Molecular phylogeny of earthworms (Annelida�:�Crassiclitellata) based on 28S, 18S and 16S gene sequences

Download Molecular phylogeny of earthworms (Annelida�:�Crassiclitellata) based on 28S, 18S and 16S gene sequences

Post on 27-Jan-2017

226 views

Category:

Documents

0 download

TRANSCRIPT

  • Molecular phylogeny of earthworms (Annelida : Crassiclitellata) based on 28S, 18S and 16S gene sequences Samuel W. JamesA,C and Seana K. DavidsonB ADepartment of Biology, 143 Biology Building, University of Iowa, Iowa City, IA 52242-1324, USA. BDepartment of Civil and Environmental Engineering, University of Washington, Benjamin Hall Building, 616 Northlake Place, Seattle, WA 98195-5014, USA. CCorresponding author. Email: samuel-james@uiowa.edu Abstract. Relationships among, and content of, earthworm families have been controversial and unstable.Herewe analyse molecular data from 14 Crassiclitellata families represented by 54 genera, the non-crassiclitellate ‘earthworms’ of the Moniligastridae, plus several clitellate outgroups. Complete 28S and 18S gene sequences and a fragment of the 16S gene analysed separately or in concatenated Bayesian analyses indicate that most previously proposed suprafamilial taxa within the Crassiclitellata are para- or polyphyletic. There is strong support for the Metagynophora, which consists of the Crassiclitellata andMoniligastridae. Themost basal within-Clitellata branch leads to the small families Komarekionidae, Sparganophilidae, Kynotidae, and Biwadrilidae, found in widely separated areas. A clade composed of Lumbricidae, Ailoscolecidae, Hormogastridae, Criodrilidae and Lutodrilidae appears near the base of the tree, but Criodrilidae and Biwadrilidae are not closely related because the former is sister to the Hormogastridae +Lumbricidae clade. The Glossoscolecidae is here separated into two families, the Glossoscolecidae s.s. and the Pontoscolecidae (fam. nov.). The Megascolecidae is monophyletic within a clade including all acanthodrilid earthworms. There is strong support for the Benhamiinae (Acanthodrilidae s.l.) as sister to Acanthodrilidae +Megascolecidae, but taxon sampling within other acanthodrilid groups was not sufficient to reach further conclusions. The resulting trees support revised interpretations of morphological character evolution.’ Received 31 March 2011, accepted 6 March 2012, published online 6 August 2012 Introduction Over the last 120 years, various classifications of earthworms have been proposed and debated usingmorphological characters, sometimes in an evolutionary context, but rarely with any explicit analysis of character data, resulting in intuitive conclusions (e.g. Michaelsen 1900; Stephenson 1930; Gates 1972). This, coupled with the lack of a fossil record, has led workers in the field to reach diverse conclusions from the same basic data, and to generally dismiss any character set thought to be ‘adaptive,’ or subject to selection based on environmental characteristics. In contrast, Struck et al. (2011) found that a fundamental lifestyle difference within Annelida was congruent with their Expressed Sequence Tag (EST)-based phylogeny. However other ecological differences have not yet been confirmed at shallower branching points. Such a project does not look promising in the context of the current paper, because most earthworm families span a range of ecological niches. The history of family and suprafamilial concepts in the Crassiclitellata Jamieson, 1988 (earthworms in general) reveals recurrent problems in homology assumptions and ad hoc hypotheses of the importance of certain characters or suites of characters, all complicated by the fact that different sets of characters give conflicting signals. Erséus (2005) critiqued the history of intuitive and formal phylogenetic arguments in the ClitellataMichaelsen, 1919, and reached conclusions with which we agree: modern techniques of phylogenetic research have had insufficient impact on the approaches used with Clitellata. Some exceptions are Jamieson (1988) and Jamieson et al. (2002), in which morphological and molecular data, respectively, were formally analysed and the results applied to define higher taxa within earthworms. Recent work has also attempted to reconsider morphological character states in relation to (palaeo)biogeography to help define families and classifications within the earthworms, such as that of Omodeo (1998, 2000), Sims (1980), Gates (1972), and Blakemore (2000, 2008). Gates (1972) did a considerable service by criticising the classical system (Michaelsen 1900; Stephenson 1930) for its dependence on reproductive characters, its denigration of somatic characters, and its fallacious evolutionary reasoning. Sims (1980) proposed definitions of the superfamilies Megascolecoidea (Acanthodrilidae, Megascolecidae, Octochaetidae, Ocnerodrilidae, Eudrilidae), Lumbricoidea (Lumbricidae, Hormogastridae, Lutodrilidae, Ailoscolecidae and Sparganophilidae) and Glossoscolecoidea (Glossoscolecidae, Kynotidae Almidae, and Microchaetidae) based largely on ovarian morphology and the budding of the Journal compilation � CSIRO 2012 www.publish.csiro.au/journals/is CSIRO PUBLISHING Invertebrate Systematics, 2012, 26, 213–229 http://dx.doi.org/10.1071/IS11012 mailto:samuel-james@uiowa.edu
  • oocytes (Gates 1976). Two other superfamilies, Criodriloidea and Biwadriloidea, are monogeneric, while the Komarekionidae are placedbySims(1980) in theAiloscolecidaeandtheTumakidaehad not yet been discovered. Omodeo (2000) proposed a Lumbricoidea containing Lumbricidae, Hormogastridae, Lutodrilidae, Glossoscolecidae, Kynotidae (as within Microchaetidae), Ailoscolecidae and Criodrilidae (which included Sparganophilidae, Lutodrilidae, Komarekionidae, and maybe Biwadrilidae), Almidae and Glyphidrilidae. He placed the Eudrilidae in its own superfamily Eudriloidea, and his Megascolecoidea consisted of Acanthodrilidae, Megascolecidae, Octochaetidae, and Ocnerodrilidae. Omodeo’s (2000) detailed but informal analysis of character evolution concluded that Crassiclitellata are polyphyletic, stemming from 2 or 3 different non- crassiclitellate ancestors. He derived Eudriloidea from Alluroididae-like ancestors based on a hypothesised homology of euprostates present in both groups, and considered the Moniligastridae (terrestrial non-crassiclitellates of earthworm dimensions) as belonging to this lineage. The Lumbricoidea are derived from something resembling modern Haplotaxidae, a more or less classical position, and the Megascolecoidea could be derived from the same ancestor as theEudriloidea or a different but related ancestor. An enduring problem within the Megascolecoidea is that of multiple nephridia (meronephry) in earthworms of the families Acanthodrilidae and/or Octochaetidae (which family is used depends on the interpretation of the nephridia). The Octochaetidae (type genus Octochaetus Beddard, 1892 from New Zealand) includes only meronephric species with acanthodrilin male terminalia. The acanthodrilin male terminalia are composed of male pores and separate prostatic pores in the same or adjacent segments, generally in the range of segments 17–20. Prostate glands are usually tubular. Classically, the Octochaetidae had only tubular prostates, but Exxus wyensis Gates, 1959 and Neotrigaster rufa (Gates, 1962) introduced genera with racemose prostates, a characteristic previously associated only with some genera of Megascolecidae. Blakemore (2000, 2008) proposed the Exxidae, which became the home of octochaetid genera with racemose prostates. Lee (1959) made a fairly clear case for multiple independent origins of acanthodrilin meronephry by pointing out the morphological similarities between members of New Zealand genus pairs in which one member was meronephric and the other not; the set of pairs included Octochaetus. This argument did not get the traction it deserved. Lee’s conclusions have since gained support from Jamieson et al. (2002) and Dyne and Jamieson (2004), which demonstrated that the Octochaetidae was polyphyletic. Other acanthodrilid genera with multiple nephridia, and therefore classically assigned to the Octochaetidae, are found in Africa, the north Neotropics and South Asia. The Octochaetidae concept has survived in one form or another to this day, albeit with recognition that modifications are probably needed (Blakemore 2005). One such modification is that of Csuzdi (1996), who proposed the Benhamiinae to accommodate the acanthodrilid genera with stalked calciferous glands in some or all of segments 14–17, but including holonephric genera with the same gland type. This mirrors Lee’s hypothesis thatmeronephry is not phylogenetically informative within the New Zealand acanthodrilids. The above review of earthworm systematics is provided to assist those unfamiliar with the history of the debates and the diversity of forms to followour results.Wedonot intend this as an exhaustive review, but only as an introduction that can be used as a starting point for further study of the role of morphology in the classification of earthworms. For purposes of the current paper, we would like to evaluate Crassiclitellata phylogeny with molecular data and subsequently reconsider morphology in light of the molecular phylogenetic results. The present paper is an attempt to build on the earlier molecular phylogenies of Clitellata (particularly that of Jamieson et al. 2002) by expanding the sequence length and the breadth of taxonomic coverage within the Crassiclitellata. The nuclear genes encoding the 28S and 18S rRNAs, the mitochondrial 12S and 16S rRNAs, and the cytochrome oxidase subunit I (COI) genes have proven useful for phylogenetic analyses of the Clitellata (Jamieson et al. 2002; Bely and Wray 2004; Erséus and Källersjö 2004). However, the mitochondrial genes are less appropriate to resolution of deep branching in the group, so we devoted more effort to the 28S and 18S genes. We will use these genes plus a short section of the mitochondrial 16S gene to infer relationships among all families of the Crassiclitellata. The 18S gene will be used to infer relationships among Crassiclitellata and several oligochaetous Clitellata (sensu Erséus 2005) outgroups including the Moniligastridae and Enchytraeidae. Materials and methods Taxon sampling Material was collected from several genera each (except the monogeneric families) in all Crassiclitellata families plus the Moniligastridae, following the taxonomies of Jamieson et al. (2002) and Blakemore (2000, 2008). The families and species represented are shown in Table 1. We collected in the USA, France, Spain, Andorra, Romania, Hungary, Gabon, Kenya, South Africa, Madagascar, Thailand, the Philippines, Brazil, Fiji, the Antilles, Japan, and Australia. Where it was possible, samples were obtained across geographic disjunctions in families. 18S gene sequences from the oligochaetous Clitellata families Tubificidae, Haplotaxidae, Capilloventridae, Phreodrilidae, Enchytraeidae, and Lumbriculidae, plus representatives of the Hirudinida, Acanthobdellida and Branchiobdellida, were retrieved from GenBank. The taxa sampled and GenBank accession numbers for the sequences are shown in Table 1. All diverse families were represented by several species and in most cases by several genera, while the monotypic families Ailoscolecidae, Komarekionidae, Lutodrilidae, and Biwadrilidae were represented by their only known species. We were unable to obtain material of the monotypic Syngenodrilidae, the Alluroididae, Criodrilidae and the monotypic Tumakidae. The first two are not Crassiclitellata, and the Syngenodrilidae is morphologically close to the Moniligastridae, which we were able to obtain. The Kenyan type locality of Syngenodrilus lamuensis (Smith & Green, 1917) no longer exists in natural form, and nearby locations had only Eudrilidae and Dichogaster spp. Ten-year-old tissues of Lutodrilus multivesiculatus 214 Invertebrate Systematics S. W. James and S. K. Davidson
  • Table 1. Taxon sample and GenBank accession numbers Asterisks indicate taxa belonging to the Octochaetidae of some authorities Family Individual number, taxon ID Location 18S 28S 16S Acanthodrilidae 0113 Dichogaster sp. FJ22* Fiji HQ728872 HQ728984 JF267864 Acanthodrilidae 0120 Dichogaster sp. Mart2sA18s* Martinique HQ728870 Acanthodrilidae 0145 Dichogaster sp.* Dominica HQ728990 JF267865 Acanthodrilidae 0147 Dichogaster sp. DomMM18s* Dominica HQ728871 Acanthodrilidae 0225 Neotrigaster rufa* Puerto Rico HQ728887 HQ728982 JF267866 Acanthodrilidae 0339 Dichogaster saliens* Brazil HQ728874 HQ728988 JF267867 Acanthodrilidae 0414 Dipocardia conoyeri USA HQ728888 HQ728983 JF267868 Acanthodrilidae 0828 Acanthodrilidae sp. MG Madagascar HQ728890 HQ728986 JF267870 Acanthodrilidae 0904 Diplotrema sp. Australia HQ728889 HQ728987 JF267871 Acanthodrilidae 1042 Benhamiona sp. Gh* Ghana HQ728991 JF267872 Acanthodrilidae 1058 Benhamia sp. Gh* Ghana HQ728880 HQ728992 JF267873 Acanthodrilidae 1062 Millsonia sp. Gh* Ghana HQ728881 HQ728993 JF267874 Acanthodrilidae 1127 Dichogaster sp. Ke3_5* Kenya HQ728873 HQ728989 JF267875 Acanthodrilidae 1212 Dichogaster sp. Ga5_2* Gabon HQ728875 HQ728994 JF267876 Ailoscolecidae 0662 Ailoscolex lacteospumosus France HQ728907 HQ728934 JF267908 Almidae 0881 Glyphidrilus sp. Thailand HQ728894 HQ728961 JF267919 Almidae 1112 Almidae sp. Ke Kenya HQ728895 HQ728997 JF267921 Biwadrilidae 0589 Biwadrilus bathybates Japan HQ728920 HQ728949 JF267906 Criodrilidae Criodrilus lacuum AY365461 AY048492 GU901783 Eudrilidae 1060 Hyperiodrilus sp. Gh Ghana HQ728925 HQ728960 JF267877 Eudrilidae 1115 Polytoreutus finni Kenya HQ728926 HQ728958 JF267878 Eudrilidae 1117 Eudriloides sp. Ke Kenya HQ728924 HQ728959 JF267879 Eudrilidae 1221 Hyperiodrilus africanus Gabon HQ728927 HQ728995 Glossoscolecidae 0222 Estherella sp. EY2 Puerto Rico HQ728896 HQ728951 JF267882 Glossoscolecidae 0234 Pontoscolex spiralis Puerto Rico HQ728898 HQ728954 JF267883 Glossoscolecidae 0315 Andiorrhinus sp. PG Brazil HQ728897 HQ728953 JF267884 Glossoscolecidae 0320 Fimoscolex sp. PG Brazil HQ728891 HQ728966 JF267885 Glossoscolecidae 0322 Urobenus brasiliensis Brazil HQ728899 HQ728955 JF267886 Glossoscolecidae 0327 Goiascolex sp. Brazil HQ728952 JF267887 Glossoscolecidae 0329 Rhinodrilus sp. Brazil HQ728956 Glossoscolecidae 0330 Glossoscolex paulistus Brazil HQ728892 HQ728967 JF267888 Glossoscolecidae 0855 Atatina sp. Brazil HQ728900 HQ728957 JF267890 Glossoscolecidae 0862 Glossodrilus sp. Ecuador HQ728893 HQ728968 JF267889 Hormogastridae 0598 Hormogaster gallica Spain HQ728912 HQ728932 JF267891 Hormogastridae 0622 Vignysa popi France HQ728911 HQ728933 JF267892 Hormogastridae 0632 Hemigastrodrilus monicae France HQ728908 HQ728935 JF267893 Komarekionidae 0844 Komarekiona eatoni USA HQ728922 HQ728944 JF267913 Kynotidae 0821 Kynotus sp. r1 Madagascar HQ728947 JF267909 Kynotidae 0823 Kynotus sp. w Madagascar HQ728917 HQ728945 JF267910 Kynotidae 0825 Kynotus sp. lgW Madagascar HQ728918 HQ728946 JF267911 Kynotidae 0826 Kynotus sp. r2 Madagascar HQ728919 HQ728948 JF267912 Lumbricidae 0399 Bimastos zeteki USA HQ728901 HQ728940 JF267922 Lumbricidae 0405 Eisenoides_carolinensis USA HQ728903 HQ728939 JF267923 Lumbricidae 0592 Zophoscolex zhangi France HQ728906 HQ728937 JF267924 Lumbricidae 0717 Lumbricus polyphemus Hungary HQ728904 HQ728938 JF267925 Lumbricidae 0781 Allolobophora mehadiensis Romania HQ728905 HQ728936 Lumbricidae 0813 Octodrilus complanatus Cyprus HQ728902 HQ728941 JF267926 Lumbricidae Lumbricus terrestris AJ272183 Lutodrilidae 0957 Lutodrilus multivesiculatus USA HQ728910 Megascolecidae 0004 Archipheretima pandanophila Philippines HQ728882 HQ728975 JF267894 Megascolecidae 0007 Pheretima sp. 092_1 Philippines HQ728883 HQ728976 JF267927 Megascolecidae 0244 Perionyx excavatus USA HQ728977 JF267900 Megascolecidae 0389 Arctiostrotus sp. USA HQ728884 HQ728979 JF267895 Megascolecidae 0391 Toutellus sp. USA HQ728981 JF267896 Megascolecidae 0835 Perionyx sp. MG Madagascar HQ728978 JF267899 Megascolecidae 0903 Terriswalkerius sp. Australia HQ728886 HQ728974 JF267897 Megascolecidae 0917 Driloleirus sp. USA HQ728885 HQ728980 JF267898 Microchaetidae 0500 Tritogenia lunata USA HQ728916 HQ728950 JF267880 (continued next page ) Molecular phylogeny of earthworms Invertebrate Systematics 215
  • McMahan, 1974 did not yield full 28S sequences, and we could not locate new material. Specimens of each field-distinguishable species were preserved at the time of collection with fixatives appropriate for preserving DNA and morphology of the earthworms. Voucher specimens were fixed in neutral buffered 4% formaldehyde – 0.17 M NaCl (PFA: Koshiba et al. 1993) before being transferred to 80% ethanol for transport and long-term storage at �20�C. Specimens collected for DNA extraction were preserved in 95% ethanol, 3 volumes per volume of earthworm, which was changed two or three times until the material was stiff. Vouchers were deposited in the Kansas University Natural History Museum and/or repatriated to institutions of other nations as required by their laws. DNA extraction, gene amplification and sequencing Bodywall tissue samples of earthwormswere extracted by one of threemethods: (1) DNAeasy TissueKit (Qiagen) according to the Table 1. (continued ) Family Individual number, taxon ID Location 18S 28S 16S Microchaetidae 0506 Proandricus thornvillensis South Africa HQ728915 HQ728996 JF267881 Microchaetidae 0508 Parachilota sp. South Africa HQ728985 JF267869 Microchaetidae 0511 Microchaetus papillatus South Africa HQ728914 HQ728999 Microchaetidae 0516 Geogenia pandoana South Africa HQ728913 HQ729000 JF267901 Moniligastridae 0868 Drawida sp. bl Thailand HQ728930 HQ728964 JF267916 Moniligastridae 0871 Drawida sp. w Thailand HQ728928 HQ728962 JF267917 Moniligastridae 0873 Drawida sp. br Thailand HQ728929 HQ728963 JF267918 Ocnerodrilidae 0233 Ocnerodrilidae sp. PR Puerto Rico HQ728876 HQ728969 JF267905 Ocnerodrilidae 0240 Gordiodrilus elegans USA HQ728879 HQ728973 JF267902 Ocnerodrilidae 0341 Nematogenia sp. Brazil HQ728877 HQ728971 JF267903 Ocnerodrilidae 0343 Kerriona sp. Brazil HQ728878 HQ728970 JF267904 Ocnerodrilidae 0555 Ocnerodrilidae sp. South Africa HQ728972 Sparganophilidae 0411 Sparganophilus sp. GA USA HQ728921 HQ728942 JF267907 Sparganophilidae 0846 Sparganophilus sp. G2 USA HQ728943 JF267914 Sparganophilidae 0848 Sparganophilus sp. LA USA HQ728923 HQ728998 JF267915 Clitellata outgroup taxa Enchytraeidae 0892 Enchytraeidae sp. USA HQ728931 HQ728965 JF267920 Enchytraeidae Grania variochaeta AY365459 Enchytraeidae Grania americana AY040686 Enchytraeidae Buchholzia fallax AF411895 Enchytraeidae Fridericia tuberosa AF209453 Enchytraeidae Marionina sublitoralis AY365458 Lumbriculidae Stylodrilus heringianus AF411907 Lumbriculidae Eclipidrilus frigidus AY040692 Lumbriculidae Rhynchelmis tetratheca AY365464 Lumbriculidae Lumbriculus variegatus AF209457 Haplotaxidae Haplotaxis gordioides AY365456 Tubificidae Tubificoides bermudae AF209467 Tubificidae Smithsonidrilus hummelincki AF209465 Tubificidae Thalassodrilides gurwitschi AF209466 Tubificidae Nais communis AF411878 Tubificidae Pristina longiseta AF411875 Tubificidae Heterodrilus decipiens AF209455 Tubificidae Pectinodrilus molestus AF209462 Tubificidae Bathydrilus litoreus AF209452 Tubificidae Heronidrilus heronae AF209454 Tubificidae Bothrioneurum vejdovsky AF411908 Phreodrilidae Antarctodrilus proboscidea AY365465 Phreodrilidae Insulodrilus bifidus AF411906 Propappidae Propappus volki AY365457 Capilloventridae Capilloventer australis AY365455 Branchiobdellidae Cirrodrilus sapporensis AF310698 Acanthobdellidae Acanthobdella peledina AY040680 Cambarincolidae Cambarincola pamelae AF310695 Branchiobdellidae Branchiobdella parasita AF310690 Erpobdellidae Erpobdella japonica AF116000 Glossiphoniidae Glossiphonia complanata AF099943 Glossiphoniidae Helobdella stagnalis AF115986 Haemopidae Haemopis caeca AY040687 216 Invertebrate Systematics S. W. James and S. K. Davidson
  • manufacturer’s instructions, (2) by sending tissues to the Canadian Centre for DNA Barcoding for extraction and purification according to their protocols (Ivanova et al. 2006a, 2006b), or (3) lysis in 300mL of a solution of 100mM NaCl, 100mM Tris-Cl, 25mM EDTA, 0.5% SDS at pH 8 plus 2mL proteinase-K (20mgmL–1), followed by protein precipitation with 100mL 4M guanidine thiocyanate in 0.1 M Tris-Cl pH 7.5, centrifugation (5min., 13 000 rpm), and precipitation of the DNA from the supernatant with 300 mL cold isopropanol (�20�C), recentrifugation and a wash with 300mL 70% ethanol. The DNA was air-dried at ambient temperature and resuspended in 10mM Tris–Cl pH 8.0. The nuclear 18S and 28S rRNA genes and a section of the mitochondrial 16S gene were amplified with PCR primers (*) (listed inTable 1), using 1mLofDNA template, 2mLof 4mgmL–1 Bovine Serum Albumin Fraction V (Fisher BP1605), 1 mL of DMSO, 0.58mL of each primer solution (10 p.m. mL–1), 1.4mL ultrapure water and 7.29mL Qiagen HotStarTaq master mix with 1.17mL CoralLoad dye in a total reaction volume of 15mL. The thermocycle profile consisted of 4min at 94�C, then 35 cycles of 20 s at 94�C, 20 s at 47�C and 105 s at 72�C, followed by 7min of final extension at 72�C. The 28S gene was copied in two overlapping sections of 1800–2000 bp using two primer pairs listed in Table 2 using an initial denaturation of 4min at 94�C, then 35 cycles of 30 s at 94�C, 30 s at 60�C and 90 s at 72�C, followed by 10min at 72�C. The ~460-bp 16S gene fragment used the following profile: initial denaturation of 4min at 95�C, then 35 cycles of 60 s at 94�C, 60 s at 48�C and 60 s at 72�C, followed by 7min at 72�C. All primers used in sequencing are given in Table 1. All sequencing was done at the University of Kansas Biodiversity Institute Molecular Phylogeny Laboratory on an ABI 3730 Applied Biosystems genetic analyser or on the ABI 3130xl machine. Sequence assembly was done manually from trace files viewed in FINCHTV 1.4.0 (Geospiza, Inc.), assembled as text files, strand reads aligned in CLUSTAL 2.0 (Larkin et al. 2007) and checked for errors and ambiguities by revisiting the trace files. The resulting consensus sequences were aligned in CLUSTAL 2.0 with default settings and manually edited in BIOEDIT 7.0 (Hall 1999) to remove length/alignment ambiguous regions and singleton one-base indels (these could be the result of base call errors not detected earlier in the process). Stringent editing of length-variable regions was applied to sequences such that unalignable regions were eliminated from the data matrix. Phylogenetic analyses We used a standard procedure for all analyses, unless otherwise noted. Substitution models were selected by the Akaike Information Criterion (AIC: Akaike 1973) as implemented in JModeltest 0.1 (Posada 2008) with use of PHYML (Guindon and Gascuel 2003). The best models all contained invariant site and gamma parameters, and the GTR+ I +G model was chosen for Table 2. Primers used for PCR (*) and sequencing (all) Primer Sequence Source 18sA* AAC CTG GTT GAT CCT GCC AGT Medlin et al. (1988) 18sL AGT TAA AAA GCT CGT AGT TGG Medlin et al. (1988) 18sC CGG TAA TTC CAG CTC CAA TAG Medlin et al. (1988) 18sY GTT GGT GGA GCG ATT TGT CTG Medlin et al. (1988) 18sB* AGG TGA ACC TGC GGA AGG ATC Medlin et al. (1988) 18sO AAG GGC ACC ACC AGG AGT GGA G Medlin et al. (1988) 28sC* ACCCGCTGAATTTAAGCAT Jamieson et al. (2002) 28sD2 TCCGTGTTTCAAGACGG Jamieson et al. (2002) Po28F1 TAAGCGGAGGAggaAAAGAAAC Struck et al. (2006), modified with gga insert 28F5 CAAGTACCGTGAGGGAAAGTTG Passamaneck et al. (2004) Po28F2 CGACCCGTCTTGAAACACGG Struck et al. (2006) 28R6 CAACTTTCCCTCACGGTACTTG Passamaneck et al. (2004) Po28R5 CCGTGTTTCAAGACGGGTCG Struck et al. (2006) 28F1 GGGACCCGAAAGATGGTGAAC Passamaneck et al. (2004) Po28R4 GTTCACCATCTTTCGGGTCCCAAC Struck et al. (2006) 28ee ATCCGCTAAGGAGTGTGTAACAACTCACC Hillis and Dixon (1991) 28ff* GGTGAGTTGTTACACACTCCTTAGCGG Hillis and Dixon (1991) Po28R3* GCTGTTCACATGGAACCCTTCTCC Struck et al. (2006) 28F4 CGCAGCAGGTCTCCAAGGTGAACA GCCTC Passamaneck et al. (2004) 28R2 GAGGCTGTKCACCTTGGAGACCTG CTGCG Passamaneck et al. (2004) 28v AAGGTAGCCAAATGCCTCGTCATC Hillis and Dixon (1991) 28R3 GATGACGAGGCATTTGGCTACC Passamaneck et al. (2004) Po28R2 CCTTAGGACACCTGCGTTA Struck et al. (2006) 28F6 CAGACCGTGAAAGCGTGGCCTATC GATCC Passamaneck et al. (2004) Po28R1 GAACCTGCGGTTCCTCTCG Struck et al. (2006) R3264.2 TTCTGACTTAGAGGCGTTCAG Passamaneck et al. (2004), modified here 28MSR* ACTTTCAATAGATCGCAG Mallatt and Sullivan (1998) 16sAr* CGCCTGTTTATCAAAAACAT Palumbi (1996) 16sBr* CCGGTCTGAACTCAGATCACGT Palumbi (1996) Molecular phylogeny of earthworms Invertebrate Systematics 217
  • all genes, given the model options available in MrBayes 3.1 (Ronquist and Huelsenbeck 2003). All gene trees and concatenated analyses were done in MrBayes 3.1 with default priors and three heated, one cold Markov chains, running each analysis from two random starting points for 20� 106 generations, sampling trees every 10 000 generations and discarding the first 20% as burn-in. The temperature was set to 0.10 inorder to improve chainmixing.Eachanalysiswas repeated and the outputs combined in TRACER 1.5 (Rambaut and Drummond 2009), with which we evaluated sampling of the parameter distributions and convergence of the Bayesian runs. MrBayes jobswere runon theCIPRES server (http://www.phylo. org/portal2/). 18S gene trees were used to check the monophyly of the Crassiclitellata with broad taxon sampling within the Clitellata. A duplicate set of 18S analyses using the less stringent alignment editing was performed. 28S gene sequences were analysed separately to confirm consistency of the tree topologies (Crassiclitellata +Moniligastridae only) between the 18S and 28S datasets. The 18S and 28S sequences were concatenated and run in partitioned Bayesian analyses, as were the three gene sequences (18S, 28S, 16S). In both cases the partitionswere unlinked and the GTR+ I +G model’s parameters were estimated separately by gene. For the three-gene dataset we ran a Maximum Likelihood (ML) 1000 bootstrap resampling analysis inRAxML (Stamatakis 2006) as implemented on the CIPRES server, using the GTR+G substitution model and three data partitions. Maximum parsimony analysis of the 18S + 28S + 16S dataset was done in PAUP* (Swofford 2002) using TBR and 500 bootstrap resamplings. We also did several Maximum Parsimony (MP) analyses in TNT (Goloboff et al. 2003, 2008), implementing sectorial search (RSS and XSS options), ratchet, and tree fusing (3 rounds, TBR) in various combinations. The final analysis used these three search types and 1000 symmetric resamplings. In order to test Sims’ (1980) hypotheses of monophyly of his Lumbricoidea and Glossoscolecoidea suprafamilial groups, and Omodeo’s (2000) hypotheses of Lumbricoidea and Eudrilidae +Moniligastridae, we ran separate Bayesian analyses of the 18S plus 28S data matrix with topological constraints for monophyly of the respective taxon sets for each author’s concept of higher classification. Thus there was a ‘Sims constraint’ run and an ‘Omodeo constraint’ run. Except for the topological constraints, all other settings were the same as in the main analyses, but with only 2� 106 generations each. Finally, an unconstrained analysis of 2� 106 generations was also run. The constrained trees’ statistics and the short unconstrained tree statistics were compared with Bayes factors (Kass and Raftery 1995; Nylander et al. 2004). Results Phylogenies The18Sand28SgenesofClitellata areGC-rich, as expected from other animal taxa. Length-variable regions were not numerous or complex, and alignments of the 18S (1748 bp) and 28S (3170 bp) gene sequences were straightforward. The 16S fragment had proportionately more length-variable regions and substitutions, leading to reduction during editing to 454 total nucleotides. All MrBayes runs converged well and, with sufficient generation numbers, produced nearly normally distributed parameter estimates via TRACER (Rambaut and Drummond 2009). The ML and MP analyses are summarised in conjunction with the three gene dataset results below. The separate 18S and 28S gene analyses (Figs 1 and 2 respectively) returned similar topologies, differing in only one or two placements. The 18S gene tree (Fig. 1) indicates that the Crassiclitellata (clade posterior probability PP = 0.80) is sister to the Moniligastridae (PP = 1.0), and that these two groups form a clade (PP = 1.0) (the Metagynophora of Jamieson 1988) nested within the other Clitellata. Haplotaxis gordioides (Hartmann, 1821) is the sister to this clade, butwith no support (PP = 0.53), so it is better to consider the basal relationships within Clitellata as unresolved. In a compromise dictated by our having full data for an enchytraeid, but not Haplotaxis, all other trees were rooted with the Enchytraeidae. In the following summary of results, all node labels refer to the same bipartitions across the trees. The 28S gene tree (Fig. 2) has a modestly well supported Crassiclitellata (node A, PP = 0.94). In the 18S + 28S combined analysis (Fig. 3) the main body of Crassiclitellata, Moniligastridae, and the Sparganophilidae +Komarekionidae + Biwadrilidae +Kynotidae clade formed a basal tritomy, but all internal nodal posterior probabilitieswere high (>0.95)with a few exceptions. Nodal support was slightly higherwith 18S alone and 28S alone. Weak nodes within the Crassiclitellata, regardless of the inclusion of the 16S gene (included in Fig. 4), were the same. Node B, connecting Sparganophilidae +Komarekionidae to Biwadrilidae +Kynotidae, has no support (PP< 0.80) in all combined analyses but has weak support in the 28S gene tree (PP = 0.88). The sister group relationship of Sparganophilidae and Komarekionidae is strong (node K, PP = 1.0) in all analyses. The sister-group relationship of Biwadrilidae and Kynotidae is strongly supported in the 28S gene tree (Fig. 2; PP = 1.0) but is unsupported in the combined analyses and the 18S gene tree. The Hormogastridae + Lumbricidae clade (Node D) has strong support in the 28S gene tree and the 18S + 28S combined analysis (Figs 2 and 3 Node D; PP = 1.0) in whichHemigastrodrilus is the sister taxon to the Lumbricidae (Figs 2 and 3; PP> 0.98). In these two trees the Hormogastridae is paraphyletic, but in Fig. 4 the placement of Hemigastrodrilus is unresolved. The only other node with PP < 0.9 in all analyses is node G connecting the Almidae as sister taxon to all higher-branching clades. Except for the basally placed branches leading to the Sparganophilidae +Komarekionidae +Biwadrilidae +Kynotidae group and the Lumbricidae +Hormogastridae +Criodrilidae, most other nodes (E to J) lead to a single-family lineage split from the main lineage, with uppermost diverging families Megascolecidae, Acanthodrilidae and ‘Octochaetidae’ (marked with asterisks) and Benhamiinae grouping as closely related. The Acanthodrilidae is paraphyletic by the nesting ofMegascolecidae within an Acanthodrilidae (s.l.) clade. The 28S gene tree (Fig. 2) had a monophyletic Megascolecidae (Node M, PP = 1.0) and a paraphyletic Acanthodrilidae composed of a polytomy. Within the acanthodriline worms a more resolved topology was obtained from the combined analyses (Fig. 3, 18S + 28S; Fig. 4, 18S + 28S + 16S), consisting of the Benhamiinae (Node L, PP = 0.87 or PP = 1.0 respectively in Figs 3 and 4), a NewWorld 218 Invertebrate Systematics S. W. James and S. K. Davidson http://www.phylo.org/portal2/ http://www.phylo.org/portal2/
  • acanthodriline clade (PP = 1.0; Diplocardia, Neotrigaster) and a Southern Hemisphere acanthodriline clade (PP = 1.0; Diplotrema, Acanthodrilidae sp. from Madagascar). The ML analysis of the full dataset in RAxML returned a topology virtually identical to that of the Bayesian analysis (Fig. 4), with one exception, that Biwadrilus was placed as the sister to the clade (Kynotus (Komarekiona (Sparganophilus))) rather than as sister to Kynotus. However, in both ML and Bayesian analyses the nodes involved (node B and neighbouring node) are unresolved. In all other nodes on the ML tree support values are comparable to or lower than those of the Bayesian analysis, and are included on Fig. 4. MP analyses in PAUP* and TNT returned a topology strongly supportive of the Crassiclitellata (Fig. 5; 99.8% and 100%, PAUP* and TNT respectively) and of the family-level groups indicated in Fig. 4, but with poor resolution of the basal relationships among families or sets of families. The PAUP* tree was 6906 steps long, compared to the 6834 steps from TNT but the topologies were the same, allowing for consensus tree collapse of nodes of 150: Kass and Raftery 1995) for the null hypothesis given by the unconstrained trees (Table 3) compared with the trees given by the analyses constrained for the classifications of Sims (1980) and Omodeo (2000). Omodeo’s superfamily Lumbricoidea includes Glossoscolecidae among others in the Sims Glossoscolecoidea, as well as his expanded Criodrilidae (Omodeo 2000). The other constraint in the Omodeo trees was to enforce monophyly of the Eudrilidae +Moniligastridae, in keeping with his hypothesis (Omodeo 2000) that the Crassiclitellata is polyphyletic at least by the independent origin of theEudrilidae fromMoniligastridae- like ancestors.With a BF of 68.52, Omodeo’s concept is strongly rejected in favour of that of Sims, but both are inferior to the unconstrained tree. Discussion Clitellata relationships The resolution of the Crassiclitellata based on our expanded set of gene characters also contributed a little to understanding of the broader Clitellata relationships. The 18S rRNA gene tree offers strong support for the Moniligastridae as the sister taxon to the Crassiclitellata, and thus for the monophyly of the Metagynophora of Jamieson (1988). Erséus and Källersjö (2004) and Siddall et al. (2001) had essentially the same result, monophyly of Metagynophora, without any moniligastrids in their datasets. Erséus and Källersjö (2004) and Siddall et al. 1.0 1.0 1.0 1.0 0.74 0.570.61 0.53 1.0 1.0 0.80 1.0 1.0 1.0 1.0 1.0 1.0 0.90 0.67 0.80 1.0 0.64 0.83 0.86 1.0 1.0 0.99 1.0 Branchiobdellida Hirudinida Lumbriculidae Acanthobdellida Enchytraeidae Proppapus volki Phreodrilidae Tubificidae Eudrilidae Benhamiinae Ocnerodrilidae Acanthodrilidae Megascolecidae Glossoscolecidae Almidae "Glossoscolecidae" Lutodrilidae Criodrilidae Lumbricidae Hormogastridae Ailoscolecidae Microchaetidae Kynotidae Komarekionidae Sparganophilidae Biwadrilus bathybates Moniligastridae Capilloventer australis Haplotaxis gordioides 0.03 Fig. 1. 18S gene tree Bayesian phylogram showing relationships among earthworm families. Branch lengths are drawn proportional to the expected number of substitutions per site and measured with the scale bar. Numbers above nodes are posterior probabilities. Molecular phylogeny of earthworms Invertebrate Systematics 219
  • 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 0.95 1.0 0.88 1.0 1.0 1.0 1.00.64 0.55 1.0 0.64 0.94 0. 92 0.93 0.74 1.0 1.0 1.0 1.0 1.0 1.0 1. 0 1.0 1. 0 0.98 0.95 0. 85 0.91 0.99 0. 94 1.0 1.0 0.72 1.0 1.0 1.0 0.90 0.95 0.59 1.0 0. 1 1.0 0.96 0.78 1.0 1.0 0.99 0.52 0.89 72. 0 0.75 0.99 1.0 0.97 0.95 A B C D E F H G I J Drawida sp. w Drawida sp. br Drawida sp. bl Sparganophilus sp. G1 Sparganophilus sp. L Sparganophilus sp. G2 Komarekiona eatoni Kynotus sp. w1 Kynotus sp. w2 Kynotus sp. r2 Kynotus sp. r1 Biwadrilus bathybates Tritogenia lunata Proandricus thornvillensis Microchaetus papillatus Geogenia pandoana Estherella sp. Goiascolex sp. Andiorrhinus sp. Urobenus brasiliensis Rhinodrilus sp. Pontoscolex spiralis Atatina sp. "Glossoscolecidae" Glossoscolecidae KK K Polytoreutus finni Hyperiodrilus africanus Eudriloides sp. Hyperiodrilus sp. Ocnerodrilidae sp. Ocnerodrilidae sp. Kerriona sp. Nematogenia sp. Gordiodrilus elegans Terriswalkerius sp. Archipheretima pandoana Pheretima sp. Perionyx excavatus Perionyx sp. MG Arctiostrotus sp. Driloleirus sp. Toutellus sp. Neotrigaster rufa* Diplocardia conoyeri Dichogaster sp. Fiji* Dichogaster sp. Dom* Dichogaster saliens* Dichogaster sp. Kenya* Dichogaster sp. Gabon* Benhamia sp.* Millsonia sp.* Parachilota sp. Diplotrema sp. Acanthodrilidae sp. MG Benhamiona sp.* Fimoscolex sp. Glossoscolex paulistus Glossodrilus sp. Glyphidrilus sp. Alma sp. Enchytraeidae sp. 0.04 Hemigastrodrilus monicae Allolobophora mehadiensis Lumbricus polyphemus Eisenoides carolinensis Bimastos zeteki Octodrilus complanatus Zophoscolex zhangi Hormogaster gallica Vignysa popi Ailoscolex lacteospumosus Benhamiinae Benhamiinae M L Fig. 2. 28S gene tree Bayesian phylogram showing relationships among earthworm families. Branch lengths are drawn proportional to the expected number of substitutions per site and measured with the scale bar. Numbers above nodes are posterior probabilities.Node labels are consistent acrossFigs2–4.Taxamarkedwith anasterisk (*) are theOctochaetidaeof someauthorities. 220 Invertebrate Systematics S. W. James and S. K. Davidson
  • Diplotrema sp. AUS Dichogaster sp. Fiji* Dichogaster saliens* Dichogaster sp. Kenya* Dichogaster sp. Gabon* Benhamia sp. Ghana* Millsonia sp. Ghana* Acanthodrilidae sp. MG Diplocardia conoyeri Neotrigaster rufa* Hemigastrodrilus monicae Allolobophora mehadiensis Lumbricus polyphemus Eisenoides carolinensis Bimastos zeteki Octodrilus complanatus Zophoscolex zhangi Hormogaster gallica Ailoscolex lacteospumosus 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 0.6 0.81 0.95 0.91 0.98 0.67 1.0 0.99 0.86 1.0 1.0 0.98 1.0 1.0 1.0 0.89 1.0 1.0 1.0 1.0 1.0 0.79 1.0 0.99 1.0 1.0 0.70 0.88 0.87 0.88 1.01.0 1.0 1.0 0.03 1.0 1.0 1.0 0.98 39.0 Vignysa popi Terriswalkerius sp. Archipheretima pandanophila Pheretima sp. Arctiostrotus sp. Driloleirus sp. Ocnerodrilidae sp. Kerriona sp. Nematogenia sp. Gordiodrilus elegans Polytoreutus finni Eudriloides sp. Hyperiodrilus sp. Hyperiodrilus africanus Fimoscolex sp. Glossoscolex paulistus Glossodrilus sp. Alma sp. Glyphidrilus sp. Atatina sp. Urobenus brasiliensis Pontoscolex spiralis Andiorrhinus sp. Estherella sp. Geogenia pandoana Microchaetus papillata Proandricus thornvillensis Tritogenia lunata Drawida sp. bl Drawida sp. br Drawida sp. w Sparganophilus sp. G Sparganophilus sp. L Komarekiona eatoni Kynotus sp. w Kynotus sp. wl Kynotus sp. r Biwadrilus bathybates B K C D E F G H I J L M Enchytraeidae sp. Fig. 3. 18s + 28S partitioned analysis Bayesian phylogram showing relationships among earthworm families. Branch lengths aredrawnproportional to the expectednumberof substitutionsper site andmeasuredwith the scale bar. Numbers above nodes are posterior probabilities. Taxa marked with an asterisk (*) are the Octochaetidae of some authorities. Molecular phylogeny of earthworms Invertebrate Systematics 221
  • (2001) found the Enchytraeidae to be the sister to Crassiclitellata, based on 18S rRNA andmt COI genes. However, these analyses did not include the Moniligastridae, nor did they have broad sampling within earthworms. In our trees including additional Clitellata we see that Enchytraeidae are nested within a clade that joins a basal polytomy in the Clitellata. However, this is not a Hemigastrodrilus monicae Allolobophora mehadiensis Lumbricus polyphemus Eisenoides carolinensis Octodrilus complanatus Zophoscolex zhangi Hormogaster gallica Criodrilus lacuum LUMBRICIDAE Sparganophilus sp. G Sparganophilus sp. L Komarekiona eatoni Kynotus sp. w Kynotus sp. wl Kynotus sp. r Biwadrilus bathybates SPARGANOPHILIDAE KYNOTIDAE KOMAREKIONIDAE CRIODRILIDAE BIWADRILIDAE MONILIGASTRIDAE Drawida sp. bl Drawida sp. br Drawida sp. w HORMOGASTRIDAE Geogenia pandoana Microchaetus papillatus Proandricus thornvillensis Tritogenia lunata MICROCHAETIDAE Dichogaster sp. Kenya* BENHAMIINAE* Acanthodrilidae sp. MG Neotrigaster rufa* Terriswalkerius sp. Archipheretima pandanophila Pheretima sp. Arctiostrotus sp. Driloleirus sp. MEGASCOLECIDAE Ocnerodrilidae sp. Kerriona sp. Nematogenia sp. Gordiodrilus elegans OCNERODRILIDAE Polytoreutus finni Hyperiodrilus africanus EUDRILIDAE Glossoscolex paulistus Glossodrilus sp. GLOSSOSCOLECIDAE Glyphidrilus sp. Urobenus brasiliensis Pontoscolex spiralis PONTOSCOLECIDAE ALMIDAE Enchytraeidae sp. B K A D C L M J I H G F E 1.0/59 1.0/97 1.0/70 1.0/ 85 1.0/60 1.0/69 1 .0 98 1.0/ 94 1.0 100 1.0 100 1 1.0 100 1.0 100 1.0 100 1.0 100 1.0 100 1.0 100 1.0/ 84 1.0/ 92 1.0/ 86 1.0/89 1.0/90 1.0/94 1.0/ 97 0.92/58 0.84/52 0.63/ 42 0.99/92 0.93/ 60 0.57/56 0.98/76 0.90/65 0.66/ 65 0.58/na 0.64/na 0.52/16 Andiorrhinus sp. ACANTHODRILIDAE ACANTHODRILIDAE 0.90/ 46 Atatina sp. Estherella sp. Alma sp. Fimoscolex sp. Hyperiodrilus sp. Eudriloides sp. Diplocardia conoyeri Diplotrema sp. AUS Dichogaster sp. Gabon* Dichogaster sp. Fiji* Dichogaster saliens* Millsonia sp. Ghana* Benhamia sp. Ghana* Ailoscolex lacteospumosus Vignysa popi Bimastos zeteki 1.0 100 1 .0 100 1.0/86 1.0 100 1.0 100 1.0 100 1.0 100 0.99/77 1.0 100 1.0 100 1.0 1001.0 100 0.97/68 0.90/54 1.0 100 1.0/100 1.0 100 1.0 99 0.07 Fig. 4. 18S+ 28S+ 16SpartitionedanalysisBayesianphylogramshowing relationships amongearthworm families.Branch lengths are drawn proportional to the expected number of substitutions per site andmeasured with the scale bar. Numbers above nodes are posterior probabilities/bootstrap support from RAxML analysis. Taxa marked with an asterisk (*) are the Octochaetidae of some authorities. 222 Invertebrate Systematics S. W. James and S. K. Davidson
  • definitive placement of the Enchytraeidae, and the relationships within Clitellata are quite unresolved. This analysis also provides no support for the classical hypothesis that the Crassiclitellata are derived from theHaplotaxidae. The ordinal taxonHaplotaxida, as presently understood, could be polyphyletic and should be provisionally abandoned in favour of the Metagynophora, which is supported. Relationships within the Crassiclitellata The superfamilies The phylogenetic hypotheses presented here (Figs 2–5) support some long-held relationships within earthworms, and reject others, while providing support for one new family-level taxon discussed below. Omodeo’s (2000) hypothesis, based on Enchytraeidae sp. Drawida sp. w Drawida sp. br Drawida sp. bl Glyphidrilus sp. Alma sp. Estherella sp. Andiorrhinus sp. Urobenus brasiliensis Pontoscolex spiralis Atatina sp. Hormogaster gallica Vignysa popi Hemigastrodrilus monicae Ailoscolex lacteospumosus Allolobophora mehadiensis Zophoscolex zhangi Lumbricus polyphemus Eisenoides carolinensis Bimastos zeteki Octodrilus complanatus Criodrilus lacuum Sparganophilus sp. G Sparganophilus sp. L Komarekiona eatoni Kynotus sp. w Kynotus sp. r Kynotus sp. wl Biwadrilus bathybates Proandricus thornvillensis Microchaetus papillatus Geogenia pandoana Tritogenia lunata Eudriloides sp. Hyperiodrilus africanus Polytoreutus finni Hyperiodrilus sp. Ocnerodrilidae sp. Nematogenia sp. Kerriona sp. Gordiodrilus elegans Archipheretima pandanophila Pheretima sp. Terriswalkerius sp. Arctiostrotus sp. Driloleirus sp. Neotrigaster rufa Diplocardia conoyeri Acanthodrilidae sp. MG Diplotrema sp. AUS Dichogaster sp. Fiji Dichogaster sp. Gabon Dichogaster sp. Kenya Dichogaster saliens Benhamia sp. Ghana Millsonia sp. Ghana Fimoscolex sp. Glossoscolex paulistus Glossodrilus sp. 100 100 96 97 100 100 64 52 71 49 99 100 94 94 82 77 99 99 99 99 87 87 54 49 83 67 98 98 51 5100 100 77 70 79 80 82 71 50 33 80 72 100 100100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 62 54 88 88 97 98 73 49 62 44 94 97 76 79 100 10098 98 68 76 52 32 96 97 83 93 85 94 87 83 99 100 71 68 62 54 Fig. 5. 18S+ 28S+ 16S maximum parsimony analysis in PAUP* and TNT. Branch lengths are not to scale. Nodal support values are bootstrap percentages (PAUP*) above the branches and symmetric resampling percentages (TNT) below the branches. Molecular phylogeny of earthworms Invertebrate Systematics 223
  • morphological features, that Crassiclitellata are polyphyletic and originated from three non-crassiclitellate ancestors, is not supported, but neither is it firmly rejected given that support for the Crassiclitellata node is PP = 0.80 in Bayesian analysis, but near 100% in MP. Nevertheless it would be hard to reconcile Omodeo’s hypothesis with the strongly supported internal nodes of the Crassiclitellata. There are only a few cases for ranks above family level. Sims’ Megascolecoidea is a monophyletic group, and includes Eudrilidae, Ocnerodrilidae, Megascolecidae, Acanthodrilidae and Octochaetidae. Two of the polyfamilial superfamilies defined by Sims (1980) were rejected by Bayes Factor comparisons with an unconstrained tree. Unsupported superfamilies included the Glossoscolecoidea, which grouped Almidae, Glossoscolecidae, Kynotidae and Microchaetidae by ovarian morphology. Instead, the Kynotidae appear basally (Bayes) or unresolved (ML, MP) in a group with the Komarekionidae, Sparganophilidae and Biwadrilidae. The Microchaetidae is closest to the Lumbricidae/Hormogastridae clade and does not appear within the Glossoscolecoidea regardless of ovarian morphology. If mapped onto the trees given in Fig. 3 or 4, the defining state of the ovarian morphology must have been lost three times, or evolved independently twice and lost once. The two scenarios are equally parsimonious. Sims’ Lumbricoidea included the Sparganophilidae and Komarekionidae, which by unconstrained analyses are not in a clade with the Lumbricidae and his other Lumbricoidea. A revised Lumbricoidea should include the Lumbricidae, Hormogastridae, Ailoscolecidae, Criodrilidae and Lutodrilidae. The superfamily Criodriloidea is nested within the revised Lumbricoidea, and the Biwadriloidea has an unresolved position close to Kynotidae, Sparganophilidae andKomarekionidae. Therefore these twovery small superfamilies should be disregarded. Small basal crassiclitellate families The Sparganophilidae, Komarekionidae, Biwadrilidae and Kynotidae (Node B) form a group of relict families that appears as sister to all other earthworms, although the sister relationship is without strong support in any analyses except the 18s gene tree (Fig. 1, PP = 0.92). The node is absent in theML and MP analyses because Biwadrilidae is placed as sister to the remaining three. If this holds up in future analyses, it refutes several previous placements of these families. A notable example is the placement of themonotypic Japanese Biwadrilidae as sister taxon of Kynotidae (a Madagascar endemic), which previously was hypothesised to be allied to Microchaetidae and Glossoscolecidae. Kynotidae is excluded from a close relationship with Microchaetidae by the strong support (PP = 1.0) for Nodes C and E, but its placement in relation to the Biwadrilidae is unresolved, as is the placement with regard to the clade composed of Sparganophilidae and Komarekionidae (Node K, PP = 1.0). Biwadrilidae and Kynotidae were considered close in the morphological analysis of Jamieson (1988). Given the large geographic disjunction between Japan and Madagascar, Biwadrilidae and Kynotidae could be relicts of taxa longvanished fromother land areas.Consistently, butwith no support, they are close to the families Sparganophilidae and Komarekionidae. Biwadrilus was moved from the Criodrilidae to its own family Biwadrilidae by Jamieson (1971), and later returned to the Criodrilidae by Blakemore (2006). According to our molecular data analyses, the Criodrilidae is sister to the Lumbricidae +Hormogastridae clade. Therefore we remove Biwadrilidae from the synonymy of Criodrilidae. The placement of the Sparganophilidae as the sister taxon of Komarekionidae is strongly supported by our data and by Jamieson et al. (2002). Sparganophilidae are mud-dwelling worms of fresh water margins and lake bottoms, while Komarekiona eatoni Gates, 1974 lives in mesic forest soils of the central Appalachian Mountains. Sparganophilidae has variously been placed in an expanded concept of the Glossoscolecidae (e.g. Jamieson 1971) or within a superfamily Lumbricoidea (Sims 1980; Qiu and Bouché 1998; Omodeo 2000). However, these placements are not supported by the molecular data, and neither is the hypothesised synonymy of Komarekionidae and Ailoscolecidae by Sims (1980) and Qiu and Bouché (1998). Instead, Komarekionidae is quite phylogenetically distant from Ailoscolecidae (their common ancestor is the common ancestor of the Crassiclitellata clade), the latter nested within the Hormogastridae with strong support (Node D; PP = 1.0). Certain morphological similarities of Komarekiona eatoni to Ailoscolex lacteospumosus Bouché, 1969, have contributed to ambiguity in estimating the relatedness of these two families. K. eatoni differs in the location of its single esophageal gizzard as compared to the two of Ailoscolex, but is similar in having many small prostatoid glands (possibly non-homologous to the Ailoscolex glands) associated with the ventral setae in the reproductive segments. Many other earthworms have glands associated with setae used in copulation, so this could be parallel evolution and not a uniting character. The two species are completely unlike one another in general aspect and ecology. K. eatoni is an unpigmented earthworm of unremarkable appearance and lives as an epiendogeic in forest soils, while A. lacteospumosus is very delicate, short and thick, and appears to inhabit deeper soil layers exclusively. A revised Lumbricoidea As mentioned above, a new concept of Lumbricoidea should include Ailoscolecidae, Lumbricidae, Hormogastridae, Criodrilidae and, tentatively, Lutodrilidae. The inclusion of Ailoscolecidae within the Lumbricidae–Hormogastridae– Table 3. Bayes factor comparisons of 18S + 28S trees constrained for suprafamilial concepts of Sims (1980) or the suprafamilial concepts and Crassiclitellata polyphyly of Omodeo (2000) Each cell value was calculated by subtracting the total harmonic mean likelihood score of the row constraint analysis (null hypothesis) from a column constraint analysis. Only positive values are shown Alternate hypothesis Null hypothesis Sims constraints Omodeo constraints Unconstrained Sims constraints 0 68.52 – Omodeo constraints – 0 – Unconstrained 165.55 234.14 0 224 Invertebrate Systematics S. W. James and S. K. Davidson
  • Criodrilidae (Node D), instead of being allied with Komarekionidae, is strongly supported by the molecular data. There is morphological support for this placement as well, the Ailoscolecidae and Hormogastridae differing mainly in the presence of prostatoid glands in the former, and of a rudimentary intestinal gizzard in the latter (Sims 1980; Omodeo 2000). Hormogastridae and Lumbricidae are usually considered closely related and both are European (except for two NorthAmerican lumbricid genera,Eisenoides andBimastos, both in the taxon sample). The hormogastrid genus Hemigastrodrilus is placed as sister to the Lumbricidae, with weak nodal support, but consistently across many analyses. This placement would render the Hormogastridae paraphyletic, and so would the retention of family status for the Ailoscolecidae. On the basis of our results, we advocate placing Ailoscolecidae in the synonymy of Hormogastridae. Stephenson (1930) suggested a relationship between the Lumbricidae and Criodrilidae, which is consistent with the molecular data analysis placing Criodrilidae as sister to the Hormogastridae +Lumbricidae (Figs 3 and 4), but conflicts with placement of Criodrilus in Almidae (Jamieson 1988). Qiu and Bouché (1998) considered Criodrilus lacuum Hoffmeister, 1845 a hormogastrid secondarily adapted to aquatic life. The topology does not support the implied evolutionary history because Criodrilus is placed basal to the Hormogastridae. With only partial sequence data for C. lacuum, the grouping of C. lacuumwith the Lumbricidae andHormogastridae is tentative, but strongly supported and unlikely to change with additional sequence data. The South African Microchaetidae is most closely related to the Lumbricoidea as defined here and sister to all higher-placed families. Within the Microchaetidae, Tritogenia is basal to the other sampled genera, and is morphologically distinct from other Microchaetidae by having multiple nephridia per segment (meronephric) and having an unusually short, thick body form. A revised Megascolecoidea The superfamily Megascolecoidea (sensu Sims 1980), containing the Megascolecidae, Octochaetidae, Acanthodrilidae, Eudrilidae and Ocnerodrilidae, is a monophyletic group (nodal support >0.9 except in MP analyses) but with internal relationships that demand further consideration. The only character known to be constant across the Megascolecoidea is the shape of the ovaries (Sims 1980). This could be a synapomorphy uniting the families in Sims’ concept of the superfamily but we prefer to examine the morphological and genetic data independent of any superfamily concept. Stephenson (1930) considered the Eudrilidae to have been derived from megascolecoid ancestors, but several morphological features and the phylogenies strongly suggest that the reverse is true (Figs 2–4). The findings indicate that ancestors of the Eudrilidae diverged before the emergence of the Megascolecidae +Acanthodrilidae +Ocnerodrilidae clade, undermining the doubtful homology of certain eudrilid features to those of the Megascolecoidea. The eudrilid euprostates, for example, are implied as homologous to the prostates of other megascolecoid families, but have a distinct structure from the other prostate glands found in the rest of the Megascolecoidea. In contrast to the megascolecid and acanthodrilid glandular prostates connected to the exterior by a duct, the eudrilid euprostates have large muscular ejaculatory bulbs with resemblance to the copulatory sacs or pouches in Glossoscolex of Glossoscolecidae. These ejaculatory structures of Eudrilidae and Glossoscolecidae both have the male ducts joining the muscular bulb. Their similarities indicate a close relationship between the Glossoscolecidae and the Eudrilidae, as noted by Benham (1895). The more likely hypothesis is that the prostate glands of Acanthodrilidae, Octochaetidae, Megascolecidae and Ocnerodrilidae are an innovation arising on the way to Node J. In addition to the euprostates, paired dorsal calcium carbonate glands are found in one of segments 12 or 13 in both Eudrilidae and Glossoscolecidae. In both families the glands have complex internal tubules. Furthermore, there are structures in Glossoscolex and Fimoscolex that have possible homologues of the complex ovarian and spermathecal systems of Eudrilidae, including modified septa surrounding segment 13, with pouches containing spermatozoa-like material (Bartz et al. in press), and flat subneural sacs on the body wall in segments 13–14 of a Fimoscolex sp. These morphological data complement the molecular data, suggesting a close relationship of the Glossoscolecidae to the Eudrilidae. As would be expected from the phylogenies, the Ocnerodrilidae shares morphological characters with the Eudrilidae, but also with the megascolecid–acanthodrilid group. The Eudrilidae (Paraeudrilinae) lacks the paired dorsal esophageal glands in the area of segments 12 and 13, as does the Ocnerodrilidae, a possible indication of affinity. Both the Eudrilidae and Ocnerodrilidae have suboesophageal sacs in some or all of segments 9–11, of very similar form. These are paired in most, but not all, Ocnerodrilidae, and unpaired in the Eudrilidae. Beddard (1895) thought there might be a close relationship between these two taxa. However, Eudriloides, the one paraeudriline genus in the taxon sample, is no closer to the Ocnerodrilidae than the other Eudrilidae included. It is possible that the Paraeudrilinae is polyphyletic, and by chance we obtained a genus that is more distant to the Ocnerodrilidae. Additional sampling is needed to test the hypothesis that the Ocnerodrilidae is sister taxon to at least some of the Paraeudrilinae. The Ocnerodrilidae and Eudrilidae are likely to have diverged long ago. The Ocnerodrilidae occur naturally in South America, Africa and India, suggesting that the family diverged from the common ancestor with Eudrilidae well before the break-up of Gondwana. As was the case in Stephenson’s (1930) derivation of the Eudrilidae from megascolecoids, Michaelsen’s (1935) hypothesis that the Eudrilidae is derived from Ocnerodrilidae is rejected by the placement of Eudrilidae basal to the Ocnerodrilidae–Megascolecidae–Acanthodrilidae clade, a placement in agreement with recent and traditional phylogenies. Amore limitedMegascolecoidea consisting ofOcnerodrilidae, Octochaetidae, Acanthodrilidae and Megascolecidae was proposed by Omodeo (2000). Here we support Omodeo’s limited concept of Megascolecoidea, but with the elimination of the Octochaetidae. Besides the ovarian morphology cited by Sims (1980), an apparent synapomorphy of this superfamily is the presence of prostate glands associated with the male pores, and Molecular phylogeny of earthworms Invertebrate Systematics 225
  • together present a variety of male genital fields characterised as acanthodrilin (plus the reduced versions microscolecin and balantin) or megascolecin. The Ocnerodrilidae is separated from the other three families by the latter having a pair of hearts in segment 12 (and often 13), the relocation of the segment of intestinal origin to 15 or later, and the loss of the ocnerodrilin calciferous glands. The problematic Acanthodrilidae, Megascolecidae and Octochaetidae The remaining three megascolecoid families have been problematic in the history of earthworm systematics. From here on, let it be clear that we advocate an Acanthodrilidae sensu latu that corresponds to the Acanthodrilinae sensu Jamieson (2000, 2001) and Jamieson and Ferraguti (2006). This concept of Acanthodrilidae combines the Acanthodrilidae, Octochaetidae and Exxidae Blakemore, 2000. In the taxon sample, Octochaetidae is indicated by asterisks (*) in Table 1 and the figures. The Exxidae is a subset of these, here represented by Neotrigaster rufa. Both the Octochaetidae and Exxidae will be lumped into the Acanthodrilidae in the following discussion. The Megascolecidae is either sister to the Acanthodrilidae (Jamieson et al. 2002; Buckley et al. 2011) or nested within the Acanthodrilidae (Figs 2–5). Within the megascolecid and acanthodrilid genera, Figs 3 and 4 show four well supported clades, one composed of meronephric Benhamiinae (sensu Csuzdi 1996), one composed of the Megascolecidae (sensu Blakemore 2000) or Megascolecinae sensu Jamieson and Ferraguti (2006), and two others being variously composed of other Acanthodrilidae and either Octochaetidae or Exxidae. Even thoughwe did not havematerial from the diverse ‘Octochaetidae’ of the Indian subcontinent, it is clear that the Octochaetidae, as usually defined, is polyphyletic, and the family was rejected by Dyne and Jamieson (2004). Within the taxon set of this paper, Octochaetidae is represented by the Benhamiinae (Node L, PP�0.87) and Neotrigaster rufa (unless one places it in the Exxidae), which falls in a sparsely sampled New World clade (PP = 1.0) with Diplocardia conoyeri Murchie, 1961 (Acanthodrilidae s.l.). Buckley et al. (2011) has a polyphyletic Octochaetus, the type genus of the (meronephric) Octochaetidae, placed within a clade of holonephric New Zealand Acanthodrilidae. Therefore, if the Octochaetidae is to be retained, it could be restricted to a part of Octochaetus. Neotrigaster has been transferred by Blakemore (2000) to Exxidae, a family erected to remove acanthodrilin worms with racemose prostates and multiple nephridia from the Octochaetidae. We will return to the Exxidae question below. Buckley et al. (2011) had the same placement of Benhamiinae in relation to the other Acanthodrilidae as we have here, as the sister taxon to all other Acanthodrilidae (plus Megascolecidae in the present case) (Figs 3, 4), though the node was not supported by the less extensive dataset of Buckley et al. (2011). It may be premature to include the holonephric genera Neogaster, Omodeona, Pickfordia, Wegeneriella and Wegeneriona in Benhamiinae, because we do not have them represented in the taxon sample. Blakemore (2005) considers this inclusion by Csuzdi ‘unacceptable’ but gives no reasons for preferring the condition of the nephridia over the condition of the calciferous glands as indicators of phylogeny. The calciferous gland structure of thesefive genera is very similar to that of themeronephric genera in Benhamiinae. Multiplication of nephridia has taken place in several acanthodrilid and megascolecid lineages, suggesting that the character is not as stable as one might prefer for the basis of a classification. Given the consistent support for the monophyly of Benhamiinae, we favour the use of this subfamily name and it may merit elevation to family rank. There are two clades within the remaining sampled Acanthodrilidae, one of which is represented here by Australian, South African (Parachilota: Fig. 2 only) and Malagasy taxa, and the other by North American taxa. Neotrigaster rufa is a Puerto Rican endemic with multiple nephridia per segment and two pairs of racemose prostates discharging separately from the male pores, at the ends of seminal grooves (the acanthodrilin male field configuration). The nephridial character has been used to place Neotrigaster in the Octochaetidae, a decision our data do not support, because N. rufa is in a strongly supported (PP = 1.0) clade with Diplocardia. Blakemore (2000), in an attempt to deal with the combined acanthodrilin male field plus racemose prostate ‘problem’ posed by Exxus wyensis, erected the family Exxidae and transferred N. rufa and other acanthodrilid worms (mostly Neotropical) with racemose prostates to the Exxidae. Racemose prostates were a problem because they were previously known only from (some or all, depending on whose) Megascolecidae. It seems simpler to afford racemose prostates less weight, in recognition that evolution of complex prostates from simple ones has taken place several times in the history of megascolecoid earthworms. Therefore we propose to remove Neotrigaster and the related genera Trigaster and Zapatadrilus from the Exxidae, perhaps transferring them toa revivedDiplocardiinae (the revival, though differently constituted, also suggested by Blakemore (2005) – see below) and leave the status of the Exxidae until such time as someone actually finds a specimen of Exxus wyensis and obtains molecular data from it. A taxonomic solution suggested by Blakemore (2005) might be to resurrect the Diplocardiinae, which could include the North American Acanthodrilidae with multiple gizzards, including Diplocardia, but we would add at least the trigiceriate Neotrigaster and Trigaster (see Figs 3, 4 and Buckley et al. 2011). This leaves the question of what to do with the numerous, unsampled Acanthodrilidae of Mexico and central America, some of which do (e.g. Zapatadrilus, Zapotecia and Protozapotecia) and some of which do not (e.g. Larsonidrilus, Balanteodrilus, Ramiellona) have multiple gizzards. The Diplocardiinae concept we support includes meronephric and holonephric genera, in contrast to that indicated by Blakemore (2005), who would restrict it to holonephric genera. However the lack of data on Acanthodrilidae makes us cautious about further taxonomic rearrangements of acanthodrilid earthworms, pending sampling of more taxa, particularly Acanthodrilus. The Megascolecidae representatives in the taxon set were collected in the Philippines, Australia, and North America, each being endemic to its location. The attempts to provide stable diagnostic characters for the Megascolecidae have been fraught with problems. Sims (1980) and Csuzdi (2010) based the family on the racemose prostate glands without a central lumen, but this 226 Invertebrate Systematics S. W. James and S. K. Davidson
  • is not universally adopted nor is it supported here. One section of the Megascolecidae clearly does have racemose prostates, an Australasian clade including Pheretima, but its North American sister group does not. What they have in common is male and prostatic ducts united on segment 18, a character state that is not universal among the racemose prostate genera of Australasia. Several genera not included here (among them New Zealand Megascolides and Spenceriella) have tongue-shaped prostates without a central lumen but do not have externally evident branching, as is seen among the pheretimoid genera (Sims and Easton 1972) and some others. Gates (1972) advocated a distinction between racemose prostates of mesodermal origin (his Megascolecidae) and non-racemose prostates of ectodermal origin (his Acanthodrilidae +Octochaetidae). For the present we agree with Blakemore’s (2000) and Jamieson and Ferraguti’s (2006) Megascolecidae (-inae) concept, which includes diverse prostate gland types, whose ducts generally are joined by the sperm ducts in combined male and prostatic pore(s) on segment 18 or nearby. It seems rather obvious that the evolution of prostate glands in the Megascolecidae and Acanthodrilidae (s.l.) has been more complex than convenient to taxonomists. Any modifications of the Megascolecidae are prevented by our lack of material from South Asia, where there are many Megascolecidae, including the type genus Megascolex. Revising the Glossoscolecidae A salient departure from traditional classification is the strong support for a polyphyletic Glossoscolecidae, indicated in Figs 2 and 3 with the family containing the type genus, Glossoscolex Leuckart, 1835, remaining as Glossoscolecidae, but the other glossoscolecid clade indicated as ‘Glossoscolecidae’. The Almidae, removed from the Microchaetidae by Jamieson (1988), is closely related to both the Glossoscolecidae and the ‘Glossoscolecidae’, but the topology obtained in all analyses is one of two most parsimonious solutions to the evolution of calcium carbonate glands and male terminalia in the Glossoscolecidae (s.s) and the Eudrilidae. The Glossoscolecidae type of calcium carbonate gland and male terminalia are lacking in the Almidae and ‘Glossoscolecidae’. An equally parsimonious dichotomous tree would have the ‘Glossoscolecidae’ as sister taxon to the Almidae. The two divisions of the former Glossoscolecidae are distinct, well supported clades (nodal support values > 0.99), as is the Almidae. This division is supported by morphological distinctions as well. The Glossoscolecidae sensu strictu share the form and placement of paired esophageal calcium carbonate glands plus the presence of conspicuous male pores, usually with muscular ejaculatory bulbs commonly called copulatory pouches. Typhlosolar development typically does not involve a very deep simple lamina, but complex folding of a more compact lamina. The ‘Glossoscolecidae’ is more diverse in esophageal calcium carbonate gland number and structure, the male pores are minute and superficial, or within an intramural invagination, and never with the muscular bulbs. If a typhlosole is present it typically consists of an S-curved (in transverse section) lamina that can exceed the intestinal diameter in depth. For these reasons we propose a new family as follows: Family PONTOSCOLECIDAE James, 2012, fam. nov. Type genus: Pontoscolex Schmarda, 1861. Type species: Lumbricus corethrurus Müller, 1857. Definition Crassiclitellata with one oesophageal gizzard in vi; paired, extramural calciferous glands in some or all of segments vii–xiv; typhlosole ribbon-shaped, variously folded or pouched. Vascular system, with dorsal and ventral trunks, supraoesophageal trunk, paired extraoesophageal trunks median to the hearts, subneural vessel adherent to body wall. Holonephrida stomate, vesiculate in intestinal region. Dorsal pores lacking. Spermathecae, adiverticulate, in front of the gonadal segments. Male pores behind female pores, microscopic if primary; or if macroscopic then connected to intramural copulatory chambers. Included genera Aicodrilus,Alexidrilus,Andiodrilus,Andiorrhinus,Andioscolex, Annadrilus, Anteoides, Anteus, Aptodrilus, Atatina, Aymara, Botarodrilus, Bribri, Chibui, Cirodrilus, Diachaeta, Estherella, Eudevoscolex, Goiascolex, Hexachyloscolex, Inkadrilus, Langioscolex, Maipure, Martiodrilus, Meroscolex, Nouraguesia, Onoreodrilus, Onychochaeta, Opisthodrilus, Periscolex, Perolofius, Pontoscolex, Pseudochibui, Quimbaya, Randdrilus,Rhinodrilus,Tairona,Tamayodrilus,Thamnodriloides, Thamnodrilus, Tuiba, Tupinaki, Urobenus, Zongodrilus. Pontoscolex is the oldest described genus in the family and contains themost commonmember of the family,P. corethrurus. This species is among the most common earthworms in tropical climates, having been introduced accidentally to all tropical climate regions. Family GLOSSOSCOLECIDAE Michaelsen, 1900; emend. James 2012 Type genus: Glossoscolex Leuckart, 1835 Type species: Glossoscolex giganteus Leuckart, 1835 Definition Crassiclitellata with one esophageal gizzard in vi; a single pair of extramural calciferous glands of intertwined tubular type in segment xi or xii, typhlosole topologically a blade, but with an anterior section in which zig-zag folds have been ventrally fused and folded over to form lateral pockets. Vascular system, with dorsal and ventral trunks, a supraoesophageal trunk, paired extraoesophageal trunks median to the hearts, and a subneural adherent to the body wall. Holonephrida stomate, vesiculate in intestinal region. Dorsal pores lacking. Spermathecae, when present, adiverticulate and in front of the gonadal segments. Male pores, behind female pores, macroscopic and then connected to intracoelomic muscular ejaculatory bulbs that receive the vasa deferentia. Included genera Diaguita,Enantiodrilus,Fimoscolex,Glossodrilus,Glossoscolex, Holoscolex, and Righiodrilus. This restricted sense of Glossoscolecidae is exclusively South American except for a few Glossodrilus outliers in Central Molecular phylogeny of earthworms Invertebrate Systematics 227
  • America and the Caribbean islands Dominica and Martinique (Fragoso et al. 1995). Conclusion The followingobservationmadeover50years agodeserveswider circulation: ‘L’évolution n’a aucune raison de faciliter notre travail de classement’ – F. Grandjean (1954) (Evolution has no reason to facilitate our work of classification.) The molecular phylogenies we present here are a work in progress. We were fortunate to obtain reasonably well supported topologieswith a fewgenes and a limited but broad taxon sample. Within each of the diverse families, as opposed to the monogeneric ones, considerable additional taxon sampling is necessary to develop hypotheses about the phylogeny and patterns of morphological evolution within each group. Across all families, it will be useful to obtain additional sequence data from genes appropriate to the resolution of relatively deep branching points. The 28S gene appears to be quite useful in this regard but needs additional support from other loci. We have no easy way to calibrate a molecular clock for earthworms, there being no fossil record and only the coarse resolution of major tectonicmovements of the last 200million years. Regardless, it is apparent from a few pre- and post-Gondwanan vicariance events thatmost of the divergences in earthworms are quite old: Buckley et al. (2011) found thatwithin–NewZealand cladeswere as old as most continental clades, so minimally ~70million years within the New Zealand Acanthodrilidae. Therefore for resolutions among family levels, gene choice should focus on conserved protein-coding regions of the nuclear genome. This will be the focus of our future work on phylogeny of the Clitellata. Acknowledgments This research was funded by United States National Science Foundation Award DEB-0516439 (James) and 0516520 (Davidson). At the University of Kansas, Mike Grose of the Biodiversity Institute Molecular Phylogeny Laboratory gave us his full cooperation, as did Paulyn Cartwright, who generously provided laboratory space, and Daphne Fautin, who provided logistical support and leadership in the Division of Invertebrate Zoology. Danuta Plisko,Victor Pop,CsabaCsuzdi,MarcelBouché,Robert Blakemore, Tomas Pavlicek, Raylton Sumrall, Somsak Panha, Munir Abdullah Dawood, Alfonso Alonso of The Smithsonian Institution’s Gamba Protected Areas Project, Malalatiana Razafrindrakoto, George Brown, Nicolas Pinel, Pattana Somniyam, Barrie Jamieson and numerous other people provided assistance in diverse ways, such as organising and guiding collection trips, collecting specimens for us, or participating in field work with the first author in the extensive travel necessary to complete this research. All collecting was done under appropriate permits for the countries involved. Charlène Briard alerted us to the Grandjean (1954) quote. We dedicate this paper to Pietro Omodeo, with whose phylogenetic conclusions we respectfully disagree, but who is among the most kindly, generous and knowledgeable of men. References Akaike, H. (1973). Information theory as an extension of the Maximum Likelihood principle. In ‘Second International Symposium Information Theory’. (Eds N. Petrov and F. Csaki.) pp. 267–281. (Akademiai Kiado.) Bartz, M. L. C., James, S. W., Pasini, A., and Brown, G. G. (in press). New speciesofGlossoscolexLeuckart, 1835andFimoscolexMichaelsen, 1900 (Clitellata: Glossoscolecidae) from Northern Paraná, Brazil. Zootaxa. Beddard, F. E. (1895). ‘A Monograph of the Order Oligochaeta.’ xii + 769 pp. (Clarendon Press: Oxford.) Bely, A. E., and Wray, G. A. (2004). Molecular phylogeny of naidid worms (Annelida: Clitellata) based on cytochrome oxidase I. Molecular Phylogenetics and Evolution 30, 50–63. doi:10.1016/ S1055-7903(03)00180-5 Blakemore, R. J. (2000). ‘Tasmanian Earthworms.’ CD-ROM Monograph with Review of World Families. (VermEcology Kippax: Canberra.) Blakemore, R. J. (2005). Whither Octochaetidae? – its family status reviewed. In ‘Advances in Earthworm Taxonomy. II. Proceedings of the 2nd International Oligochaete Taxonomy Meeting’. (Eds A. A. and V. V. Pop.) pp. 63–84. (Cluj University Press: Romania.) Blakemore, R. J. (2006). Review of Criodrilidae (Annelida: Oligochaeta) including Biwadrilus from Japan. Opuscula Zoologica Budapest 37, 11–22. Blakemore, R. J. (2008). ‘Cosmopolitan Earthworms – an Eco-Taxonomic Guide to the Species.’ 3rd edn. (VermEcology: Yokohama, Japan.) Buckley, T. R., James, S., Allwood, J., Bartlett, S., Howitt, R., and Prada, D. (2011). Phylogenetic analysis of New Zealand earthworms (Oligochaeta: Megascolecidae) reveals ancient clades and cryptic taxonomic diversity. Molecular Phylogenetics and Evolution 58, 85–96. doi:10.1016/ j.ympev.2010.09.024 Csuzdi, C. (1996). Revision der Unterfamilie BenhamiinaeMichaelsen, 1897 (Oligochaeta: Acanthodrilidae). Mitteilungen aus dem Museum für Naturkunde in Berlin. Zoologisches Museum und Institut für Spezielle Zoologie (Berlin) 72, 347–367. doi:10.1002/mmnz.19960720219 Csuzdi, C. (2010). A monograph of the Paleotropical Benhamiinae earthworms (Annelida: Oligochaeta, Acanthodrilidae). Pedozoologica Hungarica 6, Hungarian Natural History Museum, Budapest. Dyne, G. R., and Jamieson, B. G. M. (2004). Native earthworms of Australia II (Megascolecidae, Acanthodrilinae). ABRS, Australian Government Department of Environment and Heritage. CD-ROM. Erséus, C. (2005). Phylogeny of oligochaetous Clitellata. Hydrobiologia 535/536, 357–372. doi:10.1007/s10750-004-4426-x Erséus, C., and Källersjö, M. (2004). 18S rDNA phylogeny of Clitellata (Annelida). Zoologica Scripta 33, 187–196. doi:10.1111/j.1463-6409. 2004.00146.x Fragoso, C., James, S. W., and Borges, S. (1995). Native earthworms of the north Neotropical region: current status and controversies. In ‘Earthworm Ecology and Biogeography in North America’. (Ed. P. Hendrix.) pp. 67–115. (CRC Press: Boca Raton, FL.) Gates, G. E. (1972). Burmese earthworms, an introduction to the systematics and biology ofmegadrile oligochaeteswith special reference to south-east Asia. Transactions of the American Philosophical Society 62(7), 1–326. doi:10.2307/1006214 Gates, G. E. (1976). On earthworm ovaries and their importance in megadrile systematics. I. Megadrilogica 2(12), 1–2. Goloboff, P.A., Farris, J. S., andNixon,K.C. (2003). Tree analysis using new technology. Willi Hennig Society version, available at www.zmuc.dk/ public/phylogeny/tnt [verified June 2012] Goloboff, P. A., Farris, J. S., and Nixon, K. C. (2008). TNT, a free program for phylogenetic analysis. Cladistics 24, 774–786. doi:10.1111/j.1096- 0031.2008.00217.x Grandjean, F. (1954). Essai de classification des Oribates (Acariens).Bulletin de la Societe Zoologique de France 78, 421–446. Guindon, S., andGascuel, O. (2003).A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Systematic Biology 52, 696–704. doi:10.1080/10635150390235520 Hall, T. A. (1999). BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41, 95–98. Hillis, D. M., and Dixon, M. T. (1991). Ribosomal DNA: molecular evolution and phylogenetic inference. Quarterly Review of Biology 66, 411–453. 228 Invertebrate Systematics S. W. James and S. K. Davidson dx.doi.org/10.1016/S1055-7903(03)00180-5 dx.doi.org/10.1016/S1055-7903(03)00180-5 dx.doi.org/10.1016/j.ympev.2010.09.024 dx.doi.org/10.1016/j.ympev.2010.09.024 dx.doi.org/10.1002/mmnz.19960720219 dx.doi.org/10.1007/s10750-004-4426-x dx.doi.org/10.1111/j.1463-6409.2004.00146.x dx.doi.org/10.1111/j.1463-6409.2004.00146.x dx.doi.org/10.2307/1006214 www.zmuc.dk/public/phylogeny/tnt www.zmuc.dk/public/phylogeny/tnt dx.doi.org/10.1111/j.1096-0031.2008.00217.x dx.doi.org/10.1111/j.1096-0031.2008.00217.x dx.doi.org/10.1080/10635150390235520
  • Ivanova,N.V., deWaard, J. R., andHebert, P.D.N. (2006a). An inexpensive, automation-friendly protocol for recovering high-quality DNA. Molecular Ecology Notes 6, 998–1002. doi:10.1111/j.1471-8286.2006. 01428.x Ivanova, N. V., deWaard, J. R., and Hebert, P. D. N. (2006b). CCDB DNA Extraction. http://www.dnabarcoding.ca/CCDB_DOCS/CCDB_DNA_ Extraction.pdf [Verified June 2012] Jamieson, B.G.M. (1971).Glossoscolecidae. In ‘TheAquaticOligochaeta of theWorld’. (Eds R. O. Brinkhurst andB. G. M. Jamieson.) pp. 147–199. (Oliver and Boyd: Edinburgh, Toronto.) Jamieson, B. G. M. (1988). On the phylogeny and higher classification of the Oligochaeta. Cladistics 4, 367–401. doi:10.1111/j.1096-0031.1988. tb00520.x Jamieson, B. G. M. (2000). The native earthworms of Australia (Megascolecidae Megascolecinae). (Science Publishers: Enfield, NH.) (CD-ROM). Jamieson, B. G. M. (2001). The native earthworms of Australia (Megascolecidae Megascolecinae). Supplement. (B. G. M. Jamieson, Department of Zoology and Entomology, University of Queensland, Brisbane.) (CD-ROM). Jamieson, B. G. M., and Ferraguti, M. (2006). Non-leech Clitellata. In ‘Reproductive biology and phylogeny of Annelida’. (Eds G. Rouse, and F. Pleijel.) pp. 235–392. (Science Publishers: Enfield, NH.) Jamieson, B. G. M., Tillier, S., Tillier, A., Justine, J.-L., Ling, E., James, S., MacDonald, K., and Hugall, A. F. (2002). Phylogeny of the Megascolecidae and Crassiclitellata (Annelida, Oligochaeta): combined versus partitioned analysis using nuclear (28S) and mitochondrial (12S, 16S) rDNA. Zoosystema 24, 707–734. Kass, R. E., andRaftery, A. E. (1995). Bayes factors. Journal of the American Statistical Association 90, 773–795. doi:10.2307/2291091 Koshiba, M., Ogawa, K., Hamazaki, S., Sugiyama, T., Ogawa, O., and Kitajima, T. (1993). The effect of formalin fixation on DNA and the extraction of high-molecular weight DNA from fixed and embedded tissues. Pathology, Research and Practice 189, 66–72. Larkin,M.A.,Blackshields,G., Brown,N. P., Chenna,R.,McGettigan, P.A., McWilliam, H., Valentin, F., Wallace, I. M., Wilm, A., Lopez, R., Thompson, J. D., Gibson, T. J., and Higgins, D. G. (2007). Clustal W and Clustal X version 2.0. Bioinformatics (Oxford, England) 23, 2947–2948. doi:10.1093/bioinformatics/btm404 Lee, K. E. (1959). The earthworm fauna of New Zealand. New Zealand Department of Scientific and Industrial Research Bulletin, Vol. 130. Mallatt, J., and Sullivan, J. (1998). 28S and 18S ribosomal DNA sequences support themonophyly of lampreys andhagfishes.MolecularBiologyand Evolution 15, 1706–1718. Medlin, L., Hille, J. E., Shawn, S., and Sogin, M. L. (1988). The characterization of enzymatically amplified eukaryotic 16S-like rRNA-coding regions. Gene 71, 491–499. doi:10.1016/0378-1119(88) 90066-2 Michaelsen, W. (1900). Oligochaeta. Tierreich 10, xxix + 1–575. Michaelsen, W. (1919). Über die Beziehungen der Hirudineen zu den Oligochaeten. Mitteilungen aus dem Naturhistorischen Museum Hamburg 36, 131–153. Michaelsen, W. (1935). Oligochaten von Belgisch-Kongo. III. Revue de Zoologie et de Botanique Africaines 29, 37–74. Nylander, J. A. A., Ronquist, F., Huelsenbeck, J. P., and Nieves Aldrey, J. L. (2004). Bayesian phylogenetic analysis of combined data. Systematic Biology 53, 47–67. doi:10.1080/10635150490264699 Omodeo, P. (1998). History of Clitellata. The Italian Journal of Zoology 65, 51–73. doi:10.1080/11250009809386726 Omodeo, P. (2000). Evolution and biogeography of megadriles (Annelida, Clitellata). The Italian Journal of Zoology 67, 179–201. doi:10.1080/ 11250000009356313 Palumbi, S. R. (1996). Nucleic acids II: the polymerase chain reaction. In ‘Molecular Systematics’. (EdsD. M.,Hillis,C.Moritz, andB. K.Mable.) pp. 205–247. (Sinauer & Associates: Sunderland, MA.) Passamaneck, Y. J., Schander, C., and Halanych, K.M. (2004). Investigation of molluscan phylogeny using large-subunit and small-subunit nuclear rRNA sequences. Molecular Phylogenetics and Evolution 32, 25–38. doi:10.1016/j.ympev.2003.12.016 Posada, D. (2008). jModelTest: phylogenetic model averaging. Molecular Biology and Evolution 25, 1253–1256. doi:10.1093/molbev/msn083 Qiu, J.-P., and Bouché, M. B. (1998). Révisions des taxon supraspécifiques de Lumbricoidea. Documents Pédozoologiques et Intégrologiques 3, 179–216. Rambaut, A., and Drummond, A. J. (2009). MCMC Trace Analysis Tool, Version v1.5.0. http://beast.bio.ed.ac.uk/ [verified June 2012] Ronquist, F., and Huelsenbeck, J. P. (2003). MrBayes3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19, 1572–1574. Siddall, M. E., Apakupakul, K., Burreson, E. M., Coates, K. A., Erséus, C., Källersjö,M.,Gelder, S.R., andTrapido-Rosenthal,H. (2001).Validating Livanow: molecular data agree that leeches, branchiobdellidans and Acanthobdella peledina are a monophyletic group of oligochaetes. Molecular Phylogenetics and Evolution 21, 346–351. doi:10.1006/ mpev.2001.1021 Sims, R. W. (1980). A classification and the distribution of earthworms, suborder Lumbricina (Haplotaxida: Oligochaeta). Bulletin of the British Museum (Natural History). Zoological Series 39, 103–124. Sims, R. W., and Easton, E. G. (1972). A numerical revision of the earthworm genus Pheretima auct. (Megascolecidae: Oligochaeta) with the recognition of new genera and an appendix on the earthworms collected by the Royal Society North Borneo Expedition. Biological Journal of the Linnaean Society 4, 169–268. Stamatakis, A. (2006). RAxML-VI-HPC: maximum likelihood–based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22, 2688–2690. doi:10.1093/bioinformatics/btl446 Stephenson, J. (1930). ‘The Oligochaeta.’ (Clarendon Press: Oxford.) Struck, T. H., Purschke, G., and Halanych, K. M. (2006). Phylogeny of Eunicida (Annelida) and exploring data congruence using a Partition Addition Bootstrap Alteration (PABA) approach. Systematic Biology 55, 1–20. Struck,T.H.,Paul,C.,Hills,N.,Hartmanns,S.,Hösel,C.,Kube,M.,Liebs,B., Meyers, A., Tiedemann, R., Purschke, G., and Bleidorn, C. (2011). Phylogenomic analyses unravel Annelida evolution. Nature 471, 95–98. doi:10.1038/nature09864 Swofford, D. L. (2002). ‘PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods). Version 4.’ (Sinauer Associates: Sunderland, MA.) Molecular phylogeny of earthworms Invertebrate Systematics 229 www.publish.csiro.au/journals/is dx.doi.org/10.1111/j.1471-8286.2006.01428.x dx.doi.org/10.1111/j.1471-8286.2006.01428.x http://www.dnabarcoding.ca/CCDB_DOCS/CCDB_DNA_Extraction.pdf http://www.dnabarcoding.ca/CCDB_DOCS/CCDB_DNA_Extraction.pdf dx.doi.org/10.1111/j.1096-0031.1988.tb00520.x dx.doi.org/10.1111/j.1096-0031.1988.tb00520.x dx.doi.org/10.2307/2291091 dx.doi.org/10.1093/bioinformatics/btm404 dx.doi.org/10.1016/0378-1119(88)90066-2 dx.doi.org/10.1016/0378-1119(88)90066-2 dx.doi.org/10.1080/10635150490264699 dx.doi.org/10.1080/11250009809386726 dx.doi.org/10.1080/11250000009356313 dx.doi.org/10.1080/11250000009356313 dx.doi.org/10.1016/j.ympev.2003.12.016 dx.doi.org/10.1093/molbev/msn083 http://beast.bio.ed.ac.uk/ dx.doi.org/10.1006/mpev.2001.1021 dx.doi.org/10.1006/mpev.2001.1021 dx.doi.org/10.1093/bioinformatics/btl446 dx.doi.org/10.1038/nature09864

Recommended

View more >