per site and measured with the scale bar. Numbers above nodes are posteriorprobabilities.Node labels are consistent acrossFigs2–4.Taxamarkedwith anasterisk (*) are theOctochaetidaeof someauthorities.
220 Invertebrate Systematics S. W. James and S. K. Davidson
Diplotrema sp. AUSDichogaster sp. Fiji*Dichogaster saliens*Dichogaster sp. Kenya*
Dichogaster sp. Gabon*Benhamia sp. Ghana*
Millsonia sp. Ghana*
Acanthodrilidae sp. MGDiplocardia conoyeri
Neotrigaster rufa*
Hemigastrodrilus monicae
Allolobophora mehadiensisLumbricus polyphemus
Eisenoides carolinensisBimastos zeteki
Octodrilus complanatusZophoscolex zhangi
Hormogaster gallica
Ailoscolex lacteospumosus
1.0
1.0
1.0
1.0
1.01.0
1.0
1.0
1.0
1.0
1.0
1.01.0
1.0
1.0
0.6
0.81
0.95
0.91
0.98
0.67
1.00.99
0.86
1.0
1.0
0.981.0
1.01.00.89
1.0
1.01.0
1.0
1.0
0.79
1.0
0.99
1.0
1.0
0.70
0.88
0.87
0.88
1.01.0
1.0
1.0
0.03
1.0
1.01.0
0.98
39.0
Vignysa popi
Terriswalkerius sp.Archipheretima pandanophilaPheretima sp.Arctiostrotus sp.
Driloleirus sp.
Ocnerodrilidae sp.Kerriona sp.
Nematogenia sp.Gordiodrilus elegans
Polytoreutus finniEudriloides sp.
Hyperiodrilus sp.Hyperiodrilus africanus
Fimoscolex sp.Glossoscolex paulistus
Glossodrilus sp.
Alma sp.Glyphidrilus sp.
Atatina sp.Urobenus brasiliensisPontoscolex spiralis
Andiorrhinus sp.Estherella sp.
Geogenia pandoanaMicrochaetus papillata
Proandricus thornvillensisTritogenia lunata
Drawida sp. blDrawida sp. br
Drawida sp. w
Sparganophilus sp. GSparganophilus sp. LKomarekiona eatoni
Kynotus sp. w
Kynotus sp. wlKynotus sp. r
Biwadrilus bathybates
B
K
C
D
E
F
G
H
I
J
L
M
Enchytraeidae sp.
Fig. 3. 18s + 28S partitioned analysis Bayesian phylogram showing relationships among earthworm families.Branch lengths aredrawnproportional to the expectednumberof substitutionsper site andmeasuredwith the scalebar. Numbers above nodes are posterior probabilities. Taxa marked with an asterisk (*) are the Octochaetidae ofsome authorities.
Molecular phylogeny of earthworms Invertebrate Systematics 221
(2001) found the Enchytraeidae to be the sister to Crassiclitellata,based on 18S rRNA andmt COI genes. However, these analysesdid not include the Moniligastridae, nor did they have broad
sampling within earthworms. In our trees including additionalClitellata we see that Enchytraeidae are nested within a clade thatjoins a basal polytomy in the Clitellata. However, this is not a
Hemigastrodrilus monicae
Allolobophora mehadiensis
Lumbricus polyphemusEisenoides carolinensis
Octodrilus complanatus
Zophoscolex zhangi
Hormogaster gallica
Criodrilus lacuum
LUMBRICIDAE
Sparganophilus sp. GSparganophilus sp. L
Komarekiona eatoni
Kynotus sp. w
Kynotus sp. wlKynotus sp. r
Biwadrilus bathybates
SPARGANOPHILIDAE
KYNOTIDAE
KOMAREKIONIDAECRIODRILIDAE
BIWADRILIDAE
MONILIGASTRIDAE
Drawida sp. blDrawida sp. br
Drawida sp. w
HORMOGASTRIDAE
Geogenia pandoanaMicrochaetus papillatusProandricus thornvillensis
Tritogenia lunata
MICROCHAETIDAE
Dichogaster sp. Kenya*BENHAMIINAE*
Acanthodrilidae sp. MG
Neotrigaster rufa*
Terriswalkerius sp.Archipheretima pandanophila
Pheretima sp.Arctiostrotus sp.
Driloleirus sp.
MEGASCOLECIDAE
Ocnerodrilidae sp.Kerriona sp.
Nematogenia sp.Gordiodrilus elegans
OCNERODRILIDAE
Polytoreutus finni
Hyperiodrilus africanusEUDRILIDAE
Glossoscolex paulistusGlossodrilus sp.
GLOSSOSCOLECIDAE
Glyphidrilus sp.
Urobenus brasiliensis
Pontoscolex spiralis
PONTOSCOLECIDAE
ALMIDAE
Enchytraeidae sp.
B
K
A
D
C
L
MJ
I
H
G
F
E
1.0/59
1.0/97
1.0/70
1.0/ 85
1.0/60
1.0/69
1 .098
1.0/94
1.0100 1.0
1001
1.0100
1.0100
1.0100
1.0100
1.0100
1.0100
1.0/ 84
1.0/92
1.0/ 86
1.0/89
1.0/901.0/94
1.0/97
0.92/58
0.84/52
0.63/42
0.99/92
0.93/ 60
0.57/56
0.98/760.90/65
0.66/ 65
0.58/na
0.64/na
0.52/16
Andiorrhinus sp.
ACANTHODRILIDAE
ACANTHODRILIDAE
0.90/46
Atatina sp.
Estherella sp.
Alma sp.
Fimoscolex sp.Hyperiodrilus sp.
Eudriloides sp.
Diplocardia conoyeri
Diplotrema sp. AUSDichogaster sp. Gabon*
Dichogaster sp. Fiji*Dichogaster saliens*
Millsonia sp. Ghana*Benhamia sp. Ghana*
Ailoscolex lacteospumosusVignysa popi
Bimastos zeteki
1.0100
1 .0100
1.0/86
1.0100
1.0100
1.0100
1.0100
0.99/77
1.0100
1.0100
1.01001.0
1000.97/68
0.90/54
1.0100
1.0/100
1.0100
1.099
0.07
Fig. 4. 18S+ 28S+ 16SpartitionedanalysisBayesianphylogramshowing relationships amongearthworm families.Branch lengths aredrawn proportional to the expected number of substitutions per site andmeasured with the scale bar. Numbers above nodes are posteriorprobabilities/bootstrap support from RAxML analysis. Taxa marked with an asterisk (*) are the Octochaetidae of some authorities.
222 Invertebrate Systematics S. W. James and S. K. Davidson
definitive placement of the Enchytraeidae, and the relationshipswithin Clitellata are quite unresolved. This analysis also providesno support for the classical hypothesis that the Crassiclitellata arederived from theHaplotaxidae. The ordinal taxonHaplotaxida, aspresently understood, could be polyphyletic and should beprovisionally abandoned in favour of the Metagynophora,which is supported.
Relationships within the Crassiclitellata
The superfamilies
The phylogenetic hypotheses presented here (Figs 2–5)support some long-held relationships within earthworms, andreject others, while providing support for one new family-leveltaxon discussed below. Omodeo’s (2000) hypothesis, based on
Enchytraeidae sp.Drawida sp. wDrawida sp. br
Drawida sp. blGlyphidrilus sp.Alma sp.
Estherella sp.Andiorrhinus sp.
Urobenus brasiliensisPontoscolex spiralis
Atatina sp.Hormogaster gallicaVignysa popiHemigastrodrilus monicaeAiloscolex lacteospumosus
Allolobophora mehadiensisZophoscolex zhangi
Lumbricus polyphemusEisenoides carolinensis
Bimastos zetekiOctodrilus complanatus
Criodrilus lacuumSparganophilus sp. GSparganophilus sp. L
Komarekiona eatoniKynotus sp. wKynotus sp. r
Kynotus sp. wlBiwadrilus bathybates
Proandricus thornvillensisMicrochaetus papillatus
Geogenia pandoanaTritogenia lunata
Eudriloides sp.
Hyperiodrilus africanusPolytoreutus finniHyperiodrilus sp.
Ocnerodrilidae sp.Nematogenia sp.Kerriona sp.
Gordiodrilus elegansArchipheretima pandanophilaPheretima sp.
Terriswalkerius sp.Arctiostrotus sp.Driloleirus sp.
Neotrigaster rufaDiplocardia conoyeri
Acanthodrilidae sp. MGDiplotrema sp. AUS
Dichogaster sp. FijiDichogaster sp. Gabon
Dichogaster sp. KenyaDichogaster saliens
Benhamia sp. GhanaMillsonia sp. Ghana
Fimoscolex sp.Glossoscolex paulistus
Glossodrilus sp.
100100
9697
100100
6452
7149
99100
9494
8277
9999
9999
8787
5449
8367
9898
51 5100
100
7770
7980
8271
5033
8072
100100100
100
100100
100100
100100
100100
100100
100100
100100
100100 62
54
8888
9798
7349 62
44
9497
7679
10010098
98
6876
5232
9697
8393
8594
8783
99100
7168
6254
Fig. 5. 18S+ 28S+ 16S maximum parsimony analysis in PAUP* and TNT. Branch lengths are not to scale. Nodal support values are bootstrappercentages (PAUP*) above the branches and symmetric resampling percentages (TNT) below the branches.
Molecular phylogeny of earthworms Invertebrate Systematics 223
morphological features, that Crassiclitellata are polyphyleticand originated from three non-crassiclitellate ancestors, is notsupported, but neither is it firmly rejected given that support forthe Crassiclitellata node is PP = 0.80 in Bayesian analysis, butnear 100% in MP. Nevertheless it would be hard to reconcileOmodeo’s hypothesis with the strongly supported internal nodesof the Crassiclitellata. There are only a few cases for ranks abovefamily level. Sims’ Megascolecoidea is a monophyletic group,and includes Eudrilidae, Ocnerodrilidae, Megascolecidae,Acanthodrilidae and Octochaetidae. Two of the polyfamilialsuperfamilies defined by Sims (1980) were rejected by BayesFactor comparisons with an unconstrained tree. Unsupportedsuperfamilies included the Glossoscolecoidea, which groupedAlmidae, Glossoscolecidae, Kynotidae and Microchaetidaeby ovarian morphology. Instead, the Kynotidae appearbasally (Bayes) or unresolved (ML, MP) in a group withthe Komarekionidae, Sparganophilidae and Biwadrilidae. TheMicrochaetidae is closest to the Lumbricidae/Hormogastridaeclade and does not appear within the Glossoscolecoidearegardless of ovarian morphology. If mapped onto the treesgiven in Fig. 3 or 4, the defining state of the ovarianmorphology must have been lost three times, or evolvedindependently twice and lost once. The two scenarios areequally parsimonious. Sims’ Lumbricoidea included theSparganophilidae and Komarekionidae, which byunconstrained analyses are not in a clade with the Lumbricidaeand his other Lumbricoidea. A revised Lumbricoidea shouldinclude the Lumbricidae, Hormogastridae, Ailoscolecidae,Criodrilidae and Lutodrilidae. The superfamily Criodriloideais nested within the revised Lumbricoidea, and theBiwadriloidea has an unresolved position close to Kynotidae,Sparganophilidae andKomarekionidae. Therefore these twoverysmall superfamilies should be disregarded.
Small basal crassiclitellate families
The Sparganophilidae, Komarekionidae, Biwadrilidae andKynotidae (Node B) form a group of relict families thatappears as sister to all other earthworms, although the sisterrelationship is without strong support in any analyses exceptthe 18s gene tree (Fig. 1, PP = 0.92). The node is absent in theMLand MP analyses because Biwadrilidae is placed as sister to theremaining three. If this holds up in future analyses, it refutesseveral previous placements of these families. A notable example
is the placement of themonotypic Japanese Biwadrilidae as sistertaxon of Kynotidae (a Madagascar endemic), which previouslywas hypothesised to be allied to Microchaetidae andGlossoscolecidae. Kynotidae is excluded from a closerelationship with Microchaetidae by the strong support(PP = 1.0) for Nodes C and E, but its placement in relation tothe Biwadrilidae is unresolved, as is the placement with regard tothe clade composed of Sparganophilidae and Komarekionidae(Node K, PP = 1.0). Biwadrilidae and Kynotidae wereconsidered close in the morphological analysis of Jamieson(1988). Given the large geographic disjunction between Japanand Madagascar, Biwadrilidae and Kynotidae could be relictsof taxa longvanished fromother land areas.Consistently, butwithno support, they are close to the families Sparganophilidae andKomarekionidae. Biwadrilus was moved from the Criodrilidaeto its own family Biwadrilidae by Jamieson (1971), and laterreturned to the Criodrilidae by Blakemore (2006). Accordingto our molecular data analyses, the Criodrilidae is sister to theLumbricidae +Hormogastridae clade. Therefore we removeBiwadrilidae from the synonymy of Criodrilidae.
The placement of the Sparganophilidae as the sister taxonof Komarekionidae is strongly supported by our data and byJamieson et al. (2002). Sparganophilidae are mud-dwellingworms of fresh water margins and lake bottoms, whileKomarekiona eatoni Gates, 1974 lives in mesic forest soils ofthe central Appalachian Mountains. Sparganophilidae hasvariously been placed in an expanded concept of theGlossoscolecidae (e.g. Jamieson 1971) or within a superfamilyLumbricoidea (Sims 1980; Qiu and Bouché 1998; Omodeo2000). However, these placements are not supported by themolecular data, and neither is the hypothesised synonymy ofKomarekionidae and Ailoscolecidae by Sims (1980) and Qiuand Bouché (1998). Instead, Komarekionidae is quitephylogenetically distant from Ailoscolecidae (their commonancestor is the common ancestor of the Crassiclitellata clade),the latter nested within the Hormogastridae with strong support(Node D; PP = 1.0).
Certain morphological similarities of Komarekiona eatoni toAiloscolex lacteospumosus Bouché, 1969, have contributed toambiguity in estimating the relatedness of these two families.K. eatoni differs in the location of its single esophageal gizzardas compared to the two of Ailoscolex, but is similar in havingmany small prostatoid glands (possibly non-homologous to theAiloscolex glands) associated with the ventral setae in thereproductive segments. Many other earthworms have glandsassociated with setae used in copulation, so this could beparallel evolution and not a uniting character. The two speciesare completely unlike one another in general aspect and ecology.K. eatoni is an unpigmented earthworm of unremarkableappearance and lives as an epiendogeic in forest soils, whileA. lacteospumosus is very delicate, short and thick, and appearsto inhabit deeper soil layers exclusively.
A revised Lumbricoidea
As mentioned above, a new concept of Lumbricoideashould include Ailoscolecidae, Lumbricidae, Hormogastridae,Criodrilidae and, tentatively, Lutodrilidae. The inclusion ofAiloscolecidae within the Lumbricidae–Hormogastridae–
Table 3. Bayes factor comparisons of 18S + 28S trees constrained forsuprafamilial concepts of Sims (1980) or the suprafamilial concepts and
Crassiclitellata polyphyly of Omodeo (2000)Each cell value was calculated by subtracting the total harmonic meanlikelihood score of the row constraint analysis (null hypothesis) from a
column constraint analysis. Only positive values are shown
Alternate hypothesisNull hypothesis Sims
constraintsOmodeoconstraints
Unconstrained
Sims constraints 0 68.52 –
Omodeo constraints – 0 –
Unconstrained 165.55 234.14 0
224 Invertebrate Systematics S. W. James and S. K. Davidson
Criodrilidae (Node D), instead of being allied withKomarekionidae, is strongly supported by the molecular data.There is morphological support for this placement as well, theAiloscolecidae and Hormogastridae differing mainly in thepresence of prostatoid glands in the former, and of arudimentary intestinal gizzard in the latter (Sims 1980;Omodeo 2000). Hormogastridae and Lumbricidae are usuallyconsidered closely related and both are European (except for twoNorthAmerican lumbricid genera,Eisenoides andBimastos, bothin the taxon sample). The hormogastrid genus Hemigastrodrilusis placed as sister to the Lumbricidae, with weak nodal support,but consistently across many analyses. This placement wouldrender the Hormogastridae paraphyletic, and so would theretention of family status for the Ailoscolecidae. On the basisof our results, we advocate placing Ailoscolecidae in thesynonymy of Hormogastridae.
Stephenson (1930) suggested a relationship between theLumbricidae and Criodrilidae, which is consistent with themolecular data analysis placing Criodrilidae as sister tothe Hormogastridae +Lumbricidae (Figs 3 and 4), but conflictswith placement of Criodrilus in Almidae (Jamieson 1988). Qiuand Bouché (1998) considered Criodrilus lacuum Hoffmeister,1845 a hormogastrid secondarily adapted to aquatic life. Thetopology does not support the implied evolutionary historybecause Criodrilus is placed basal to the Hormogastridae.With only partial sequence data for C. lacuum, the grouping ofC. lacuumwith the Lumbricidae andHormogastridae is tentative,but strongly supported and unlikely to change with additionalsequence data.
The South African Microchaetidae is most closely related tothe Lumbricoidea as defined here and sister to all higher-placedfamilies. Within the Microchaetidae, Tritogenia is basal to theother sampled genera, and is morphologically distinct from otherMicrochaetidae by having multiple nephridia per segment(meronephric) and having an unusually short, thick body form.
A revised Megascolecoidea
The superfamily Megascolecoidea (sensu Sims 1980),containing the Megascolecidae, Octochaetidae, Acanthodrilidae,Eudrilidae and Ocnerodrilidae, is a monophyletic group (nodalsupport >0.9 except in MP analyses) but with internalrelationships that demand further consideration. The onlycharacter known to be constant across the Megascolecoidea isthe shape of the ovaries (Sims 1980). This could be asynapomorphy uniting the families in Sims’ concept of thesuperfamily but we prefer to examine the morphologicaland genetic data independent of any superfamily concept.Stephenson (1930) considered the Eudrilidae to have beenderived from megascolecoid ancestors, but severalmorphological features and the phylogenies strongly suggestthat the reverse is true (Figs 2–4). The findings indicate thatancestors of the Eudrilidae diverged before the emergence ofthe Megascolecidae +Acanthodrilidae +Ocnerodrilidae clade,undermining the doubtful homology of certain eudrilidfeatures to those of the Megascolecoidea. The eudrilideuprostates, for example, are implied as homologous to theprostates of other megascolecoid families, but have a distinctstructure from the other prostate glands found in the rest of
the Megascolecoidea. In contrast to the megascolecid andacanthodrilid glandular prostates connected to the exterior by aduct, the eudrilid euprostates have large muscular ejaculatorybulbs with resemblance to the copulatory sacs or pouches inGlossoscolex of Glossoscolecidae. These ejaculatory structuresof Eudrilidae and Glossoscolecidae both have the male ductsjoining the muscular bulb. Their similarities indicate a closerelationship between the Glossoscolecidae and the Eudrilidae,as noted by Benham (1895). The more likely hypothesis isthat the prostate glands of Acanthodrilidae, Octochaetidae,Megascolecidae and Ocnerodrilidae are an innovation arisingon the way to Node J.
In addition to the euprostates, paired dorsal calcium carbonateglands are found in one of segments 12 or 13 in both Eudrilidaeand Glossoscolecidae. In both families the glands havecomplex internal tubules. Furthermore, there are structures inGlossoscolex and Fimoscolex that have possible homologues ofthe complex ovarian and spermathecal systems of Eudrilidae,including modified septa surrounding segment 13, with pouchescontaining spermatozoa-like material (Bartz et al. in press),and flat subneural sacs on the body wall in segments 13–14of a Fimoscolex sp. These morphological data complementthe molecular data, suggesting a close relationship of theGlossoscolecidae to the Eudrilidae.
As would be expected from the phylogenies, theOcnerodrilidae shares morphological characters with theEudrilidae, but also with the megascolecid–acanthodrilidgroup. The Eudrilidae (Paraeudrilinae) lacks the paired dorsalesophageal glands in the area of segments 12 and 13, as doesthe Ocnerodrilidae, a possible indication of affinity. Both theEudrilidae and Ocnerodrilidae have suboesophageal sacs insome or all of segments 9–11, of very similar form. These arepaired in most, but not all, Ocnerodrilidae, and unpaired in theEudrilidae. Beddard (1895) thought there might be a closerelationship between these two taxa. However, Eudriloides,the one paraeudriline genus in the taxon sample, is no closerto the Ocnerodrilidae than the other Eudrilidae included. It ispossible that the Paraeudrilinae is polyphyletic, and by chancewe obtained a genus that is more distant to the Ocnerodrilidae.Additional sampling is needed to test the hypothesis thatthe Ocnerodrilidae is sister taxon to at least some of theParaeudrilinae. The Ocnerodrilidae and Eudrilidae are likely tohave diverged long ago. The Ocnerodrilidae occur naturally inSouth America, Africa and India, suggesting that the familydiverged from the common ancestor with Eudrilidae wellbefore the break-up of Gondwana.
As was the case in Stephenson’s (1930) derivation of theEudrilidae from megascolecoids, Michaelsen’s (1935)hypothesis that the Eudrilidae is derived from Ocnerodrilidaeis rejected by the placement of Eudrilidae basal to theOcnerodrilidae–Megascolecidae–Acanthodrilidae clade, aplacement in agreement with recent and traditional phylogenies.
Amore limitedMegascolecoidea consisting ofOcnerodrilidae,Octochaetidae, Acanthodrilidae and Megascolecidae wasproposed by Omodeo (2000). Here we support Omodeo’slimited concept of Megascolecoidea, but with the elimination ofthe Octochaetidae. Besides the ovarian morphology cited by Sims(1980), an apparent synapomorphy of this superfamily is thepresence of prostate glands associated with the male pores, and
Molecular phylogeny of earthworms Invertebrate Systematics 225
together present a variety of male genital fields characterised asacanthodrilin (plus the reduced versions microscolecin andbalantin) or megascolecin. The Ocnerodrilidae is separated fromthe other three families by the latter having a pair of hearts insegment 12 (and often 13), the relocation of the segment ofintestinal origin to 15 or later, and the loss of the ocnerodrilincalciferous glands.
The problematic Acanthodrilidae, Megascolecidaeand Octochaetidae
The remaining three megascolecoid families have beenproblematic in the history of earthworm systematics. Fromhere on, let it be clear that we advocate an Acanthodrilidaesensu latu that corresponds to the Acanthodrilinae sensuJamieson (2000, 2001) and Jamieson and Ferraguti(2006). This concept of Acanthodrilidae combines theAcanthodrilidae, Octochaetidae and Exxidae Blakemore, 2000.In the taxon sample, Octochaetidae is indicated by asterisks (*) inTable 1 and the figures. The Exxidae is a subset of these, hererepresented by Neotrigaster rufa. Both the Octochaetidae andExxidae will be lumped into the Acanthodrilidae in the followingdiscussion.
The Megascolecidae is either sister to the Acanthodrilidae(Jamieson et al. 2002; Buckley et al. 2011) or nested within theAcanthodrilidae (Figs 2–5). Within the megascolecid andacanthodrilid genera, Figs 3 and 4 show four well supportedclades, one composed of meronephric Benhamiinae (sensuCsuzdi 1996), one composed of the Megascolecidae (sensuBlakemore 2000) or Megascolecinae sensu Jamieson andFerraguti (2006), and two others being variously composed ofother Acanthodrilidae and either Octochaetidae or Exxidae. Eventhoughwe did not havematerial from the diverse ‘Octochaetidae’of the Indian subcontinent, it is clear that the Octochaetidae,as usually defined, is polyphyletic, and the family was rejectedby Dyne and Jamieson (2004). Within the taxon set of thispaper, Octochaetidae is represented by the Benhamiinae(Node L, PP�0.87) and Neotrigaster rufa (unless one placesit in the Exxidae), which falls in a sparsely sampled NewWorld clade (PP = 1.0) with Diplocardia conoyeri Murchie,1961 (Acanthodrilidae s.l.). Buckley et al. (2011) has apolyphyletic Octochaetus, the type genus of the (meronephric)Octochaetidae, placed within a clade of holonephric NewZealand Acanthodrilidae. Therefore, if the Octochaetidae is tobe retained, it could be restricted to a part of Octochaetus.Neotrigaster has been transferred by Blakemore (2000) toExxidae, a family erected to remove acanthodrilin wormswith racemose prostates and multiple nephridia from theOctochaetidae. We will return to the Exxidae question below.
Buckley et al. (2011) had the same placement ofBenhamiinae in relation to the other Acanthodrilidae as wehave here, as the sister taxon to all other Acanthodrilidae (plusMegascolecidae in the present case) (Figs 3, 4), though thenode was not supported by the less extensive dataset ofBuckley et al. (2011). It may be premature to include theholonephric genera Neogaster, Omodeona, Pickfordia,Wegeneriella and Wegeneriona in Benhamiinae, because wedo not have them represented in the taxon sample. Blakemore(2005) considers this inclusion by Csuzdi ‘unacceptable’ butgives no reasons for preferring the condition of the nephridia over
the condition of the calciferous glands as indicators of phylogeny.The calciferous gland structure of thesefive genera is very similarto that of themeronephric genera in Benhamiinae. Multiplicationof nephridia has taken place in several acanthodrilid andmegascolecid lineages, suggesting that the character is not asstable as one might prefer for the basis of a classification. Giventhe consistent support for the monophyly of Benhamiinae, wefavour the use of this subfamily name and it may merit elevationto family rank.
There are two clades within the remaining sampledAcanthodrilidae, one of which is represented here byAustralian, South African (Parachilota: Fig. 2 only) andMalagasy taxa, and the other by North American taxa.Neotrigaster rufa is a Puerto Rican endemic with multiplenephridia per segment and two pairs of racemose prostatesdischarging separately from the male pores, at the ends ofseminal grooves (the acanthodrilin male field configuration).The nephridial character has been used to place Neotrigasterin the Octochaetidae, a decision our data do not support, becauseN. rufa is in a strongly supported (PP = 1.0) clade withDiplocardia. Blakemore (2000), in an attempt to deal with thecombined acanthodrilin male field plus racemose prostate‘problem’ posed by Exxus wyensis, erected the family Exxidaeand transferred N. rufa and other acanthodrilid worms (mostlyNeotropical) with racemose prostates to the Exxidae. Racemoseprostates were a problem because they were previously knownonly from (some or all, depending on whose) Megascolecidae.It seems simpler to afford racemose prostates less weight, inrecognition that evolution of complex prostates from simple oneshas taken place several times in the history of megascolecoidearthworms. Therefore we propose to remove Neotrigaster andthe related genera Trigaster and Zapatadrilus from the Exxidae,perhaps transferring them toa revivedDiplocardiinae (the revival,though differently constituted, also suggested by Blakemore(2005) – see below) and leave the status of the Exxidae untilsuch time as someone actually finds a specimen of Exxus wyensisand obtains molecular data from it.
A taxonomic solution suggested by Blakemore (2005) mightbe to resurrect the Diplocardiinae, which could include theNorth American Acanthodrilidae with multiple gizzards,including Diplocardia, but we would add at least thetrigiceriate Neotrigaster and Trigaster (see Figs 3, 4 andBuckley et al. 2011). This leaves the question of what to dowith the numerous, unsampled Acanthodrilidae of Mexicoand central America, some of which do (e.g. Zapatadrilus,Zapotecia and Protozapotecia) and some of which do not(e.g. Larsonidrilus, Balanteodrilus, Ramiellona) have multiplegizzards. The Diplocardiinae concept we support includesmeronephric and holonephric genera, in contrast to thatindicated by Blakemore (2005), who would restrict it toholonephric genera. However the lack of data onAcanthodrilidae makes us cautious about further taxonomicrearrangements of acanthodrilid earthworms, pending samplingof more taxa, particularly Acanthodrilus.
The Megascolecidae representatives in the taxon set werecollected in the Philippines, Australia, and North America, eachbeing endemic to its location. The attempts to provide stablediagnostic characters for the Megascolecidae have been fraughtwith problems. Sims (1980) and Csuzdi (2010) based the familyon the racemose prostate glands without a central lumen, but this
226 Invertebrate Systematics S. W. James and S. K. Davidson
is not universally adopted nor is it supported here. One section ofthe Megascolecidae clearly does have racemose prostates, anAustralasian clade including Pheretima, but its North Americansister group does not. What they have in common is male andprostatic ducts united on segment 18, a character state that is notuniversal among the racemose prostate genera of Australasia.Several genera not included here (among them New ZealandMegascolides and Spenceriella) have tongue-shaped prostateswithout a central lumen but do not have externally evidentbranching, as is seen among the pheretimoid genera (Simsand Easton 1972) and some others. Gates (1972) advocated adistinction between racemose prostates of mesodermal origin(his Megascolecidae) and non-racemose prostates of ectodermalorigin (his Acanthodrilidae +Octochaetidae). For the present weagree with Blakemore’s (2000) and Jamieson and Ferraguti’s(2006) Megascolecidae (-inae) concept, which includes diverseprostate gland types, whose ducts generally are joined by thesperm ducts in combined male and prostatic pore(s) on segment18 or nearby. It seems rather obvious that the evolution ofprostate glands in the Megascolecidae and Acanthodrilidae(s.l.) has been more complex than convenient to taxonomists.Any modifications of the Megascolecidae are prevented byour lack of material from South Asia, where there are manyMegascolecidae, including the type genus Megascolex.
Revising the Glossoscolecidae
A salient departure from traditional classification is the strongsupport for a polyphyletic Glossoscolecidae, indicated in Figs 2and 3 with the family containing the type genus, GlossoscolexLeuckart, 1835, remaining as Glossoscolecidae, but the otherglossoscolecid clade indicated as ‘Glossoscolecidae’. TheAlmidae, removed from the Microchaetidae by Jamieson(1988), is closely related to both the Glossoscolecidae andthe ‘Glossoscolecidae’, but the topology obtained in allanalyses is one of two most parsimonious solutions to theevolution of calcium carbonate glands and male terminaliain the Glossoscolecidae (s.s) and the Eudrilidae. TheGlossoscolecidae type of calcium carbonate gland and maleterminalia are lacking in the Almidae and ‘Glossoscolecidae’.An equally parsimonious dichotomous tree would have the‘Glossoscolecidae’ as sister taxon to the Almidae. The twodivisions of the former Glossoscolecidae are distinct, wellsupported clades (nodal support values > 0.99), as is theAlmidae. This division is supported by morphologicaldistinctions as well. The Glossoscolecidae sensu strictushare the form and placement of paired esophageal calciumcarbonate glands plus the presence of conspicuous male pores,usually with muscular ejaculatory bulbs commonly calledcopulatory pouches. Typhlosolar development typically doesnot involve a very deep simple lamina, but complex foldingof a more compact lamina. The ‘Glossoscolecidae’ is morediverse in esophageal calcium carbonate gland number andstructure, the male pores are minute and superficial, or withinan intramural invagination, and never with the muscular bulbs.If a typhlosole is present it typically consists of an S-curved(in transverse section) lamina that can exceed the intestinaldiameter in depth. For these reasons we propose a new familyas follows:
Family PONTOSCOLECIDAE James, 2012, fam. nov.
Type genus: Pontoscolex Schmarda, 1861.Type species: Lumbricus corethrurus Müller, 1857.
Definition
Crassiclitellata with one oesophageal gizzard in vi; paired,extramural calciferous glands in some or all of segmentsvii–xiv; typhlosole ribbon-shaped, variously folded orpouched. Vascular system, with dorsal and ventral trunks,supraoesophageal trunk, paired extraoesophageal trunksmedian to the hearts, subneural vessel adherent to body wall.Holonephrida stomate, vesiculate in intestinal region. Dorsalpores lacking. Spermathecae, adiverticulate, in front of thegonadal segments. Male pores behind female pores,microscopic if primary; or if macroscopic then connected tointramural copulatory chambers.
Included genera
Aicodrilus,Alexidrilus,Andiodrilus,Andiorrhinus,Andioscolex,Annadrilus, Anteoides, Anteus, Aptodrilus, Atatina, Aymara,Botarodrilus, Bribri, Chibui, Cirodrilus, Diachaeta,Estherella, Eudevoscolex, Goiascolex, Hexachyloscolex,Inkadrilus, Langioscolex, Maipure, Martiodrilus, Meroscolex,Nouraguesia, Onoreodrilus, Onychochaeta, Opisthodrilus,Periscolex, Perolofius, Pontoscolex, Pseudochibui, Quimbaya,Randdrilus,Rhinodrilus,Tairona,Tamayodrilus,Thamnodriloides,Thamnodrilus, Tuiba, Tupinaki, Urobenus, Zongodrilus.
Pontoscolex is the oldest described genus in the family andcontains themost commonmember of the family,P. corethrurus.This species is among the most common earthworms in tropicalclimates, having been introduced accidentally to all tropicalclimate regions.
Family GLOSSOSCOLECIDAE Michaelsen, 1900; emend.James 2012
Type genus: Glossoscolex Leuckart, 1835Type species: Glossoscolex giganteus Leuckart, 1835
Definition
Crassiclitellata with one esophageal gizzard in vi; a single pair ofextramural calciferous glands of intertwined tubular type insegment xi or xii, typhlosole topologically a blade, but with ananterior section in which zig-zag folds have been ventrally fusedand folded over to form lateral pockets. Vascular system, withdorsal and ventral trunks, a supraoesophageal trunk, pairedextraoesophageal trunks median to the hearts, and a subneuraladherent to the body wall. Holonephrida stomate, vesiculate inintestinal region. Dorsal pores lacking. Spermathecae, whenpresent, adiverticulate and in front of the gonadal segments.Male pores, behind female pores, macroscopic and thenconnected to intracoelomic muscular ejaculatory bulbs thatreceive the vasa deferentia.
Included genera
Diaguita,Enantiodrilus,Fimoscolex,Glossodrilus,Glossoscolex,Holoscolex, and Righiodrilus.
This restricted sense of Glossoscolecidae is exclusively SouthAmerican except for a few Glossodrilus outliers in Central
Molecular phylogeny of earthworms Invertebrate Systematics 227
America and the Caribbean islands Dominica and Martinique(Fragoso et al. 1995).
Conclusion
The followingobservationmadeover50years agodeserveswidercirculation:
‘L’évolution n’a aucune raison de faciliter notre travail declassement’ – F. Grandjean (1954) (Evolution has noreason to facilitate our work of classification.)The molecular phylogenies we present here are a work in
progress. We were fortunate to obtain reasonably well supportedtopologieswith a fewgenes and a limited but broad taxon sample.Within each of the diverse families, as opposed to themonogeneric ones, considerable additional taxon sampling isnecessary to develop hypotheses about the phylogeny andpatterns of morphological evolution within each group. Acrossall families, it will be useful to obtain additional sequence datafrom genes appropriate to the resolution of relatively deepbranching points. The 28S gene appears to be quite useful inthis regard but needs additional support from other loci. We haveno easy way to calibrate a molecular clock for earthworms, therebeing no fossil record and only the coarse resolution of majortectonicmovements of the last 200million years. Regardless, it isapparent from a few pre- and post-Gondwanan vicariance eventsthatmost of the divergences in earthworms are quite old: Buckleyet al. (2011) found thatwithin–NewZealand cladeswere as old asmost continental clades, so minimally ~70million years withinthe New Zealand Acanthodrilidae. Therefore for resolutionsamong family levels, gene choice should focus on conservedprotein-coding regions of the nuclear genome. This will be thefocus of our future work on phylogeny of the Clitellata.
Acknowledgments
This research was funded by United States National Science FoundationAward DEB-0516439 (James) and 0516520 (Davidson). At the University ofKansas, Mike Grose of the Biodiversity Institute Molecular PhylogenyLaboratory gave us his full cooperation, as did Paulyn Cartwright, whogenerously provided laboratory space, and Daphne Fautin, who providedlogistical support and leadership in the Division of Invertebrate Zoology.Danuta Plisko,Victor Pop,CsabaCsuzdi,MarcelBouché,Robert Blakemore,Tomas Pavlicek, Raylton Sumrall, Somsak Panha, Munir Abdullah Dawood,Alfonso Alonso of The Smithsonian Institution’s Gamba Protected AreasProject, Malalatiana Razafrindrakoto, George Brown, Nicolas Pinel, PattanaSomniyam, Barrie Jamieson and numerous other people provided assistancein diverse ways, such as organising and guiding collection trips, collectingspecimens for us, or participating in field work with the first author in theextensive travel necessary to complete this research. All collecting was doneunder appropriate permits for the countries involved. Charlène Briard alertedus to the Grandjean (1954) quote. We dedicate this paper to Pietro Omodeo,with whose phylogenetic conclusions we respectfully disagree, but who isamong the most kindly, generous and knowledgeable of men.
References
Akaike, H. (1973). Information theory as an extension of the MaximumLikelihood principle. In ‘Second International Symposium InformationTheory’. (Eds N. Petrov and F. Csaki.) pp. 267–281. (Akademiai Kiado.)
Bartz, M. L. C., James, S. W., Pasini, A., and Brown, G. G. (in press). NewspeciesofGlossoscolexLeuckart, 1835andFimoscolexMichaelsen, 1900(Clitellata: Glossoscolecidae) from Northern Paraná, Brazil. Zootaxa.
Beddard, F. E. (1895). ‘A Monograph of the Order Oligochaeta.’ xii + 769pp. (Clarendon Press: Oxford.)
Bely, A. E., and Wray, G. A. (2004). Molecular phylogeny of naididworms (Annelida: Clitellata) based on cytochrome oxidase I.Molecular Phylogenetics and Evolution 30, 50–63. doi:10.1016/S1055-7903(03)00180-5
Blakemore, R. J. (2000). ‘Tasmanian Earthworms.’ CD-ROM Monographwith Review of World Families. (VermEcology Kippax: Canberra.)
Blakemore, R. J. (2005). Whither Octochaetidae? – its family statusreviewed. In ‘Advances in Earthworm Taxonomy. II. Proceedings ofthe 2nd International Oligochaete Taxonomy Meeting’. (Eds A. A. andV. V. Pop.) pp. 63–84. (Cluj University Press: Romania.)
Blakemore, R. J. (2006). Review of Criodrilidae (Annelida: Oligochaeta)including Biwadrilus from Japan. Opuscula Zoologica Budapest 37,11–22.
Blakemore, R. J. (2008). ‘Cosmopolitan Earthworms – an Eco-TaxonomicGuide to the Species.’ 3rd edn. (VermEcology: Yokohama, Japan.)
Buckley, T. R., James, S., Allwood, J., Bartlett, S., Howitt, R., and Prada, D.(2011). Phylogenetic analysis of New Zealand earthworms (Oligochaeta:Megascolecidae) reveals ancient clades and cryptic taxonomic diversity.Molecular Phylogenetics and Evolution 58, 85–96. doi:10.1016/j.ympev.2010.09.024
Csuzdi, C. (1996). Revision der Unterfamilie BenhamiinaeMichaelsen, 1897(Oligochaeta: Acanthodrilidae). Mitteilungen aus dem Museum fürNaturkunde in Berlin. Zoologisches Museum und Institut für SpezielleZoologie (Berlin) 72, 347–367. doi:10.1002/mmnz.19960720219
Csuzdi, C. (2010). A monograph of the Paleotropical Benhamiinaeearthworms (Annelida: Oligochaeta, Acanthodrilidae). PedozoologicaHungarica 6, Hungarian Natural History Museum, Budapest.
Dyne, G. R., and Jamieson, B. G. M. (2004). Native earthworms of AustraliaII (Megascolecidae, Acanthodrilinae). ABRS, Australian GovernmentDepartment of Environment and Heritage. CD-ROM.
Erséus, C. (2005). Phylogeny of oligochaetous Clitellata. Hydrobiologia535/536, 357–372. doi:10.1007/s10750-004-4426-x
Erséus, C., and Källersjö, M. (2004). 18S rDNA phylogeny of Clitellata(Annelida). Zoologica Scripta 33, 187–196. doi:10.1111/j.1463-6409.2004.00146.x
Fragoso, C., James, S. W., and Borges, S. (1995). Native earthworms ofthe north Neotropical region: current status and controversies. In‘Earthworm Ecology and Biogeography in North America’. (Ed.P. Hendrix.) pp. 67–115. (CRC Press: Boca Raton, FL.)
Gates, G. E. (1972). Burmese earthworms, an introduction to the systematicsand biology ofmegadrile oligochaeteswith special reference to south-eastAsia. Transactions of the American Philosophical Society 62(7), 1–326.doi:10.2307/1006214
Gates, G. E. (1976). On earthworm ovaries and their importance in megadrilesystematics. I. Megadrilogica 2(12), 1–2.
Goloboff, P.A., Farris, J. S., andNixon,K.C. (2003). Tree analysis using newtechnology. Willi Hennig Society version, available at www.zmuc.dk/public/phylogeny/tnt [verified June 2012]
Goloboff, P. A., Farris, J. S., and Nixon, K. C. (2008). TNT, a free programfor phylogenetic analysis. Cladistics 24, 774–786. doi:10.1111/j.1096-0031.2008.00217.x
Grandjean, F. (1954). Essai de classification des Oribates (Acariens).Bulletinde la Societe Zoologique de France 78, 421–446.
Guindon, S., andGascuel, O. (2003).A simple, fast, and accurate algorithm toestimate large phylogenies by maximum likelihood. Systematic Biology52, 696–704. doi:10.1080/10635150390235520
Hall, T. A. (1999). BioEdit: a user-friendly biological sequence alignmenteditor and analysis program for Windows 95/98/NT. Nucleic AcidsSymposium Series 41, 95–98.
Hillis, D. M., and Dixon, M. T. (1991). Ribosomal DNA: molecularevolution and phylogenetic inference. Quarterly Review of Biology 66,411–453.
228 Invertebrate Systematics S. W. James and S. K. Davidson
Ivanova,N.V., deWaard, J. R., andHebert, P.D.N. (2006a). An inexpensive,automation-friendly protocol for recovering high-quality DNA.Molecular Ecology Notes 6, 998–1002. doi:10.1111/j.1471-8286.2006.01428.x
Ivanova, N. V., deWaard, J. R., and Hebert, P. D. N. (2006b). CCDB DNAExtraction. http://www.dnabarcoding.ca/CCDB_DOCS/CCDB_DNA_Extraction.pdf [Verified June 2012]
Jamieson, B.G.M. (1971).Glossoscolecidae. In ‘TheAquaticOligochaeta oftheWorld’. (Eds R. O. Brinkhurst andB. G. M. Jamieson.) pp. 147–199.(Oliver and Boyd: Edinburgh, Toronto.)
Jamieson, B. G. M. (1988). On the phylogeny and higher classification ofthe Oligochaeta. Cladistics 4, 367–401. doi:10.1111/j.1096-0031.1988.tb00520.x
Jamieson, B. G. M. (2000). The native earthworms of Australia(Megascolecidae Megascolecinae). (Science Publishers: Enfield, NH.)(CD-ROM).
Jamieson, B. G. M. (2001). The native earthworms of Australia(Megascolecidae Megascolecinae). Supplement. (B. G. M. Jamieson,Department of Zoology and Entomology, University of Queensland,Brisbane.) (CD-ROM).
Jamieson, B. G. M., and Ferraguti, M. (2006). Non-leech Clitellata. In‘Reproductive biology and phylogeny of Annelida’. (Eds G. Rouse,and F. Pleijel.) pp. 235–392. (Science Publishers: Enfield, NH.)
Jamieson, B. G. M., Tillier, S., Tillier, A., Justine, J.-L., Ling, E., James, S.,MacDonald, K., and Hugall, A. F. (2002). Phylogeny of theMegascolecidae and Crassiclitellata (Annelida, Oligochaeta): combinedversus partitioned analysis using nuclear (28S) and mitochondrial (12S,16S) rDNA. Zoosystema 24, 707–734.
Kass, R. E., andRaftery, A. E. (1995). Bayes factors. Journal of the AmericanStatistical Association 90, 773–795. doi:10.2307/2291091
Koshiba, M., Ogawa, K., Hamazaki, S., Sugiyama, T., Ogawa, O., andKitajima, T. (1993). The effect of formalin fixation on DNA and theextraction of high-molecular weight DNA from fixed and embeddedtissues. Pathology, Research and Practice 189, 66–72.
Larkin,M.A.,Blackshields,G., Brown,N. P., Chenna,R.,McGettigan, P.A.,McWilliam, H., Valentin, F., Wallace, I. M., Wilm, A., Lopez, R.,Thompson, J. D., Gibson, T. J., and Higgins, D. G. (2007). Clustal Wand Clustal X version 2.0. Bioinformatics (Oxford, England) 23,2947–2948. doi:10.1093/bioinformatics/btm404
Lee, K. E. (1959). The earthworm fauna of New Zealand. New ZealandDepartment of Scientific and Industrial Research Bulletin, Vol. 130.
Mallatt, J., and Sullivan, J. (1998). 28S and 18S ribosomal DNA sequencessupport themonophyly of lampreys andhagfishes.MolecularBiologyandEvolution 15, 1706–1718.
Medlin, L., Hille, J. E., Shawn, S., and Sogin, M. L. (1988). Thecharacterization of enzymatically amplified eukaryotic 16S-likerRNA-coding regions. Gene 71, 491–499. doi:10.1016/0378-1119(88)90066-2
Michaelsen, W. (1900). Oligochaeta. Tierreich 10, xxix + 1–575.Michaelsen, W. (1919). Über die Beziehungen der Hirudineen zu den
Oligochaeten. Mitteilungen aus dem Naturhistorischen MuseumHamburg 36, 131–153.
Michaelsen, W. (1935). Oligochaten von Belgisch-Kongo. III. Revue deZoologie et de Botanique Africaines 29, 37–74.
Nylander, J. A. A., Ronquist, F., Huelsenbeck, J. P., and Nieves Aldrey, J. L.(2004). Bayesian phylogenetic analysis of combined data. SystematicBiology 53, 47–67. doi:10.1080/10635150490264699
Omodeo, P. (1998). History of Clitellata. The Italian Journal of Zoology65, 51–73. doi:10.1080/11250009809386726
Omodeo, P. (2000). Evolution and biogeography of megadriles (Annelida,Clitellata). The Italian Journal of Zoology 67, 179–201. doi:10.1080/11250000009356313
Palumbi, S. R. (1996). Nucleic acids II: the polymerase chain reaction. In‘Molecular Systematics’. (EdsD. M.,Hillis,C.Moritz, andB. K.Mable.)pp. 205–247. (Sinauer & Associates: Sunderland, MA.)
Passamaneck, Y. J., Schander, C., and Halanych, K.M. (2004). Investigationof molluscan phylogeny using large-subunit and small-subunit nuclearrRNA sequences. Molecular Phylogenetics and Evolution 32, 25–38.doi:10.1016/j.ympev.2003.12.016
Posada, D. (2008). jModelTest: phylogenetic model averaging. MolecularBiology and Evolution 25, 1253–1256. doi:10.1093/molbev/msn083
Qiu, J.-P., and Bouché, M. B. (1998). Révisions des taxon supraspécifiquesde Lumbricoidea. Documents Pédozoologiques et Intégrologiques 3,179–216.
Rambaut, A., and Drummond, A. J. (2009). MCMC Trace Analysis Tool,Version v1.5.0. http://beast.bio.ed.ac.uk/ [verified June 2012]
Ronquist, F., and Huelsenbeck, J. P. (2003). MrBayes3: Bayesianphylogenetic inference under mixed models. Bioinformatics 19,1572–1574.
Siddall, M. E., Apakupakul, K., Burreson, E. M., Coates, K. A., Erséus, C.,Källersjö,M.,Gelder, S.R., andTrapido-Rosenthal,H. (2001).ValidatingLivanow: molecular data agree that leeches, branchiobdellidans andAcanthobdella peledina are a monophyletic group of oligochaetes.Molecular Phylogenetics and Evolution 21, 346–351. doi:10.1006/mpev.2001.1021
Sims, R. W. (1980). A classification and the distribution of earthworms,suborder Lumbricina (Haplotaxida: Oligochaeta). Bulletin of the BritishMuseum (Natural History). Zoological Series 39, 103–124.
Sims, R. W., and Easton, E. G. (1972). A numerical revision of theearthworm genus Pheretima auct. (Megascolecidae: Oligochaeta) withthe recognition of new genera and an appendix on the earthwormscollected by the Royal Society North Borneo Expedition. BiologicalJournal of the Linnaean Society 4, 169–268.
Stamatakis, A. (2006). RAxML-VI-HPC: maximum likelihood–basedphylogenetic analyses with thousands of taxa and mixed models.Bioinformatics 22, 2688–2690. doi:10.1093/bioinformatics/btl446
Stephenson, J. (1930). ‘The Oligochaeta.’ (Clarendon Press: Oxford.)Struck, T. H., Purschke, G., and Halanych, K. M. (2006). Phylogeny of
Eunicida (Annelida) and exploring data congruence using a PartitionAddition Bootstrap Alteration (PABA) approach. Systematic Biology 55,1–20.
Struck,T.H.,Paul,C.,Hills,N.,Hartmanns,S.,Hösel,C.,Kube,M.,Liebs,B.,Meyers, A., Tiedemann, R., Purschke, G., and Bleidorn, C. (2011).Phylogenomic analyses unravel Annelida evolution. Nature 471,95–98. doi:10.1038/nature09864
Swofford, D. L. (2002). ‘PAUP*. Phylogenetic Analysis Using Parsimony(*and Other Methods). Version 4.’ (Sinauer Associates: Sunderland,MA.)
Molecular phylogeny of earthworms Invertebrate Systematics 229
www.publish.csiro.au/journals/is
