![Page 1: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/1.jpg)
NGS Data analysis http://ueb.vhir.org/NGS2012
Introduction to NGS(Now Generation Sequencing)
Data Analysis
Statistics and Bioinformatics Research GroupStatistics department, Universitat de Barelona
Statistics and Bioinformatics UnitVall d’Hebron Institut de Recerca
Alex Sánchez
![Page 2: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/2.jpg)
Outline
• Introduction• Bioinformatics Challenges• NGS data analysis: Some examples and workflows
• Metagenomics, De novo sequencing, Variant detection, RNA-seq
• Software• Galaxy, Genome viewers
• Data formats and quality control
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 3: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/3.jpg)
Introduction
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 4: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/4.jpg)
Why is NGS revolutionary?
• NGS has brought high speed not only to genome sequencing and personal medicine,
• it has also changed the way we do genome research
Got a question on genome organization?
SEQUENCE IT !!!
Ana Conesa, bioinformatics researcher at Principe Felipe Research Center
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 5: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/5.jpg)
NGS means high sequencing capacity
GS FLX 454(ROCHE)
HiSeq 2000(ILLUMINA)
5500xl SOLiD (ABI)
Ion TORRENT
GS Junior
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 6: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/6.jpg)
454 GS Junior35MB
NGS Platforms Performance
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 7: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/7.jpg)
454 Sequencing
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 8: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/8.jpg)
ABI SOLID Sequencing
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 9: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/9.jpg)
Solexa sequencing
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 10: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/10.jpg)
Applications of Next-Generation Sequencing
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 11: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/11.jpg)
Comparison of 2nd NGS
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 12: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/12.jpg)
Some numbers
Platform 454/FLX Solexa (Illumina)AB SOLIDRead length ~350-400bp 36, 75, or 106 bp 50bpSingle read Yes Yes YesPaired-end Reads Yes Yes YesLong-insert (several Kbp) mate-paired reads Yes Yes NoNumber of reads por instrument run 5.00K >100 M 400MMax Data output 0.5Gbp 20.5 Gbp 20GbpRun time to 1Gb 6 Days > 1 Day >1 DayEase of use (workflow) Difficult Least difficult DifficultBase Calling Flow Space Nucleotide space Color sapce
DNA ApplicationsWhole genome sequencing and resequencing Yes Yes Yes
de novo sequencing Yes Yes YesTargeted resequencing Yes Yes Yes
Discovery of genetic variants ( SNPs, InDels, CNV, ...) Yes Yes YesChromatin Immunopecipitation (ChIP) Yes Yes YesMethylation Analysis Yes Yes YesMetagenomics Yes No No
RNA Applications Yes Yes YesWhole Transcriptome Yes Yes YesSmall RNA Yes Yes Yes
Expression Tags Yes Yes Yes
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 13: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/13.jpg)
Bioinformatics challenges of NGS
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 14: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/14.jpg)
I have my sequences/images. Now what?
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 15: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/15.jpg)
NGS pushes (bio)informatics needs up
• Need for computer power• VERY large text files (~10 million lines long)
– Can’t do ‘business as usual’ with familiar tools such as Perl/Python.– Impossible memory usage and execution time • Impossible to browse for problems
• Need sequence Quality filtering• Need for large amount of CPU power
• Informatics groups must manage compute clusters• Challenges in parallelizing existing software or redesign of algorithms to work in a
parallel environment
• Need for Bioinformatics power!!!• The challenges turns from data generation into data analysis!• How should bioinformatics be structured
• Bigger centralized bioinformatics services? (or research groups providing service?)• Distributed model: bioinformaticians must be part of the temas. Interoperability?
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 16: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/16.jpg)
Data management issues
• Raw data are large. How long should be kept?• Processed data are manageable for most people
– 20 million reads (50bp) ~1Gb
• More of an issue for a facility: HiSeq recommends 32 CPU cores, each with 4GB RAM
• Certain studies much more data intensive than other– Whole genome sequencing
• A 30X coverage genome pair (tumor/normal) ~500 GB• 50 genome pairs ~ 25 TB
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 17: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/17.jpg)
So what?
• In NGS we have to process really big amounts of data, which is not trivial in computing terms.
• Big NGS projects require supercomputing infrastructures
• Or put another way: it's not the case that anyone can do everything.– Small facilities must carefully choose their projects to be scaled
with their computing capabilities.
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 18: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/18.jpg)
Computational infrastructure for NGS
• There is great variety but a good point to start with:
– Computing cluster• Multiple nodes (servers) with multiple cores• High performance storage (TB, PB level)• Fast networks (10Gb ethernet, infiniband)
– Enough space and conditions for the equipment ("servers room")
– Skilled people (sysadmin, developers)• CNAG, in Barcelona: 36 people, more than 50% of them
informaticians
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 19: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/19.jpg)
Alternatives (1): Cloud Computing
• Pros– Flexibility.– You pay what you use.– Don´t need to maintain a data center.
• Cons– Transfer big datasets over internet is
slow.– You pay for consumed bandwidth.
That is a problem with big datasets.– Lower performance, specially in disk
read/write.– Privacy/security concerns.– More expensive for big and long
term projects.
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 20: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/20.jpg)
Alternatives (2): Grid Computing
• Pros– Cheaper.– More resources available.
• Cons– Heterogeneous
environment.– Slow connectivity (specially
in Spain).– Much time required to find
good resources in the grid.
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 21: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/21.jpg)
In summary?
•“NGS” arrived 2007/8
•No-one predicted NGS in 2001 (ten years ago)
•Therefore we cannot predict what we will come up against
•TGS represents specific challenges
–Large Data Storage
–Technology-aware software
–Enables new assays and new science
•We would have said the same about NGS….
•These are not new problems, but will require new solutions
•There is a lag between technology and software….
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 22: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/22.jpg)
Bioinformatics and bioinformaticians
• The term bioinformatician means many things • Some may require a wide range of skills • Others require a depth of specific skills • The best thing we can teach is the ability to learn and
adapt • The spirit of adventure • There is a definite skills shortage • There always has been
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 23: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/23.jpg)
Increasing importance of data analysis needs
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 24: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/24.jpg)
NGS data analysis
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 25: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/25.jpg)
NGS data analysis stages
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 26: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/26.jpg)
Quality control and preprocessing of NGS data
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 27: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/27.jpg)
Data types
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 28: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/28.jpg)
Why QC and preprocessing
• Sequencer output:– Reads + quality
• Natural questions– Is the quality of my sequenced
data OK?– If something is wrong can I fix it?
• Problem: HUGE files... How do they look?
• Files are flat files and big... tens of Gbs (even hard to browse them)
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 29: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/29.jpg)
Preprocessing sequences improves results
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 30: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/30.jpg)
How is quality measured?
• Sequencing systems use to assign quality scores to each peak• Phred scores provide log(10)-transformed error probability values:
If p is probability that the base call is wrong the Phred score isQ = .10·log10p
– score = 20 corresponds to a 1% error rate– score = 30 corresponds to a 0.1% error rate– score = 40 corresponds to a 0.01% error rate
• The base calling (A, T, G or C) is performed based on Phred scores.
• Ambiguous positions with Phred scores <= 20 are labeled with N.
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 31: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/31.jpg)
Data formats
• FastA format (everybody knows about it)– Header line starts with “>” followed by a sequence ID– Sequence (string of nt).
• FastQ format (http://maq.sourceforge.net/fastq.shtml)– First is the sequence (like Fasta but starting with “@”)– Then “+” and sequence ID (optional) and in the following line are
QVs encoded as single byte ASCII codes• Different quality encode variants
• Nearly all downstream analysis take FastQ as input sequence
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 32: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/32.jpg)
The fastq format
• A FASTQ file normally uses four lines per sequence. – Line 1 begins with a '@' character and is followed by a sequence
identifier and an optional description (like a FASTA title line). – Line 2 is the raw sequence letters. – Line 3 begins with a '+' character and isoptionally followed by the same
sequence identifier (and any description) again. – Line 4 encodes the quality values for the sequence in Line 2, and must
contain the same number of symbols as letters in the sequence.• Different encodings are in use• Sanger format can encode a Phred quality score from 0 to 93 using ASCII 33 to 126
@Seq description
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 33: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/33.jpg)
Some tools to deal with QC
• Use FastQC to see your starting state.
• Use Fastx-toolkit to optimize different datasets and then visualize the result with FastQC to prove your success!
• Hints: – Trimming, clipping and filtering may improve quality– But beware of removing too many sequences…
Go to the tutorial and try the exercises...
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 34: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/34.jpg)
Applications
• [1] Metagenomics• [2] De novo sequencing• [3] Amplicon analysis• [4] Variant discovery• [5] Transcriptome analysis• …and more …
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 35: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/35.jpg)
[1] Metagenomics &other community-based “omics”
Zoetendal E G et al. Gut 2008;57:1605-1615
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 36: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/36.jpg)
[1] A metagenomics workflow
Gene prediction
Binning
AAGACGTGGACA
CATGCGTGCATG
AGTCGTCAGTCATGGG
GTCCGTCACAACTGA
Short reads (40-150 bps)
AAGACGTGGACAGATCTGCTCAGGCTAGCATGAAC
Contigs
GATAGGTGGACCGATATGCATTAGACTTGCAGGGC
1 3000 6000
ORFs
Proteins, families, functions
1 3000 6000
Functional profiles
1 2000
Sequences into species
Assembly
Homology searching
Functional classificationOntologies
![Page 37: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/37.jpg)
[1] Metagenomic Approaches
SMALL-SCALE: 16S rRNA gene profilingThe basic approach is to identify microbes in a complex community by exploiting universal and conserved targets, such as rRNA genesPetrosini.
LARGE-SCALE: Whole Genome Shotgun (WGS)Whole-genome approaches enable to identify and annotate microbial genes and its functions in the community.
Environmental Shotgun Sequencing (ESS).A primer on metagenomics.
PLoS Comput Biol. 2010 Feb 26;6(2):e1000667.
Challenges and limitations: Chimeric sequences caused by PCR amplification and sequencing errors.
Challenges and limitations: relatively large amounts of starting material requiredpotential contamination of metagenomic samples with host
genetic materialhigh numbers of genes of unknown function.
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 38: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/38.jpg)
[1] Comparative Metagenomics
Other software based on phylogeneticdata are UniFrac.
MEGAN can also be used to compare the OTU composition of two or more frequency-normalized samples.MG-RAST provides acomparative functional and sequence-based analysis for uploaded samples
.
Comparing two or more metagenomes is necessary to understand how genomic differences affect, and are affected by the abiotic environment.
![Page 39: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/39.jpg)
[1] Some Metagenomics projects
"whole-genome shotgun sequencing" 78 million base pairs of unique DNA sequence were analyzed
"whole-genome shotgun sequencing" was applied to microbial populationsA total of 1.045 billion base pairs of nonredundant sequence were analyzed
To date, 242 metagenomic projects are on going and 103 are completed (www.genomesonline.org).
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 40: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/40.jpg)
[2] De novo sequencing
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 41: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/41.jpg)
[3] Amplicon analysis
Each amplicon (PCR product) is sequenced individually, allowing for the identification of rare variants and the assignment of haplotype information over the full sequence length
Some applications:● Detection of low-frequency (<1%) variants in complex mixtures
→ rare somatic mutations, viral quasispecies... Ultra-deep amplicon sequencing
● Identification of rare alleles associated with hereditary diseases, heterozygote SNP calling... Ultra-broad amplicon sequencing
● Metabolic profiling of environmental habitats, bacterial taxonomy and phlylogeny 16S rRNA amplicon sequencing
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 42: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/42.jpg)
[3] Example of raw data generation with GS-FLX
...
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 43: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/43.jpg)
[3] Data Workflow
...
Dat
a P
roce
ssin
g
![Page 44: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/44.jpg)
[3] Final output examples
...
Bar plots output example (with circular legend for the AA)
NT substitution (error) matrices
AA frequency tables
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 45: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/45.jpg)
[4] Variant discovery
Your aligner decides the type/amount of variants you can identify
Naive SNP callingReads counting
Statistic support SNP callingMaximum likelihood, Bayesian
Quality score recalibrationRecalibrate quality score from whole alignment
Local realignment around indelsRealign reads
Known variants (limited species)dbSNP
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 46: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/46.jpg)
[4] Example: Exome Variant Analysis
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 47: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/47.jpg)
[4] Genotype calling tools
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 48: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/48.jpg)
[4] GATK pipeline
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 49: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/49.jpg)
[4]
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 50: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/50.jpg)
[4] Many ongoing sequencing projects
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 51: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/51.jpg)
[5] Transcriptome Analysis using NGS
RNA-Seq, or "Whole Transcriptome Shotgun Sequencing" ("WTSS") refers to use of HTS technologies to sequence cDNA in order to get information about a sample's RNA content.
Reads produced by sequencing
Aligned to a reference genome to build transcriptome mappings.
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 52: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/52.jpg)
[5] Applications (1) Whole transcriptome analysis
AAAAmRNAFragmentation
RT
cDNA library
sequencing
Detects expression of known and novel mRNAs
Identification of alternative splicing events Detects expressed SNPs or mutations Identifies allele specific expression patterns
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 53: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/53.jpg)
[5] Applications (2) Differential expression
1.Reads are mapped to the reference genome or transcriptome
2.Mapped reads are assembled into expression summaries (tables of counts, showing how may reads are in coding region, exon, gene or junction);
3.The data are normalized;
4.Statistical testing of differential expression (DE) is performed, producing a list of genes with P-values and fold changes.
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 54: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/54.jpg)
[5] RNA Seq data analysis - Mapping
•Main Issues:–Number of allowed mismatches–Number of multihits–Mates expected distance–Considering exon junctions
End up with a list of # of reads per transcript
These will be our (discrete) response variable
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 55: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/55.jpg)
• Two main sources of bias– Influence of length: Counts are proportional to the transcript
length times the mRNA expression level.– Influence of sequencing depth: The higher sequencing depth, the
higher counts.
• How to deal with this– Normalize (correct) gene counts to minimize biases.– Use statistical models that take into account
length and sequencing depth
[5] RNA Seq data analysis -Normalization
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 56: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/56.jpg)
[5] RNA Seq - Differential expression methods
• Fisher's exact test or similar approaches.
• Use Generalized Linear Models and model counts using – Poisson distribution.– Negative binomial distribution.
• Transform count data to use existing approaches for microarray data.
• …
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 57: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/57.jpg)
[5] Advantages of RNA-seq Unlike hybridization approaches does not require existing genomic
sequence Expected to replace microarrays for transcriptomic studies
Very low background noise Reads can be unabmiguously mapped
Resolution up to 1 bp High-throughput quantitative measurement of transcript abundance
Better than Sanger sequencing of cDNA or EST libraries Cost decreasing all the time
Lower than traditional sequencing Can reveal sequence variations (SNPs) Automated pipelines available
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 58: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/58.jpg)
Software for NGS preprocessing and analysis
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 59: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/59.jpg)
Which software for NGS (data) analysis?
• Answer is not straightforward.• Many possible classifications
– Biological domains• SNP discovery, Genomics, ChIP-Seq, De-novo assembly, …
– Bioinformatics methods• Mapping, Assembly, Alignment, Seq-QC,…
– Technology• Illumina, 454, ABI SOLID, Helicos, …
– Operating system• Linux, Mac OS X, Windows, …
– License type• GPLv3, GPL, Commercial, Free for academic use,…
– Language• C++, Perl, Java, C, Phyton
– Interface• Web Based, Integrated solutions, command line tools, pipelines,…
http://seqanswers.com/wiki/Software/list
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 60: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/60.jpg)
NGS Data analysis http://ueb.ir.vhebron.net/NGS
Which software for NGS (data) analysis?
• Answer is not straightforward.• Many possible classifications
– Biological domains• SNP discovery, Genomics, ChIP-Seq, De-novo assembly, …
– Bioinformatics methods• Mapping, Assembly, Alignment, Seq-QC,…
– Technology• Illumina, 454, ABI SOLID, Helicos, …
– Operating system• Linux, Mac OS X, Windows, …
– License type• GPLv3, GPL, Commercial, Free for academic use,…
– Language• C++, Perl, Java, C, Phyton
– Interface• Web Based, Integrated solutions, command line tools, pipelines,…
http://seqanswers.com/wiki/Software/list
![Page 61: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/61.jpg)
Some popular tools and places
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 62: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/62.jpg)
Galaxy Site
62
http://galaxy.psu.edu/
![Page 63: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/63.jpg)
63
Obtain data from many data sources including the UCSC Table Browser,BioMart, WormBase,
or your own data.
Prepare data for further analysis by rearrangingor cutting data columns, filtering data and many
other actions.
Analyze data by findingoverlapping regions,
determining statistics, phylogenetic analysis
and much more
![Page 64: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/64.jpg)
64
contains links to the downloading,
pre-procession and analysis tools
displaysmenus and data inputs
Shows the history of analysis steps, data and resultviewing
RegisterUser
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 65: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/65.jpg)
65
Click Get Data
![Page 66: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/66.jpg)
66
Get Data from Database
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 67: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/67.jpg)
67
Upload File File Format
Upload or paste file
![Page 68: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/68.jpg)
68 NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 69: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/69.jpg)
FASTQ file manipulation: format conversation,summary statistics,
trimming reads,filtering reads
by quality score…
![Page 70: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/70.jpg)
Input: sanger FASTQOutput: SAM format
![Page 71: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/71.jpg)
Downstream analysis:SAM -> BAM
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 72: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/72.jpg)
Copyright OpenHelix. No use or reproduction without express written consent72
List saved histories andshared histories.
Work on a current history, create new, share workflow
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 73: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/73.jpg)
Creates a workflow, allowsuser to repeat analysisusing different datasets.
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 74: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/74.jpg)
DATA VISUALIZATION
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 75: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/75.jpg)
Why is visualization important?
make large amounts of data more interpretableglean patterns from the datasanity check / visual debuggingmore…
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 76: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/76.jpg)
History of Genome Visualization
1800s 1900s 2000s
time
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 77: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/77.jpg)
What is a “Genome Browser”
linear representation of a genomeposition-based annotations, each called a track
continuous annotations: e.g. conservationinterval annotations: e.g. gene, read alignmentpoint annotations: e.g. SNPs
user specifies a subsection of genome to look at
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 78: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/78.jpg)
Server-side model(e.g. UCSC, Ensembl, Gbrowse)
• central data store• renders images• sends to client
server
client• requests images• displays images
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 79: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/79.jpg)
Client-side model(e.g. Savant, IGV)
• stores dataserve
r
client• local HTS store• renders images• displays images
HTS machine
![Page 80: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/80.jpg)
Rough comparison of Genome Browsers
UCSC Ensembl GBrowse Savant IGV
Model Server Server Server Client Client
Interactive
HTS support
Database of tracks
Plugins
No support Some support Good support
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 81: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/81.jpg)
Limitations of most genome browsersdo not support multiple genomes simultaneouslydo not capture 3-dimensional conformationdo not capture spatial or temporal informationdo not integrate well with analyticscannot be customized
The SAVANT GENOME BROWSERhas been createdto overcome these limitations
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 82: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/82.jpg)
Integrative Genomics Viewer (IGV)
he Integrative Genomics Viewer (IGV) is a high-performance visualization tool for interactive exploration of large, integrated datasets. It supports a wide variety of data types including sequence alignments, microarrays, and genomic annotations.
![Page 83: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/83.jpg)
Acknowledgements Grupo de investigación en Estadística y Bioinformática del
departamento de Estadística de la Universidad de Barcelona.
All the members at the Unitat d’Estadística i Bioinformàtica del VHIR (Vall d’Hebron Institut de Recerca)
Unitat de Serveis Científico Tècnics (UCTS) del VHIR (Vall d’Hebron Institut de Recerca)
People whose materials have been borrowed or who have contributed with their work Manel Comabella, Rosa Prieto, Paqui Gallego, Javier
Santoyo, Ana Conesa, Thomas Girke and Silvia Cardona.…
NGS Data analysis http://ueb.vhir.org/NGS2012
![Page 84: Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS](https://reader033.vdocuments.site/reader033/viewer/2022052505/554c19dab4c905ec518b5064/html5/thumbnails/84.jpg)
Gracias por la atención y la paciencia
NGS Data analysis http://ueb.vhir.org/NGS2012