Transcript
Page 1: At Your Service, February 2014

wers owers

BridalBridalFlo ers

2014 Guide to Businesses in Our Region

A Supplement to the Lewiston Tribune and NW Market

AT YOUR SERVICE

Page 2: At Your Service, February 2014

A T Y O U R S E R V I C E L E W I S T O N T R I B U N E2 S U N D A Y, F E B R U A R Y 2 3 , 2 0 1 4

Adcope Athletic Club ....................................................... 25Alternative Nursing Services ............................................. 4Applied Surfaces Technology, Inc. .................................. 24Asotin County Aquatic Center ......................................... 13Avalon Progressive Care .................................................. 15B&F Power Vac ................................................................ 10Care Connection Home Care ........................................... 21Clarkston Auto Sales ........................................................ 11Community Bank ............................................................... 5Compassionate Care ........................................................... 2D&D Repair ..................................................................... 15Dave’s Auto & Truck Center ............................................ 19DA Davidson & Co. ........................................................... 3Edward Jones ..................................................................... 7El Sombrero Mexican Restaurant ...................................... 6Elmview Chiropractic Clinic ........................................... 24Emeritus at Juniper Meadows .......................................... 13Erb’s Ace Hardware ......................................................... 20Evergreen Estates ............................................................. 18Farm Bureau Mutual Insurance Co. of Idaho .................. 26Fast Signs ......................................................................... 26Garlinghouse Memorials .................................................. 22Golden Dragon ................................................................. 23Granite Concepts .............................................................. 22Guardian Angel Homes .................................................... 16H&R Block ........................................................................ 9Interlink Volunteers-Faith In Action ................................ 25Kennedy’s Auto Body ...................................................... 24

Kindred Transitional Care and Rehabilitation ................... 8Les Schwab ...................................................................... 14Lewiston Premix Concrete ............................................... 15Lolo Sporting Goods ........................................................ 12Merchant Memorial Group .............................................. 28Mike’s Pole Barns .............................................................. 6Miracle Ear ....................................................................... 13Mr. Leon’s School of Hair Design ................................... 11Mohr’s Floors ..................................................................... 8Morgan Stanley Smith Barney ......................................... 21Motion Auto Supply ........................................................... 4Northwest Handmade Goods ........................................... 20PCS Laser & Memorial ...................................................... 9Peak Performance Physical Therapy ................................ 23Peterson Radiator, Muffler & Transmission .................... 16Potlatch No. 1 Federal Credit Union ................................ 12Pure Tone Hearing Aid Service ........................................ 11Red Lion Hotel ................................................................. 17Sattler Insurance ............................................................... 19Seubert’s Quality Home Care .......................................... 10Strike & Spare Bar & Grill/Orchard Lanes ...................... 18Stripes-A-Lot ................................................................... 18The Paint Shop ................................................................... 8Tri State Memorial Hospital ............................................ 27Twin River Bank .............................................................. 16Wedgewood Terrace ........................................................... 6David L. Wilkinson, D.D.S., M.S, Orthodontics for Children and Adults ......................................................... 22

A Compassionate Care Company“Your Hometown, Home Care Company”

We believe your search for the right in-home care agency should focus on an agency that

not only off ers great care, but also promotes life enrichment. The staff of Compassionate Care takes pride in their care delivery system.

Compassionate & CaringIn-Home Health Care...Up to 24 Hours a day...

7 Days a week...We are there when you need us most...

Personal Hygiene Bathing & Dressing Medications Assistance Laundry Companionship Meal Preparation

Transportation Essential Shopping Daily Exercise Programs Supervision Toileting Assistance Homemaker Services

We AcceptIdaho MedicaidV.A. Benefi tsLong Term Care InsuranceWorkman’s CompensationArea Agency on AgingPrivate Pay

Services Provided

150 126th Street, Suite BOrofi no, ID 83544

Offi ce 208-476-3714toll free: 1-866-919-CARE (2273)email: [email protected]

526 17th Avenue,Lewiston, ID 83501

Offi ce 208-746-7433

407540BW-14

Page 3: At Your Service, February 2014

A T Y O U R S E R V I C E S U N D A Y, F E B R U A R Y 2 3 , 2 0 1 4 3l E w I S T O N T R I B U N E

First and most important, it means each member of D.A. Davidson & Co. know the people of the quad cities. We share their values and their work ethic. We’re committed to delivering the exceptional skill and service that our neighbors deserve.

Financial markets have never been more complicated. Although this complexity can be frustrating, it can create opportunities. Investors in our region need to know that they have access to the same kind of sophisticated tools and talent that big-time, big-city investors use. That’s why we are continually sharpening our abilities to provide not

We’re fortunate to live and work in a very special place and we want to keep it that way. That’s why we’re active in the community as volunteers, donors and civic leaders. We’re privileged to work with many of our friends, clients and neighbors to help make a difference for our community and surrounding area. We believe that success starts at home.

The Financial Advisors of D.A. Davidson & Co are proud to call the quad cities home and pledge to deliver our clients the utmost

Jeff NessetCFP®, CWS®,

Senior Vice President, Financial Advisor, Branch Manager

Lewiston

Brad RiceCWS®,

Senior Financial AdvisorLewiston

George BodmanCWS®, Vice President,

Financial Advisor, Assistant Branch

ManagerLewiston

Kendell JenksCWS®,

Senior Financial AdvisorLewiston

Bob Blakey Vice President,

Financial AdvisorLewiston

Joe TravisVice President,

Financial AdvisorMoscow

Scott BaldwinCWS®,

Vice President, Financial Advisor

Lewiston

Rusty SchatzCWS®, Associate

Vice President, Financial Advisor

Moscow

Ben HouseFinancial Advisor

Lewiston

Jeremy NessetCWS®,

Senior Financial AdvisorLewiston

Steve WesnerCWS®,

Financial Advisor Moscow

0305 5th StreetLewiston, Idaho 83501

(208) 743-0818 or (800) 237-2814

111 North Washington, Suite 6Moscow, Idaho 83843

(208) 883-5396 or (800) 808-5396

Page 4: At Your Service, February 2014

A T Y O U R S E R V I C E L E W I S T O N T R I B U N E4 S U N D A Y, F E B R U A R Y 2 3 , 2 0 1 4

Hours: M–F 7:30–5:30 Saturday 9–4

3716

45BX

-13

208-746-1202

NEW LOCATION! Same Day/Next Day Service on Special Orders Large Inventory Employee Owned

Rob Glen Tammy Jake DanButch AlMary

MOTION AUTO SUPPLYFULL SERVICE PARTS & SUPPLY STORE

QUALITY PARTS, SERVICE & PERFORMANCE!

Auto, Truck & SUV Parts, Tools & Accessories, Foreign & Domestic

1907 19th Avenue, Lewiston

ALTERNATIVE NURSING SERVICES, INC.“Professional & Caring In-Home Health Care”

A    lternative Nursing Services, Inc. has been serving our communities

with professionalism, quality & integrity since 1995. The primary responsibility of Alternative Nursing Services, Inc. is to the client. We continually strive

to provide quality of life for all people entrusted to our care. We endeavor to meet the total needs of those we care for! Call us Today to answer any of your questions or for a free in-home assessment.

Services Available: • Daily Living Assistance

• Housekeeping

• Medication Reminders

• Meal Preparation

• Transportation

• Bathing Assistance

Payment Options: • Idaho Medicaid• Washington Medicaid• Long Term Insurance• V.A. Medical Insurance

& AAA-Homemaker• Idaho Workmen Compensation

Insurance• Washington Labor & Industries

Insurance• Private Pay (discount options available)

Lewiston/Clarkston(208) 746-3050

Moscow(208) 882-0616

Kamiah(208) 935-2204

Grangeville/Orofi no1-800-930-3050

Locally OwnedSince1995…

• Nez Perce• Latah• Lewis

• Clearwater• Idaho• Asotin

• Garfi eld• Whitman• Benton

• Spokane

• Ada

Serving You from these Counties:

• Personal Care Services• Developmental Therapy• Homemaker Services• Adult Day Care• Skilled Nursing Services• Residential Habilitation• Respite Care• Companionship Services

Programs Off ered:

You Choose the hours… You Choose the days… 4

07048BW-14

Page 5: At Your Service, February 2014

A T Y O U R S E R V I C E S U N D A Y, F E B R U A R Y 2 3 , 2 0 1 4 5l E w I S T O N T R I B U N E

Member FDIC

Local Money Working For Local People

Clarkston118 Bridge Street

509-758-6878www.communitybanknet.com

Come Meet Our Team

We’re here to assist you with all of your banking needs!

Debbie PaaschTeller

Kristian KopczynckiTeller

Dallas KyrissLoan Analyst Jaden Yuros

MortgageOriginator &

Business Banker Kristy BartonBranch Manager

Dan LohmanAVP/Commercial

Loan Officer

Lacey SmithPersonalBanker

KarenVallandigham

Teller

John SullivanSVP/Regional Credit

Administrator

Page 6: At Your Service, February 2014

A T Y O U R S E R V I C E L E W I S T O N T R I B U N E6 S U N D A Y, F E B R U A R Y 2 3 , 2 0 1 4

4 0 4 4 4 8 BW- 1 4

Mike’s Pole Barns specializes exclusively in the construction of pole buildings. The company has been doing this for 20 years and knows how every step of the process works, making for a good homeowner experience.

What makes Mike’s Pole Barns special is its employees. They have a vast amount of knowledge and experience in their eld and take the job serious and personal. Often customers will call Mike and compliment on the quality of the work and how nice the employees are.

The customers also make this business special. Most have been wanting a shop for a long time and are excited when they make the decision to have Mike's Pole Barns build their dream shop.

As for recent trends, owner Mike Winroth has noticed an increase in use of the post frame method for commercial purposes, and with the price of steel at an all-time high, this application offers an excellent alternative.

Store hours are 7:00 a.m. to 5:00 p.m. Monday through Friday

Be sure to visit our web site for a free quote and more:www.mikespolebarns.com

Mike's POLE BARNS, LLC

250 13th Street, Clarkston • 509-751-0988

Wedgewood TerraceAssisted Living and

Stepping Stones Dementia Care

“Where the heart never forgets.”• Assisted Living• Alzheimer’s Secure Unit• Day/Night Care• Respite Care

Stop by for a visit and meet our staff.Call today for a tour – 208-743-4545

2114 Vinyard Avenue, Lewiston

Th e Pimienta Family invites you to enjoy authentic Mexican food, served in a setting of Mexican art and pottery by our family of professional chefs and servers. Two convenient locations, with

a full-service bar at the Th ain Road restaurant.

372355BX - 1 3

405 Th ain RoadLewiston

208-746-0658

2214 East MainLewiston

208-746-1205

FamilyMexicanRestaurant

Please join us today!

Page 7: At Your Service, February 2014

A T Y O U R S E R V I C E S U N D A Y, F E B R U A R Y 2 3 , 2 0 1 4 7l E w I S T O N T R I B U N E

Anyone can provide advice. At Edward Jones, our goal is to provide advice and guidance tailored to your needs.That’s why we live and work in your community.When it comes to your nancial needs and goals, we believe you deserve face-to-face attention.You talk, we listen, and we get to know you.

For more information or to schedule a complimentary nancial review, call or stop by today.

• Retirement Plan Rollovers and Consolidation

• Annuities

• Insurance

• Business Retirement Plans

• Investment Banking

• Mutual Funds

• Portfolio and Retirement Plan Reviews

www.edwardjones.com

404934BW-14

Trevor E. ArnoneFinancial Advisor

1455 G Street Suite 101Lewiston, ID 83501

(208) 746-23081-844-746-2308

Sherrie Beckman, AAMS®

Financial Advisor940 Bryden AvenueLewiston, ID 83501

(208) 746-38751-800-646-8316

Brian E. Bailey, AAMS®

Financial Advisor303 Bridge Street, Ste.3

Clarkston, WA 99403(509) 758-87311-866-758-9595

Jim KubiakFinancial Advisor

1366 Bridge StreetClarkston, WA 99403

(509) 758-83531-800-787-8353

Scott ArnoneFinancial Advisor

302 5th StreetClarkston, WA 99403

(509) 758-81191-800-441-2308

Brad Melton, AAMS®

Financial Advisor1702 G Street

Lewiston, ID 83501(208) 746-11141-888-746-1123

Dean E. Roy, AAMS®

Financial Advisor1024 16th AvenueLewiston, ID 83501

(208) 798-47421-877-798-4770

Why go anywhere else?

Larry KopczynskiFinancial Advisor2501 17th Street

Lewiston, ID 83501(208) 798-47321-866-798-4732

Stephanie JohnsonFinancial Advisor517 Thain Road

Lewiston, ID 83501(208) 746-71671-877-490-7167

Christian Leer, AAMS®

Financial Advisor740 5th Street

Clarkston, WA 99403(509) 751-16101-877-751-1610 Member SIPC

Matt Sartini, AAMS®

Financial Advisor122 Johnson Avenue

Orofino, ID 83544(208) 476-32711-866-904-3271

Page 8: At Your Service, February 2014

A T Y O U R S E R V I C E L E W I S T O N T R I B U N E8 S U N D A Y, F E B R U A R Y 2 3 , 2 0 1 44

05

01

2B

W-1

4

The Paint Shop

Cory Triplett, Owner208-743-34491022 Bryden Avenue, Lewiston

Where Beautiful Colors Make Lasting Impressions

We off er a complete line of Benjamin Moore products for virtually every project you have. From surface preparation products, to a wide array of coatings in sheens and formulas for every requirement. Whatever the job demands, we have what you need.

Mon - Fri 7:00- 5:30Sat 9:00 -2:00

307791E3-11

“Where Quality Products and Expert Installation Meet”

1036 Bryden Ave, Lewiston • 208-798-4738 • Mon-Fri 9:30-5:00 • www.MohrsFloors.com

For over eight years, Mohr’s Floors has helped customize homes with every choice of fl ooring including hardwood and granite.

They carry a variety of brands like nationally acclaimed Mohawk Smartstrand® carpet, Hallmark and Kentwood engineered and solid hardwoods, Surface Art and Bedrosians stone and porcelain tile. Whether you are remodeling one room or building a custom home, the experts at Mohr’s can help choose styles and colors to match your project. In addition to special order items, customers can shop from Mohr’s in-stock inventory of carpet, vinyl and laminate. Stop by the showroom at 1036 Bryden for your “total fl ooring solution”.

• Transitional Care Unit- Short-term Rehabilitation Unit

Physical Therapy, Occupational Therapy, Speech Therapy-Outpatient Therapy

• Complex Wound Care Team • Selective Menu’s, Fine Dining, Evening Room Service and Wi-fi • On-site Mental Health Consultant• Medicare, Medicaid, Managed Care Contracts and VA approved

208-743-9543 3315 8th Street, Lewiston

We Off er:

Please call to schedule a tour or just drop in. We are always available to show you the center and answer any questions you may have.407011BW

-14

Debbie Freeze RHITExecutive Director

40 years experience in rehab. and long-term care

Mary Moree RN, DNSDirector of

Nursing Services25 years multifaceted

background with 14 years in long-term

care at the center

Traci KingsleyMarketing/Admis-sions Coordinator

32 years experience

Breanna McKay Director of

RehabilitationWith Kindred Transitional

Care and Rehab since July 2012.

Recover in a cozy, home-like setting!Eat in our Bistro style dining room!

Proud to be Providigm QAPI Accredited and recipients of the 2013 Embracing Quality Award as a top performing nursing home.

MAKE A RESERVATIONIf you have a scheduled surgery and will need Rehabilitation therapy following the procedure, call and make a reservation for your continued care. Our therapists will

work with your physician to get you back home as quickly as possible.REHAB MADE EASY!

Page 9: At Your Service, February 2014

A T Y O U R S E R V I C E S U N D A Y, F E B R U A R Y 2 3 , 2 0 1 4 9l E w I S T O N T R I B U N E

Business Services by H&R Block"NEVER SETTLE FOR LESS!"

Business Services by H&R Block has offered small business accounting, bookkeeping, payroll, and associated business tax returns and reports for 34 years.

Come see us for all of your small business accounting needs. By providing local businesses with a cost effective accounting alternative we provide them with the opportunity to have more time to devote to customer service and building their companies. We do the paperwork so you don't have to!

Our well-trained staff will provide your business with excellent personal service.

1446 Main Street in Lewiston 10 a.m. to 5 p.m. Monday-Friday (208) 743-0222

406884BW-14

John & Terry Blankenship

PCS Laser and Memorial have been in business for over 30 years. All of our work is performed locally by skilled craftsman. Whether you are shopping for a traditional sandblasted memorial stone or a bit more non-conventional lasered stone, give us a call. Our prices are very reasonable and our workmanship is second to none. We are a full-service business from design, installation, repair work, adding additional wording to existing stones…..we can do it all!

Our specialty is the ability to create a memorial that is personal and unique to you and your family. Laser your favorite shing spot, your wedding picture, or any photo that is dear to your heart. We are the ONLY business within

the valley that can do this for you!

Check out our QR Codes. Turn your memorial into an interactive experience. The QR Code links anyone with a smartphone to a web page that provides family

history, photos and so much more. Add one to an existing headstone, bench, niches or even to an urn. A wonderful gift to leave for future generations to come

at an extraordinary low price of just $85.

4 0 6 8 9 3 BW- 1 4

PCS Laser and MemorialCreating Timeless Memories

4 0 6 8 9 34 0 6 8 9 30 6 80 6 86 864 0 6 8 9 39 36 8 BW-BW-BW-W -W -BW-W

Hours: 10 a.m. to 4 p.m. Monday-Friday, and evenings or weekends by appointment.

618 D Street, Suite A, Lewiston(208) 746-1033

Page 10: At Your Service, February 2014

A T Y O U R S E R V I C E L E W I S T O N T R I B U N E10 S U N D A Y, F E B R U A R Y 2 3 , 2 0 1 4

Lewiston(208) [email protected]

Moscow(208) 883-1114

[email protected]

Grangeville(208) 983-5275

[email protected]

Toll Free 800-597-6620Proudly serving you since 1988.

www.seubertsqualityhomecare.com

2011, 2012 & 2013

403662AY-14

Best of the West winner 3 years in a row!

Our In-Home Daily Living Services:

Not ready for a Nursing Home? Seubert’s Quality Home Care helps seniors stay in the comfort of their own homes by providing help with day to day needs. From a few hours a week up to 24 hours a

day, our caregivers come into your home and help with tasks such as running errands, shopping, cleaning, and laundry. As your needs increase, we are there to help with

bathing, dressing, and meal preparation – all daily living needs!

Personal Care ServicesMeal PreparationBathing and Dressing

CompanionshipShoppingRN Oversight

HousekeepingSupervisionMedication Assistance

TransportationMobility AssistanceUp to 24 Hour Care

Laundry

KarenMcKinleyRN, Agency

Administrator

DawnLamm

Administrative Assistant

KatieOstenson

AgencyManager

ReneeClatyton

BillingCoordinator

KattiCarlsonMoscow

Client Care Coordinator

AimeeMartinezMoscowOf ce

Coordinator

LoniDailey

Lewiston/GrangevilleClient Care Coordinator

DebbiBonnerLewiston

Of ce Coordinator

We off er a helping hand in the comfort of your own home.

Mac and Donna Mattoon and crews of B&F Power Vac have been committed to providing honest, dependable, quality cleaning service

to our commercial, industrial and residential customers in North Central Idaho, Northeast, and Central Washington since 1971.

Heating dealers, restoration companies and property management businesses depend on B&F’s cleaning expertise to complete their

customers Indoor Air Quality / Heating, Ventilation, Air

Conditioning duct cleaning maintenance

programs.

HVAC SYSTEMS

FURNACES / BOILERS

EXHAUST / VENTILATION SYSTEMS

HEAT RECLAIM SYSTEMS

DRYER VENTS / GAS WATER HEATER

CHIMNEYS / FIREPLACES

Page 11: At Your Service, February 2014

A T Y O U R S E R V I C E S U N D A Y, F E B R U A R Y 2 3 , 2 0 1 4 11l E w I S T O N T R I B U N E

4 0 4 6 4 4 BW- 1 4

CLARKSTONAuto Sales

Buy here - Pay here - Financing O.A.C.Monday-Friday 8-6pm; Saturday 8-4pm

clarkstonautosales.com

1292 Bridge Street, Clarkston (509) 758-3081Like us

onFacebook

For nearly fty years, satis ed customers have been purchasing vehicles from the Beutler family. Owner Bill Beutler and his staff take pride in providing the same good old fashioned customer service that Bill’s father provided to his customers in the 1970s.

With over 200 cars, pick-ups, and SUVs in stock, you are certain to nd something to t your needs and your budget. Great selection, friendly staff, and great service even after the sale, is what you will nd at Clarkston Auto Sales.

The next time you are thinking about purchasing a previously owned vehicle, join the generations of satis ed customers that shop at Clarkston Auto Sales.

4 0 6 3 3 2 BW- 1 4

1850 Idaho Street • Lewiston746-6068 • 1-800-248-5049

Puretone Hearing Aid ServiceMost Americans With Hearing Loss Wait Five Years

Before Going To A Specialist. Don’t Be One Of Them!Puretone Hearing Aid Service provides sales and service on most major

brands of hearing aids, as well as comprehensive hearing tests. Hearing aid repairs are also available for all brands of hearing devices. As an independent dispenser of hearing devices, Puretone specializes in matching the proper hearing instrument with a client’s hearing loss, thus customizing the package. These hearing packages are put together with absolutely no hidden costs at the lowest possible prices. All services performed with customer satisfaction in mind and prices are guaranteed to be the lowest in the valley.

Free hearing tests are available at the offi ce or we can make house calls. Offi ce hours are 9 a.m. to 4 p.m. Monday through Friday in Lewiston. Call for an appointment today!

Mr. Leon's School of Hair Design Celebrates 45 Years Serving the Quad Cities!What our students are saying:

“I love this school and how they are making my dreams come true...following in my mother's footsteps." ~Wendy's mom owned and operated Th e Polished Lady Salon in Lewiston, ID. "Knowledge and Experience." ~Shiloh "I love the teachers and how every day they show us something new. We are a family at Mr. Leon's." ~Deachon"Many of us have had a rough life and Mr. Leon's is not only a school for cosmetology but it helps us to move past our problems and grow into well rounded individuals." ~LaAnnabra"I love helping clients not only feel beautiful, but confi dent and I can do this with the help of this amazing school and instructors." ~K-Chelle

ASK ME! In remembering our founder Leon Cover's untimely death, we are encouraging our communities to join us in raising awareness, along with the Idaho North Central District Health Department, for people to go in for their regular cancer screenings! Our students are wearing these aprons to promote and encourage women in Idaho to receive their mammograms and clinical breast exams. Please contact Heidi Hensen for details (208) 799-0368.

Mr. Leon’s School of Hair Design at a glance:• Mr. Leon's opened in Moscow in 1969 & in

Lewiston in 1998• Proud heritage of caring, compassionate, professional

education, and service!• Mr. Leon’s off ers 3 programs: Cosmetology, Nail

Technology, and Teacher Training in both locations• Student Competition March 30th at the University

Inn in Moscow, ID “Masquerade” Opening it up to professionals this year for the last event!

• One of the lowest priced accredited cosmetology schools in Idaho

• New Classes starting in April! Call Lisa in Moscow 208.301.3770 or Linda 208.743.6822 to enroll!

Open to the public, all work done by students under supervision of licensed instructors.Hours: Tues.-Fri. 9:30-5, Sat. 8:30-5

www.mrleons.com | ACCREDITED by NACCAS

Financial aid available to those who qualify

Page 12: At Your Service, February 2014

A T Y O U R S E R V I C E L E W I S T O N T R I B U N E12 S U N D A Y, F E B R U A R Y 2 3 , 2 0 1 4

Lolo Sporting Goods has been a downtown Lewiston landmark for more than 60 years. Dave Howell bought the business in August of 2009, and with manager Mike Thomas supplies outdoorsmen with new and used guns, ammunition and reloading equipment and components. They buy used guns and have the lowest consignment fees of any store in the area. Lolo’s original gunsmith is back to take care of any gunsmithing needs or wants.

Lolo is a stocking dealer for Kimber, Nightforce, Montana Ri e Company and Wilson Combat and has the best deal on new and remanufactured bulk ammunition. They sell Idaho Fish and Game licenses. Lolo also accepts guns on pawn at the lowest rate in the Valley!

Lolo wants to be your rst and last stop for all your shooting needs – and that means making sure you are completely satis ed with their products and services.

405010BW

-1410:00am to 6:00pm Monday through Sunday

1026 Main St. Lewiston • 208-743-1031 • www.LoloSportingGoods.com

LOLO SPORTING GOODS

Financing your business is an important decision. We offerYou can turn to your trusted credit union and our experienced staff to meet all of your business needs!

Business LoansRevolving Lines of CreditCommercial Real Estate Purchases & RefinanceCommercial ConstructionEquipment & Vehicle LoansWorking Capital LoansAsk about our other business services includingmerchant machines!

Business Services Center1025 Warner Avenue

Lewiston, ID

CCrraaiiiggggg EEmmerssooonnn JJJJJJJJJJeeeeeeerrrrrrrrrrrrrrryyyyyyyy EEEEEEEiiiiikkkkkkkkkkkuuuuuuuummmmmmmmm

Page 13: At Your Service, February 2014

A T Y O U R S E R V I C E S U N D A Y, F E B R U A R Y 2 3 , 2 0 1 4 13l E w I S T O N T R I B U N E

Emeritus at Juniper MeadowsEmeritus is the largest and most experienced providers of assisted living

throughout the United States and Canada. Juniper Meadows brings that level of exceptional care to the Lewiston Valley. We look forward to off ering families and prospective residents with a new lifestyle and living options that are laden with compassionate care and attention to daily details.

We feature 82 apartments, fi ne dining, daily activities, housekeeping, laundry services, a beauty shop, transportation, free parking and much more, all included in your base rent.

406721BW-14

Call today for your personal tour and information packet on Assisted Living

(208) 746-8676

“Our Family is Committed to Yours.”

2975 Juniper Dr., Lewiston, IDwww.Emeritus.com

Hear Again with Miracle EarFor 32 years Miracle Ear has been offering quality service to the area, and

owner Mark Banks is intent on keeping that tradition. Nearly 36 million Americans suffer from some form of hearing loss. At Miracle Ear we offer a free hearing test, free consultation, free otoscope inspection, free trial hearing aids and a free battery charger with every purchase. Many people go untreated simply because they have not had their hearing tested. Hearing loss can be gradual - often with age.

Mark has zero percent nancing, and he bills your insurance company for you. They also offer repair and service of all brands of hearing aids.

When you choose Miracle Ear, you get more than 1,200 Miracle Ear of ces across the country to serve you when you travel.

Let Miracle Ear get you back into life... Connecting people through communication.

1927 Idaho St., Lewiston, ID (208) 746-8547Open 9am to 5pm Monday through Friday and Saturdays by appointment.

406886BW-14

Page 14: At Your Service, February 2014

A T Y O U R S E R V I C E L E W I S T O N T R I B U N E20 S U N D A Y, F E B R U A R Y 2 3 , 2 0 1 4

Your locally owned rst stop hardware shop, for 118 years and counting!Hi, I’m Brett, my wife Laurie and I are the new owners of Erb’s Ace Hardware. We want to thank all of you in community

who have supported and continue to support us. We’d also like to personally invite anyone who hasn’t been into the store for a while, or maybe hasn’t ever had the experience of shopping at Erb’s to come by and see why we are consis-tently voted #1 in Hardware for the Lewiston-Clarkston valley.

Erb’s Ace Hardware carries all the top brands and is always adding new products. We offer an incredible line of services such as business dis-counts , special orders, paint color-matching, key cutting, lock rekeying, window screening, propane exchange, Rug Doctor, and U-HAUL rentals just to mention a few. Erb’s also offers delivery, so if you don’t have room in your car, don’t worry. We’ll go the extra mile, so you don’t have to.

1896 - An entrepreneur, E.P. Doris, relocates his hardware business from Farmington, Washington, to Lewiston Idaho. He opens a new store under the name of “Cash Hardware.”

1910 - Robert S. Erb, my great-great-great uncle, takes over ownership of the store under the new name Erb Hardware Company.

1970 - My grandfather Richard Bennett and his wife Joann, who owned stock in the company bought out the remaining shareholders.

2012 - Brett Toney and his wife Laurie make an offer to buy out the shareholders of Erb’s Ace Hardware. 2013 - The Toney family secures nancing and approval for the purchase from the Ace Hardware Corporation making

it a sole proprietorship. The rest is history!

208-746-0441 | 141 Th ain Road | Lewiston, ID. 83501.406350BW-14

Page 15: At Your Service, February 2014

A T Y O U R S E R V I C E L E W I S T O N T R I B U N E14 S U N D A Y, F E B R U A R Y 2 3 , 2 0 1 4

Lewiston743-1594

Clarkston751-9661

Orofino476-5589

Moscow882-3538

Pullman334-1835

Grangeville983-1650

Colfax397-4678

LewistonOrchards746-2948

DOING THERIGHT THING

SINCE 1952™

Les Schwab started the tire business in Prineville, Oregon, on January 1st, 1952. He came to Lewiston in 1966 and at that time purchased six locations from General Tire. They were tire stores in Couer d’ Alene, Moscow, Kellogg, Oro no, Grangeville and Lewiston. All locations opened on the same day, October 1st, 1966.

The Les Schwab company has come a long way since those days, there are now 450 locations in Oregon, Washing-ton, Idaho, Montana, Utah, Nevada, Colorado and California. If you need tires, batteries, wheels, alignment, shocks or brakes, see your local Les Schwab dealer today, service and warranty that can’t be beat.

Pictured here are the 20 full time employees at our store on 1408 Main Street, Lewiston. Ready to serve.

404508BW-14

Page 16: At Your Service, February 2014

A T Y O U R S E R V I C E S U N D A Y, F E B R U A R Y 2 3 , 2 0 1 4 15L E W I S T O N T R I B U N E

Lewiston Pre-Mix Concrete, Inc.Celebrating Our 69th Year in Business

Lewiston Pre-Mix is an L-C Valley tradition, serving the community since 1945. Lewiston Pre-Mix is the “Only” computerized central batch plant in the area, specializing in all aspects of residential and commercial building. You get friendly and helpful service from Anita Lafrenz Secretary/Treasurer/Advisor, Vicki Poffenberger of ce manager and Kevin Pickett in dispatch.. Our drivers are dependable and experienced. Lewiston Pre-Mix, Inc. is family-owned and has been for all 68 years of service to Valley residents. The current owner is area native Charles Lafrenz.

Store hours are 6:00a.m. to 4:30p.m. Monday - Friday

Con rmed orders only on Saturdays.1402 Snake River Avenue, Lewiston 4

04

26

1B

W_

14

743-3333Fax 743-1083

Lewiston PRE-MIX Concrete, Inc.BOX 646 • LEWISTON, IDAHO 83501

405015BW-14

D&D REPAIRALL MAKES, ALL MODELS

LOCATED AT 350 THAIN ROAD IN LEWISTONhas been repairing cars & trucks since 1975. From oil changes to computer system problems, let the certified mechanic handle your vehicle’s needs. A mom and pop business with one-on-one service. The person you talk to is the one doing the repairs.

• Brakes • Exhaust • Tune-ups• General Services

8:00am to 5:00pm Monday through Friday. Call 208-743-1880 for your appointment and

let us get to know you and your vehicle.

Dan & Twila would like to say thank you for trusting us for 39 years to repair your car or truck.

Family owned and operated providing elderly care in Clarkston since 1987.Providing private and semi private rooms in a home-like environment. Care for all levels of personal needs from bed fast to ambulatory. � ere is an on sta� RN and dietitian and a beauty shop onsite for haircuts and perms. A large outside fenced back deck overlooks mountains and open � elds, with a view of deer, birds and the occasional fox. Residents are cared for by highly quali� ed and companionate sta� on 24 hr wake shi� s. � ere is a nurse call system in all rooms plus medication monitoring, administration and assistance. A transport van with a wheelchair li� for fun rides and medical appointments.

Call Carol Galles or Ann Beyer 509-758-67701937 2nd Ave, Clarkston Heights

Family owned and operated providing elderly care in Clarkston since 1987.Providing private and semi private rooms in a home-like environment. Care for all levels of personal needs from bed fast to ambulatory. � ere is an on sta� RN and dietitian and a beauty shop onsite for haircuts and perms. A large outside fenced back deck overlooks mountains and open � elds, with a view of deer, birds and the occasional fox. Residents are cared for by highly quali� ed and companionate sta� on 24 hr wake shi� s. � ere is a nurse call system in all rooms plus medication monitoring, administration and assistance. A transport van with a wheelchair li� for fun rides and medical appointments.

Call Carol Galles or Ann Beyer 509-758-67701937 2nd Ave, Clarkston Heights

Avalon Progressive CareSenior Care Facility

Page 17: At Your Service, February 2014

A T Y O U R S E R V I C E S U N D A Y, F E B R U A R Y 2 3 , 2 0 1 4 21l E w I S T O N T R I B U N E

Clearwater Group at Morgan Stanley

Timothy Lynch, CFAPortfolio Management Director

Financial Advisor

Kenneth MaestasFinancial Planning Specialist

Financial Advisor

Eric JustisFinancial Advisor

518 Diagonal Street, Clarkston, WA 99403509-295-5175

www.morganstanleyfa.com/[email protected]

©2014 Morgan Stanley Smith Barney LLC. Member SIPC. CRC588400 (12/12) CS 7338862 MAR014 04/13

Morgan Stanley

Your wealth plan should keep up with the changing circumstances of your life, as well as with the cycles in the nancial markets. A new career, a new grandchild, a new business, a signi cant shift in your portfolio - any of these events could necessitate a fresh look at your strategy.

As Morgan Stanley Financial Advisors, we can work with you to develop a plan and then help you manage your investments and assets through life’s changes. Call today to arrange an appointment. We’ll work together to plan for what may come.

The riskiest nancial moveis doing nothing.

40

54

70

BW

-14

Timothy Lynch, CFA Ken Maestas Eric Justis

Personal Care ServicesHomemaker Services

Medication AssistanceMeal Preparation

Companion Care Shopping

Call us if you or someone you know needs our help,

Free In-Home Assessment.We accept Private Pay, Idaho Medicaid, Long-Term Care Insurance and Veterans Benefits.

A locally Owned and Operated Family Business since 1997. Licensed in ID & WA., Bonded & Insured.

Lewiston/Clarkston ..... 746-3017Moscow ...................... 892-3774

Orofino ....................... 476-7600 Kamiah ........................ 935-7797

Mike & Linda Weiss, Owners / Managers

Quality Care with a personal touch 2 to 24 hours a day,

365 days a year.Call the office nearest you.

407050BW-14

Care Connection Home Care, LLC

email: [email protected]

Page 18: At Your Service, February 2014

A T Y O U R S E R V I C E L E W I S T O N T R I B U N E16 S U N D A Y, F E B R U A R Y 2 3 , 2 0 1 4

Peterson Radiator, Muffl er & TransmissionJim Peterson, owner of Peterson Radiator, Muf er and Transmission, is celebrating his 19th year in business. Jim offers transmission, differential and radiator service and repair, brakes, tune-ups, cooling system repair and diagnostics, anything that will keep your vehicle running smoothly!More and more people are seeing the value of regular maintenance to extend the life of their vehicles.Jim’s employees have more than 100 years of combined automotive experience. Jim keeps computerized records of his customers’ vehicles, so the mechanics and the custom-ers know exactly what work has been performed. That means customers can expect years of dependable service from their vehicles. Jim offers a nationwide warranty and free shuttle service in the L-C Valley.

Shop the rest, come to the best

Mon. — Fri. 7:30 a.m. to 5 p.m. • 1014 Bryden Ave. Lewiston • (208) 743-5887 405011BW-14

Award winningRETIREMENT • ASSISTED LIVINGDedicated to excellent care everyday

Caring for Family the old-fashioned way - “at Home”

405013BW-14

Alzheimer’s & Dementia Care Specialists Th e CraftsmanTh e TudorTh e Cottage

Th e Timber Th e Liberty House2421 Vineyard Avenue, Lewiston • (208) 743-6500 • www.guardianangelhomes.com

Now Accepting Residents – Several Room Sizes AvailableNot accepting Medicaid at this time.

Th e Offi ce

Page 19: At Your Service, February 2014

A T Y O U R S E R V I C E S U N D A Y, F E B R U A R Y 2 3 , 2 0 1 4 17l E w I S T O N T R I B U N E

Whether you’re a party of 1 or 500, the Red Lion Lewiston has a dining option to suit your needs. Led by the award-winning Chef Doug Metzger, the culinary program at the Red Lion incorporates locally grown fl avors and heart felt service at every dining outlet. Chef Metzger has an exceptional record of service and experience at internationally acclaimed establishments such as the Century Plaza and Hotel Bel-Air. An award recipient of the Chaine des Rotisseurs and named one of the “Best Chefs in Los Ange-les”, Chef Metzger looks to bring a whole new culinary experience to Lewiston, Idaho.

Home-grown fl avors fi nd their way into breakfast, lunch and dinner at Meriwether’s American Grill. An extensive menu, full bodied northwest wine list and a warm smile showcase the many talents of the team at Meriwether’s. Whether you’re dining during the day or enjoying a romantic dinner for two in the evening, be sure to say hi to one of our long-term employee’s Nancy Lawrence or Kris Swearingen.

MJ Barleyhoppers may have earned its name as a late-night brewery, but it will earn your appetite as a smoke free family restaurant, sports bar and brew pub. Led by Joey Phillips, Barleyhoppers is the perfect place to enjoy a casual meal, watch the game, sample some of Lewiston’s fi nest home brews or take part in the nightly festivities.

For a quiet serene atmosphere stop into the Exchange Lounge and enjoy our full menu along with one of our many specialty cocktails.

When you’re looking to host the most talked about event in town, look to the Catering department at the Red Lion Lewiston. Led by Michael Jones, our catering team is equipped with the knowledge and experience to create a memorable event for 5 to 500.

So come on in, make 1 stop and enjoy 4 great dining options!

Michael Jones -- Catering Director, Doug Metzger -- Master Executive Chef, Laurie Wilson -- Sales Director, Kris Swearingen -- Meriwether’s Asst. Manager

406914BW-14

Page 20: At Your Service, February 2014

A T Y O U R S E R V I C E L E W I S T O N T R I B U N E22 S U N D A Y, F E B R U A R Y 2 3 , 2 0 1 4

“A Smile is the best curve on your body.”At Wilkinson Orthodontics, we believe in making treatment comfortable and catering

to your needs. Serving the valley since 2003, Dr. David Wilkinson off ers complimentary consultations, fl exible scheduling and convenient payment plans to better serve our patients.

Th e Wilkinson Orthodontic Team works hard for everyone in your family – children, teens and adults! We want everyone to feel comfortable and at home, off ering video games for kids and warm beverages for everyone.

Dr. Wilkinson provides thorough treatment planning, attention to detail, excellent materials, and time with each patient at appointments.

• Invisalign®• Clear brackets and fun shaped brackets• Soft Tissue Laser

• 3D Imaging – CBCT• Acceledent

3326 4th Street Suite 5, Lewiston(208) 746-0479

www.wilkinsonortho.com

406353BW-14

4020 Hatwai Road, LewistonVisit Us: www.graniteconceptsnw.com

Call for your free estimate: 208-746-8196

Come See The Largest Stone Selection In The Area!John and Chad McVicars, Mark Darnell and their crew at Granite

Concepts have been doing quality stone work in the region for more than 11 years.

They specialize in granite, marble, quartz, travertine, soapstone and limestone countertops for kitchens and bathrooms, as well as furniture tops, replace hearths, mantles, and tub/shower walls.

The custom outdoor essentials division has been a huge hit. They offer outdoor kitchens, featuring Firemagic and AOG grills and accessories, with custom stone application and countertops. Fire pits and replaces featuring Firegear, with custom stone application and countertops are also available.

Their reputation for quality work comes from their experience. This family owned and operated company offers the best selection in the area, free at-home estimates and full guarantees on all of their work.

40635340635306353406353406353006353063534063530636335 BW-14BW-1W-1W-1W-1W-1WW

44444444444444444440000000000000000000222222222222222222000000000000000000 HHHHHHHHHHHHHHHHHHHaaaaaaaaaaaattttttttttttttttwwwwwwwwwwwwwwwaaaaaaaaaaaaaiiiiiiii RRRRRRRRRRRRRRRRRRRRRRooooooooooooooooooaaaaaaaaaaaaaaadddddddddddddddd,,,,,, LLLLLLLLLLLeeeeeeeeeeewwwwwwwwwwwwwwwiiiiiiiiissssssssssstttttttttttttttttoooooooooooonnnnnnnnnViViViViViiViViViViViViViViVisisisisisisisisisisisisisisissiittttttttttttttt UsUsUsUUssUsUsUsUsUsUsUUsUsUUUsUs::::::::: wwwwwwwwwwwwwwwwwwwwwwww.w.w.w.w.www.wwwwwwwwwwww grgrgrgrgrgrgrgrgrggrggrgg ananananananannanaanititittititititittitititecececececececececeeeceeeccononononononoonono cececcecececececececceccceptptptptptptptptpptptpttttp snsnsnsnsnsnsnsnsnnnsnsssss w.www.ww.w.w cocococoococoococcc mmmmmmmmmmmmmmgggggggg pppppppp

CaCaCaCaCaaCaCaCaCaCCCaCalllllllllllllllllllll ffffffffffffffffffororororororororororororororrr yyyyyyyyyyyyyyouououououuouououuouuuuouurrrrrrrrrrrrrr frfrfrfrfffrfrfrfrfrfrrffffreeeeeeeeeeeeeeeeeeee eeeeeeeeeeeestststststtstsststtimimimmimimimmimimimimmmimmmmmmataatatattatatatataatattte:e:e:e:ee:e:e::eeee: 2222222222000000000000888888888888888----777777777777777444444444444666666666-----888888888888111111111199999996666666

JoJoJooJoJoJoJooJoJJooooooJooJJJJJoohnhnhnhnhnhnnhnhnnhhhnhnhnhnhnh aaaaaaaanndndndndnd CCCCCCCCCCCCCCCChahahahahahahahhhh dddddddddddd McMcMcMcMcMcMcMcMMcMMMMMcViViViViViViVViV ccacacacacacacaaaccacaaccc rsrrsrsrsrsrssssrsrr ,,, MaMMaMaMaMaMaaMMMaMaMMMM rkrkkkkkrkrkkkkkkk DDDDDDDDDaaaararararraaaararararneneneneneenenelllllllllllllllll aaaaaaaaaaaanndndndndndnndnnnnnd ttttthehehhheheheirriririririr cccccccrererer wwww atattatta GGGGGGGGrarrraarar nininiiiiininininnn teteteteeeteteteteteteeeCoCoCoCoCoCoCoCoCCoCoCoooCCooConcncncncnnncncnnccnn epepepeppepepepepeppee tstsstsssstss hhhhhhhavavvvaaaavaaaava eeeeeee bebeeeebeeeeebeebebebeeneeneneneneeneenn dddddddddoioioiooioooo ngngngngngnngnnngg qqqqqqquauauaauauauaauauauauuauu lilililililillllililiiiitytytytytyytytyytytytytyyttytyyyyyy ssssssssstotototototoototoooneneneeneneenennennenne wwwwwwwwwwwwooorooororororororoorooororororoorkkkkkkkkkkkkkk ininnninniininni tttttttthehehehehehehehehehheheheeh rrrrrrrrrrrrrregegegegegegegegeeeggioiooiooioiooonnnnnnnn fofofofofofofofoffofofoofooorrrrrrrrr momomomomomomoorerererereerererreeththhthththththhthtt aananananananan 1111111111111111 yyyyyyeyeyeeyeeyeyyeyeey arararaaarararaarrs.s.ss.ss.ss

ThThThThThTThThTTTTTTTTTTT eyeyeyeyeyeyyyyyeyy ssssssssssssssspepeeeppepepepepeppepepepeepp cicicciialaalalalalalaalalizizizizizizizizii eeeeeeeeee innninninin gggggggggrarararararaninnininin tettttte, mamamamamamaaaaarrrbrbrbrbrbrbbbbbrrbleleleleelelelellelleel ,,,,, quuuquuuuqqqqqq araarararrrrraarararrrrtztztztztztztztztztzzztzzzzzz,,, trtrtrtrtrtrrtrtrtrttrraavavaavavaavaavavvvavverererrrererrerrerere titttitititiiiittineneneneeee,,,,,,, sosososososososoooapaaapapaapapapppappaappstststststtstssssssstononononnoononooooo eeeeeeee anananananannannddddddddlilililillililililiiiimemememememeememmmemmeeeeestststststststtttstss ononoononononononononooneeeeeeeeee cocococococococococoooocounununununnnnntetteteteteetttertrtrtrtrtrrtrrtrrtr opopopoppoppppopopopopoppssssssssssss fofofooffff rrrrr kikikikikkkkitctcccctctcttctctct hehehehehehehhehh nsnsnsnssnsssssnsnnnsns aaaaaaandndndndndnddndnddndndd bbbbbatataatatatataatata hrhrhhhhrhrhrhrrhhrhrhroooooooooooooooooooooo msmsmsmmmmmmmmsmm ,,, asasasasasasasasassa wwwwwwwwwwelelelelelelllllllll assasassas ffurrrrrrurninininiininitutututututututurererererereeertotototototootottottt pspspspspspssspsssspspspspspspssps,,,,,,,, rererererererereerepplplplplplpllplplppppp acacacacacaaacaacacacacacaaaa eeeeeeeeeeee hehehehehheheheheehh ararararararraraaa thththththththhththht s,s,s,s,s,s,ssss,, mmmmmmananannnannnnnntltltltltltltttltllllttt esesesesesessesesesssseese ,,,,, ananananananndddddddddddddddddd tuttuuuuuuutuututuutub/b/b/b/b/b/b//b/bbbbbbb shshshhshhhsshshhowowwwowowoowwererererereereereeerrrerrrr wwwwwwwwwwwwwwwwwwwwaalalalaaaa lsslsssssssssss..

ThThThThThhhhhhhhhThThThThhThThhTheeeeeeeeeee cucuccccucucccuccucucccucucuststststststststststtststomomommomommommmmmmm ooooooooooooooutututututtututututtdodododdoddodododoododdooororororooooooo eeeeeeeeeeesssssssssssssssssss enenennenenenenenenennnntititititititittitititititit alalalaaaaalalalalaaaalalaaa ssssssssssssssss didididididididididididiidddd vvivivivivivvvivvvv sisissiiiisssissssssssisssisisisiissiononooooonononononnnnnonoooo hhhhhhhhhhhhhhasaasasasasasasaasasasasasasaa bbbbbbbbbbbeeeeeeeeeeeeeeeeeeeeeeeennnnnnnnnnn aaaaaaaaa huhuhuhuhuhuhuhhugegegeeeegeeeeeegegegegeege hhhhhhhhhhhhhhitititititittitittit... ThThThThThThThhThhhhhhThT eyeyeeyeyeyeyeeyeyeyeyyeey ooooooooffffffffffferrereereererrooououuuoouuouooutdtdtdtdtdtdttddtddttdtdttddoooooooooooooooooooooooooooooorrrrrrrrr kkikikikkikiiiikkiikitctctctctctctctctctctcttcctcchehehehehehehhehehhhehhehhheh nsssnsnsnssnsssnsnsnns,,,,,, fefefefefefeeffef atattatatattaaa ururrruruuru iniininninnnnnnnngggggggggggg FiFiFiiiFirerereeeeerer mamamamamamamaamam gigigigigggigigigigigig cccccccccc ananaaanananaaaaananaannaaa dddddddddddd AAAAOAAOAOAOAOAOAOAOAOAOOAOOAOAAAOA GGGGGGGGGGGG grgrgrgrgrgrgrgrgrrgrgrggrrrrrggrililiilililiilillilillslsssssssllslsl aaaaaandnddndddnn aaaaaaaaccccccccccccccceeeeesessseesssosososososoososoooooririrrr esesee ,,,,,,wiwiwiwiwww ththtthh cccccusuususussususssu ttotototottootototototoottotootoommmmmmmmmmmmmm ststststststtstststsss onononoonono eeeeeeee apapapppappappaaaaapplpllplplplplplp iccicicicicciciccccatatatatatataatatatataataatioiooioioiioioiooioioonnnn annanana ddddddddd coooocooococounnuuununnu teteeteteteteteteeertrtrtrtrtrtrttttrtopopopopoppopooopo s.s.s.s.s.s FFFFFFFFFiriirirririrrirreeeeee pipipipippipipipipipipipippp tststststststsssststs aaaaaaaaaandndndndnddddnd rrrrrrrrepepepepepepeppepplaalaaaaaaaaceecececeeeeeeeceesssfefefefeatatataataaaa ururuuuuu inii ggg FiFiFFFirererereegegeeeeeegegeg ararararaararar,,,,, wiwiiwiwiwwiwwwwww thththththththtthhthhthththt ccccccccccccusususususussussusususuusuu tototototottootootootooommmmmmmmmmmm ststtststtsttstststststonononononononnnonnnonononoonnonnnnonneeeeeeeeeeeeeeeeee apapapapapaaapppppllplplplplplplplplppppppppp iciciciccciciccatatatataatatataaaa ioioiooioiooooiooioiooonnnnnnnnnnn ananananannnananaaaa dddddddddd cocococcoccocococounununnnnuuuuuu teteteteeeeeertrtrtrtrtrtrtttttrtopopopopoppoppoppopoppoppppppssssssssssssssssssssss arararararararararraaaa eeeeeeeeealallallaalaaa sosososos aavavailillabaabaaaaaaaaaaaa lele.

ThThThThThThThThThTT eieieeeieeeeirr rereeeererererererepupuuuupuuupup tatatt tiiononoono fffffororooo qqqqqqqquauauaaaaaauallilillililiilitytytytytytytytytytytyttyy wwwwwwororrorororrorkkkkkkkkkkkk cocococococooocooomemememememeemmmeemmmmmmmemeessssssssssss ffrfrfrfrfrfrfrfrf omomomomomomommomommmmmmomm tttttttttheheheeheheheheeeeh iiiriririrrrirrirr eeeeeeeeeeexpxpxpxpxpxpxxxx erererrrrerrrieieieieieieiieieeiencncncnccncncncncnce.ee.e.ee.e.eee TTTTTTTTTTThihihihhihihihhiih ssssssssssffafafafaaaafafaafafffaamimimimimimiimimimimimimilylyyylyylyyylylyyyy ooooooooownwnwwnwwnwwnwnnwwww eededdddd aaaaandndnnndnnnd oooopepepepepepepp raraaatetetetetetetetetedddddddddd cococoocooocccooooooompmpmpmpmpmpmpmpmmmpmpmpmm anananananannannnnnaanaanyyyyyyyyyyyyyyyyyyy ofofofofofofoofooofo fefefefefefefefeefefeeffersrrsrsrsrsrsrsrsrss tttttttthehehhehehehehhhehehe bbbbbbbbbbbbbeseseseseseseseseeseesseseseseseseseesttttttttttttttttt sesessesesesesesesseleleleleleeleelelectctctctctctctioioioioioioioioi nnnnnnnnn inininnininininnnnn tttttttttthehehehehehehhehheheharaararrarararararrrrara eaeaeaeaeaeaaeaaeaeeeae ,,,,, frfrfrfrffrfrfrffrfrrreeeeeeeeeeeeeeeeee aaaaaaaaat-t-t-t--t-tt hohoohh meeeemememme eeeeeeesttstimmimimimimatatataatessesesesesesssessse aaaaaaaaaaandndndnddnddndndndddnnnnd ffffffffffffululululululuuuuuu llllllll guguguguuggugugguggug araarararararaarararraananananannanannana teteteteteteteeeeeeeeseseseseseseesesesseseesseseee ooooooooooooooonnnnnnnnnn alalalalalalaaa lllll ofofofoofofofof tttttttttheheheheheheheheheh iriririrrirrr wwwwwwwwororoororororooro kkk.kk.kkk

Garlinghouse Memorials"We can help celebrate life."

Garlinghouse Memorials began serving the community in 1903, and owners Gary and Kay Stilson have prided themselves on carrying on the business' long tradition of service for the last 22 years.

We here at Garlinghouse design, create and produce cemetery monuments and markers, as well as civic memorials, granite signs and benches. We also provide pet memorials, garden rocks, welcome rocks and granite greeting cards. We also do on-site engraving and monument restoration.

We pride ourselves in providing one of a kind memorials for that special loved one. We make those special memories come alive in granite – special scenes, photos and those things that meant so much to your loved one.

All of our work here at Garlinghouse is done in our local plant at 1603 Main Street in Lewiston. We have a Certi ed Memorialist on staff, a recognized earned designation by the Monument Builders of North America (MBNA).

8 a.m. to 5 p.m. Monday-Friday; evenings and Saturdays by appointment(208) 743-2471 [email protected]

Gary and Kay Stilson

4 0 6 8 8 5 BW- 1 4

Page 21: At Your Service, February 2014

A T Y O U R S E R V I C E L E W I S T O N T R I B U N E18 S U N D A Y, F E B R U A R Y 2 3 , 2 0 1 4

STRIPES-A-LOTPavement Striping & Seal Coating

Since 1996, Stripes-A-Lot has been in the business of saving you money with its full-service attention to asphalt maintenance. Owner Glenn Scharnhorst serves the Lewis-Clark Valley and the surrounding area by offering asphalt seal coating, parking lot striping, patching potholes, and doing highway center lines. Recreational court striping, ADA parking and compliance signs are also available. Need old stripes removed? Stripes-A-Lot can do that too.

A 4 0 4 3 8 6 B W _ 1 4

At Stripes-A-Lot we say: “We lay down the line — when it comes to quality.”

(509) 758-0570 Clarkston, Washington

SEALED VS. UNSEALEDProblem: Left untreated, asphalt pavement will deteriorate rapidly. The asphalt binder that

holds the pavement together begins to oxidize and weather soon after installation. Moisture penetrates the asphalt causing further damage and deterioration to the pavement.

Evergreen Estates Retirement & Assisted Living Community

(509) 758-52601215 Evergreen Court, Clarkston, WA

www.evergreenestatesclarkston.com

Many times family and friends become concerned and troubled when it becomes apparent that their loved ones can no longer function safely living alone in their own homes. EVERGREEN ESTATES ASSISTED LIVING COMMUNITY provides 24-hour care through needed supervision, meals, laundry service, personal care, activities and special outings.

We strive to maintain independence for each of our residents and the secure, warm, caring environment will enhance their golden years.

Under this same roof we have EVERGREEN ESTATES INDEPENDENT RETIREMENT LIVING where meals, housekeeping and a variety of activities are provided. You still have your independence, security and a place you will be happy to call home.

EVERGREEN ESTATES is located at 1216 Evergreen Court, Clarkston, WA 99403 on the Tri-State Hospital Campus or visit us at www.evergreenestatesclarkston.com.

Th e administration and the staff appreciate your trust and the many families throughout the area who depend on us, and we invite your calls and visits! 4

04787BW-14

Orchard Lanes

3721

62BX

-13Orchard Lanes and Strike & Spare Bar & Grill have been in business since 1959. They

are located at 244 Thain Rd in the Lewiston Orchards. They would like to thank their many loyal customers for their patronage throughout the years!Orchard Lanes has new SPL synthetic lanes with bumpers available on all 16 lanes. They encourage bowling for the whole family (10am-11pm daily, noon-10pm Sunday) in a smoke-free environment. They also have several bowling leagues and specialize in kid’s birthday bowling parties. Spring and Summer Leagues are forming now, be sure to call ahead because they fill up fast! Every Monday is “Penney A Pin” from 9-11pm. Wednesday is “Cheap Date Night” from 9-11pm, cost is $7 for unlimited bowling/shoe rental. Friday & Saturday 9pm-midnight is “Thunder Alley”. Coming soon, Super Bowl Seattle Seahawks bowling balls in the fully-stocked pro shop!Strike & Spare invites you to try one of their fresh baked “Simply Pizzas,”served on a special Italian gourmet crust, with traditional, mustard or BBQ sauce. As always, their famous Jumbo sandwiches and soups are served daily. New menu item – The “Dougy,” their rendition of a hot turkey sandwich. Tuesday and Friday are Prime Rib and bite size dinner nights. Smoke-free family dining is open 11am-10pm daily and noon-10pm Sunday. Happy Hour in the bar is 3-6pm daily. Featuring $1.25 domestic tubs, $1 off well drinks, 3 rotating microbrews on tap, now filling Growlers, and they also feature $4 select appetizers.We have something for everyone! See you soon!

RyanKnieriem

JackieRichardson

Lanes208-743-7822208-743-4742

Page 22: At Your Service, February 2014

A T Y O U R S E R V I C E S U N D A Y, F E B R U A R Y 2 3 , 2 0 1 4 19l E w I S T O N T R I B U N E405559BW-14

Dave's Auto & Truck CenterDave & Bobbie Beuke and the crew have been in business as a team for 50

years. Collision repair on cars and trucks is the specialty at Dave's. Dave's is the only business in the valley that can straighten heavy duty axles on trucks and travel trailers, and frames on everything from automobiles, P.U. and heavy duty trucks. They offer a laser system to check the rear-end alignments.

Dave's offers auto, truck, and RV collision repair and painting, four way alignments on all classes of autos and trucks and front-end suspension repair and replacement parts. RV owners should take advantage of the front and rear alignment services to ensure they don't get tire wear.

Dave's maintains a reputation of being one of the best when it comes to paint matching all types of vehicles. They also do berglass repair and air conditioning. Dave's also has used cars and P.U.s.

Stop in and see their new of ce at 300 Diagonal and say Hi! Business hours are from 8 a.m. to 5 p.m. Monday through Friday.

(509) 758-3369Dave and Bobbie Beuke

1504 8TH STREET • LEWISTON, ID 83501 208.743.9426 • 800.615.8418 • 208.748.9433 FAX

• Home• Auto• Life• Disability

• Long-Term Care

• MajorMedical

• BusinessInsurance

• GroupMedical

James R. SattlerCPCU, CIC OWNER/SALES

www.sattlerins.com

We Are YOUR Independent Full Service Insurance Agency

Nancy SattlerOWNER/ACCOUNTING

Katy MillerOWNER/MANAGER

PERSONAL

Renea HollandACCOUNT MANAGER

COMMERCIAL

Denise LeeperACCOUNT MANAGER

PERSONAL

Leslie VannoyOWNER/MANAGER

COMMERCIAL

Tyler MartinSALES

COMMERCIAL

Diana HaleSALES

GROUP HEALTH

Ashley StephensACCOUNT MANAGER

COMMERCIAL

Sherri SkalickySALES

HEALTH/LIFE

Holly FriedeACCOUNT MANAGER

COMMERCIAL

Wendy AlbrightACCOUNT MANAGER

COMMERCIAL

Kara AikenRECEPTIONIST

406890BW-14

Page 23: At Your Service, February 2014

A T Y O U R S E R V I C E S U N D A Y, F E B R U A R Y 2 3 , 2 0 1 4 23l E w I S T O N T R I B U N E

1010 Bryden Ave. Suite A • LewistonWWW.PTPEAK.COM208.746.0455

INDIVIDUALIZED“Hands-On” Care

• Orthopedic Injuries• Pre & Post Surgical Rehab• Back & Neck Pain

• Foot & Hand Therapy• Work Related Injuries• Motor Vehicle Injuries

Left to Right: Dave Biery (Owner), Tami Biery (Physical Therapist/Owner), Annie Kane (Rehab Aide), Sara Roy (Rehab Aide), Tony Edmison (Rehab Aide),

Joanna Alford (Physical Therapist) and Jamie Larson (Physical Therapist).

YOU HAVE A CHOICE.

ASK YOUR DOCTOR TO REFER YOU TO...

4 0 4 6 7 0 BW- 1 4

Good reputations speak for themselves and that’s exactly what the Golden Dragon Restaurant has established throughout 36 years of business in the Lewis-Clark Val-ley. From fresh stir-fry dishes to hamburgers, locally owned and operated, the Tsang family takes great pride in cooking Chinese and American food. Lunch and Dinner specials available. The Golden Dragon also has a refreshing selection of soda, beer and wine. Take out orders are always cheerfully packaged and delivery is available. The Golden Dragon Restaurant also offers a private banquet/conference room that

them next to the rose garden in North Lewiston just off Highway 95.Check out our menu at www.goldendragonlewiston.com

Like us on FacebookOpen from 11:30 am to 10:00 pm daily

Closed some holidays.

Established in 1977

Golden Dragon"Golden Dragon lives up to expectations"

Page 24: At Your Service, February 2014

A T Y O U R S E R V I C E L E W I S T O N T R I B U N E24 S U N D A Y, F E B R U A R Y 2 3 , 2 0 1 4

Elm View Chiropractic ClinicOwned by Terri J. Drury, DC

Celebrating 22 years in Practice in Clarkston! The Health Care Environment is changing and it is exciting to see the growth in Chiropractic both in patient trust and acceptance! I continue to strive towards excellence in patient care and in our family friendly environment! Chiropractic

adjustments bene ts all ages! I utilize several adjusting techniques, cold laser therapy, nutritional counseling and loving hands. Most insurance is accepted including Medicare, Workers Compensation and Auto Injury. My staff can assist you with scheduling an appointment and answering your nancial questions. I am accepting new patients.

4 0 4 5 3 5 BW- 1 4

Clarkston Of ce hours: Monday and Wednesday 8:30-5:30pm; Thursday 9:00-6:00pm; Friday 8-12 noon. Closed Tuesday.

1303 Sixth Street, Clarkston, WA • 758-0660

KENNEDY’S BODY + PAINT, INC.0122 26th St., Lewiston, ID.

Open from 8am to 5pm Monday - Friday208-746-0634

Larry, Bonnie & John Kennedy and the crew have been serving the valley for 39 years since 1975. For all types of collision repair on cars and trucks. We off er the latest frame measuring equipment from Car-O-Liner. Also new wheel alignment measuring equipment from John Bean to take care of any suspension problems you may have.

Also new spot welding equipment from Car-0-Liner to insure proper spot welds on all the new types of high strength steel “Boron Types.” New scanner tool for pulling or re-setting codes.

We still maintain a reputation of being one of the best when it comes to painting and paint matching of all types of vehicles.

406356BW-14

APPLIED SURFACES TECHNOLOGY, INC.“Your L C Valley Flooring Connection”

www.LCValleyFlooring.com e-mail: [email protected]

1020 Port Dr. Clarkston 509-758-8016“Financing Always Available!” O.A.C.

At A.S.T., we stay up with the “technology” of fl ooring and bring this valuable information to our valley. Allow us to enhance your home or offi ce

with the combination of our 30+ years of experience and your creativity.

407049BW-14

• Carpet• Tile

• Wood• Granite

• Linoleum• Shower Water Proo ng

Page 25: At Your Service, February 2014

A T Y O U R S E R V I C E S U N D A Y, F E B R U A R Y 2 3 , 2 0 1 4 25L E W I S T O N T R I B U N E

Shelli McMurry -- General Manager, Nic Benton -- Asst. Manager/Personal Trainer and Eve Swensen -- Our Long Time Employee

Step in and see why Adcope is Lewiston’s nest full-service athletic club. As a member you’ll enjoy all the services you’d expect from a tness club, plus the added bene ts of group class, indoor acquatic mineral pool, private locker rooms with Jacuzzi’s, daily child-care and much more. Our staff is here to help you achieve your tness and health goals. From Shelli, our new club manager who comes with an extensive knowledge of management and athletic skill to Nic our per-sonal trainer, we’re here to transform your body and your life. Whether you’re taking a Zumba class with Tammy, or getting ripped in Bootcamp with ACE certi ed trainer Deb, we know you won’t be disappointed with our facility or our staff. Visit our website for a full class schedule or stop by for a complimentary tour and 5-day pass.

– Free Weights– Group Classes– Cardio Room

– Indoor Racquetball Courts– Personal Fitness Trainers

– Men’s & Women’s Locker Rooms– Indoor Acquatic Mineral Pool

– Massage Services– Child Care Facilities

406915BW-14

509.751.9143 Fax [email protected]

www.interlinkvolunteers.org

Our mission is providing volunteers to enable seniors and others to live independently in their own homes. Direct services include local and long-distance transportation to medical care

and personal care appointments, shopping – including shopping for you, rides to your bank, visiting a friend, and running errands. In addition we build and repair wheelchair ramps, do yard work, accomplish minor home repairs, and help with moving. There is never a charge for our services.We are the only local service agency providing no charge transportation to seniors and

others. Our volunteers provide grace and kindness to those we serve, as we do everything within our means to help folks stay living at home.

During our thirty years Interlink Volunteers has provided thousands of transports for medical and other care appointments. We have built hundreds of wheelchair ramps, and raked leaves in many yards. Thousands of volunteers have driven in excess of One Million Miles providing services to hundreds and hundreds of care-receivers during this time, bringing goodness throughout our communities of Lewiston, Clarkston, Lapwai and Asotin. The blessings of countless donations support our efforts day by day. We depend on your steadfast support to allow us to provide services to the grandmas and grandpas among us. Thank you. God bless you.

Our office is staffed Mondays through Thursdays 9AM – 4PM. Transportation services are provided Monday – Friday. All other services are provided on a schedule set by conversation between the care-receiver and volunteer.

Oand personal care appointments, shopping – including shopping for you, rides to your bank, visiting a friend, and running errands. In addition we build and repair wheelchair ramps, do

others. Our volunteers provide grace and kindness to those we serve, as we do everything within 817A 6th Street, Clarkston, WA

Everyday Heroes Face to Face

Faith in action

Page 26: At Your Service, February 2014

A T Y O U R S E R V I C E L E W I S T O N T R I B U N E26 S U N D A Y, F E B R U A R Y 2 3 , 2 0 1 4

4 0 6 3 5 5 BW- 1 4

2007 14th Ave., Lewiston, ID 83501 | 208-743-5533

Since 1947 Farm Bureau Mutual Insurance Company of Idaho has been committed to protecting Idaho's families and communities. Our strong and steady growth has made us one of the state's leading auto insurers as well as the largest writer of farm and ranch insurance. Our product line includes automobile, homeowners, commercial, ood, crop hail, health, life insurance and retirement funding.

Call or come by for a free, competitive quote." WE KNOW IDAHO. WE GREW UP HERE."

Agents: Tim Kasper, Doug Wheelock. CSRs: Melanie Dodd, Suzie Stewart. Adjusters: Brian Hogan, Steve Schlottman. Agency Manager: Phil Zemaitis. Crop Specialist: Kim Borgen

406355BW-14

Page 27: At Your Service, February 2014

A T Y O U R S E R V I C E S U N D A Y, F E B R U A R Y 2 3 , 2 0 1 4 27l E w I S T O N T R I B U N E

Page 28: At Your Service, February 2014

A T Y O U R S E R V I C E L E W I S T O N T R I B U N E28 S U N D A Y, F E B R U A R Y 2 3 , 2 0 1 4

We off er a wide variety of Services and Facilities: 3 Chapels Mausoleum & Columbarium Reception Room Crematory Cemetery Traditional Funerals Graveside Services Cremation Graveside Services Traditional Funeral followed by Cremation Memorial Services Simple Burial Simple Cremation*

*Usually less than Spokane Cremation Societies

Mountain View Funeral Home & CrematoryLewis Clark Memorial Gardens

Merchant Funeral HomeRichardson-Brown Funeral Home

We are experienced with services for every belief and faith, and are proud to off er dignifi ed care to everyone in our community.Your trust means everything to us, and we thank you for that trust for over 100 years.

No one wants to plan a funeral.However, when you lose a loved one, you can trust us to provide professional care, and to respect the concerns and the budget of your family.

merchantmemorialgroup.com

40

45

34

BW

_1

4


Top Related