ZOOTAXA

ISSN 1175-5326 (print edition)

ISSN 1175-5334 (online edition)Copyright © 2017 Magnolia Press

Zootaxa 4290 (1): 167–176

http://www.mapress.com/j/zt/Article

https://doi.org/10.11646/zootaxa.4290.1.10

http://zoobank.org/urn:lsid:zoobank.org:pub:8DB33697-570D-4640-B1D6-EFB0DD759832

Morphological and molecular characterisation of Discotylenchus lorestanensis sp.

n. (Nematoda: Tylenchidae) from Iran

FATEMEH MEHRABIAN, KOUROSH AZIZI1, EADI BAZGIR & MOSTAFA DARVISHNIADepartment of Plant Pathology, College of Agriculture, Lorestan University, Khoramabad, Iran1Corresponding author. E-mail: Kourosh.azizi85@gmail.com

Abstract

Discotylenchus lorestanensis sp. n., recovered from soil near Persian oak (Quercus brantii Lindl.) from the Lorestan prov-

ince of Iran, is described and illustrated based on morphological and molecular characters. The new species is character-

ized by females with a body length of 449–566 μm, a = 28.3–39.5) b = 5.2–5.8, c = 6.2–8.1, c' = 5.8–9.2, V = 63.3–71.1%,

stylet 8–9 μm, spermatheca lobed and offset, filled with rounded sperm, post-vulval uterine sac (PUS) 4.8–6.5 μm, tail

length 66–78 μm, not filiform, tapering to a rounded tip; and males with spicules 13–16 μm long. The new species has

unique molecular sequences of SSU and the D2–D3 region of LSU expansion segments, Discotylenchus lorestanensis sp.

n., separated from all known species of the Tylenchidae. We also provide an updated dichotomous key to the genus Dis-

cotylenchus.

Key words: 18S rDNA, 28S rDNA, D2–D3 region, morphology, morphometric, oak

Introduction

Siddiqi (1980) proposed the genus Discotylenchus in the family Tylenchidae Örley, 1880. Discotylenchus has a markedly tapering, smooth cephalic region, with an offset, distinct perioral disc, and lightly sclerotized framework. The amphids are longitudinal slits at the base of the perioral disc (Siddiqi 1980). Siddiqi and Lal (1992) transferred two species of Ottolenchus Husain & Khan, 1967 to Discotylenchus that had been introduced as O.

azadkashmirensis Maqbool & Shahina, 1985 and O. longicauda Maqbool & Shahina, 1985. Mizukubo (1993) described Filenchus discolabialis, later transferred by Siddiqi (2000) to Discotylenchus. To date, seven valid species, reported from all continents, are placed in the genus Discotylenchus: D. discretus Siddiqi, 1980 [type species], D. attenuatus Siddiqi, 1980, D. azadkashmirensis (Maqbool & Shahina, 1985) Siddiqi & Lal, 1992, D.

brevicaudatus Brzeski, 1986, D. discolabialis (Mizukubo, 1993) Siddiqi, 2000, D. iranicus Ghaemi, Pourjam, Atighi, Pedram & Karssen, 2012, and D. longicauda (Maqbool & Shahina, 1985) Siddiqi & Lal, 1992. However, D. iranicus was later transferred to the recently described genus Discopersicus Yaghoubi, Pourjam, Álvarez-Ortega, Liébanas, Atighi & Pedram, 2016. Two species of Discotylenchus have been recorded in Iran: D. discretus, and D. brevicaudatus. In the present study, a description of D. lorestanensis sp. n., is given, with detailed morphology and molecular data for the Iranian populations of this species. An identification key is also given for the valid species of the genus. Full length 18s SSU rDNA and the D2–D3 expansion segment of LSU rDNA were sequenced for two isolates of D. lorestanensis sp. n., and these sequences were compared with those of some other Tylenchidae to determine phylogenetic relationships within the family.

Materials and methods

From May to October 2014, seventy soil samples were collected from oak forests in Khoramabad county, Lorestan province, western Iran. Nematodes were extracted by the Whitehead tray method (Whitehead & Hemming 1965),

Accepted by P. Mullin: 29 Mar. 2017; published: 6 Jul. 2017 167

and were killed and fixed with hot FGA (formalin, glycerin and acetic acid) (De Grisse 1969). FGA-fixed individuals were transferred to anhydrous glycerol according to the method of De Grisse (1969) and permanent slides were prepared. Measurements were made and photomicrographs taken using a light microscope (Olympus BX51), equipped with a Dino-eye microscope eye-piece camera in conjunction with Dino Capture version 2.0 software. Drawings were made using a drawing tube attached to a light microscope and were redrawn using Photoshop 7.0 ME software.

For molecular analysis, nematodes were identified by microscopic observation, and a single nematode was transferred to DESS and then to a 0.2-ml PCR tube containing 25 μL of sterile de-ionised water. For lysis, 25 μL lysis buffer containing 0.2 M NaCl, 0.2 M Tris–HCl (pH 8.0), 1% (v/v) β-mercaptoethanol, and 800 μg/mL proteinase-K was added (Holterman et al. 2006) and incubated at 65°C for 30 min followed by 99°C inactivation at 900 RPM using a Thermomixer (Eppendorf). The lysate was used for the PCR reaction. Primer combinations used for LSU amplification were D1A (5’– TTAAGCATATCATTTAGCGGAGGAA–3’ forward; Holterman et al. 2008) and D3B (5’– CCAGTTCTGCTTACCAAAAATG–3’ reverse; Azizi et al. 2016), or D2A (5’– ACAAGTACCGTGAGGGAAAGTTG–3’ forward; Nunn 1992) and D3 (5’– TCGGAAGGAACCAGCTACTA–3’ reverse; Nunn 1992). PCR was performed in a final volume of 25 μL containing 3 μL lysate, 0.2 µM of each PCR primer and a Ready-To-Go PCR bead (Amersham, Little Chalfont, Buckinghamshire, UK). The following PCR program was used: 94°C for 5 min; 5× (94°C, 30 s; 45°C, 30 s; 72°C, 70 s) followed by 35 × (94°C, 30 s; 54°C, 30 s; 72°C, 70 s) and 72°C, 5 min.

For cloning, gel-purified amplification products (Zymoclean Gel DNA recovery kit) were cloned into a Topo2.1 vector (Invitrogen) using Top 10 chemically competent cells. Cloned fragments were sent out for sequencing using standard procedures (Macrogen, Korea).

The newly obtained 28S rDNA sequences were aligned using the Clustal W algorithm as implemented in BioEdit 5.0.9 (Hall 1999) with available sequences of Tylenchidae in GenBank (accession numbers: see Table 2). The alignment was manually refined and a Cephalenchus hexalineatus (Geraert, 1962) Geraert & Goodey, 1964 (GenBank accession number EU915493) sequence was included as outgroup. The full-length SSU rDNA sequences were aligned, using ClustalW as implemented in BioEdit 5.0.9 (Hall 1999), with Tylenchidae sequences obtained from GenBank (accession numbers: see Table 2). The alignment was manually refined and Cephalenchus

hexalineatus was again used as the outgroup taxon (AY284597). A Bayesian phylogenetic tree was constructed using MrBayes v.3.2 (Ronquist et al. 2012) using the GTR+I+G model. Four parallel runs with four chains each

were run for 1 × 106 generations for the D2–D3 region of LSU and 500,000 generations for the complete SSU dataset. The first 150,000 and 100,000 generations, respectively, were discarded as burn-in for the LSU and complete SSU and 50% majority-rule consensus trees were constructed from the remaining samples.

Results and discussion

Description of Discotylenchus lorestanensis sp. n.

(Figures 1 & 3; Table 1)

Female. Body straight or slightly curved ventrally after heat fixation. Cuticle with fine transverse annuli, 0.8–1 μm wide at mid-body. Lateral fields with two incisures, almost one-fifth as wide as body diameter. Lip region continuous, with distinct disk, 2–3 μm high and 5–6 μm wide at base; disk diameter 3–4 µm, cephalic framework poorly developed. Amphidial aperture longitudinal slit. Stylet short with rounded knobs, Conus slightly shorter than the shaft, 40.5–47.2 % of total stylet length (figures 1B and 2C, D). Dorsal pharyngeal gland orifice located 1–2 μm behind the stylet knobs. Procorpus slender, median bulb oval in shape, 9–11 μm long, 6–7 μm wide, with weak valve plates. Nerve ring located in anterior half of the isthmus. Excretory pore 67–71 µm from anterior end, hemizonid 2 to 3 annuli anterior to excretory pore. Isthmus slender, basal pharyngeal bulb saccate, offset from intestine (figures 1A and 2A, B). Reproductive system monoprodelphic, with outstretched ovary and short post-uterine sac (figures 1D and 2G), oocytes in single row, spermatheca lobed and offset, filled with rounded sperm (Figure 1K). Tail elongated, not filiform, tapering to a rounded tip (figure 1L and 2H–J).

Male. Similar to female in general view. Body straight or slightly curved ventrally, lateral field with two incisures. Testis outstretched, sperm in single row. Spicules slender, ventrally arcuate, bursa short, 17–20 µm; gubernaculum simple. (Figures 1E, J and 2A–F).

MEHRABIAN ET AL.168 · Zootaxa 4290 (1) © 2017 Magnolia Press

TABLE 1. Morphometric data for Discotylenchus lorestanensis sp. n., collected from the rhizosphere of oak (Quercus

brantii) in Lorestan province, Iran. All measurements are in µm and in the form: mean ± SD (range).

Diagnosis and Relationships. Discotylenchus species are divided into two groups based on the number of lateral field incisures. Those with two incisures include D. azadkashmirensis, D. discolabialis, and D. longicauda, while the second group, with four incisures, includes D. attenuatus, D. brevicaudatus, D. iranicus, and D.

discretus. Discotylenchus lorestanensis sp. n., belongs to the first group on the basis of its two lateral field incisures, and is further characterized by a stylet length of 8–9 μm, tail 66–78 μm long and tapering to a rounded tip, offset, lobed spermatheca filled with rounded sperm, and an oval median bulb. The new species can be distinguished from D. azadkashmirensis by having a shorter tail (66–78 vs 100–105 μm), spermatheca shape (lobed vs elongated), different basal bulb shape (saccate to elongate vs elongate), longer body (449–566 vs 350–460 μm),

Character\Source Female Male

Holotype Paratype CV Paratype

N 1 19 7

L 494 508 ± 31 (449–566) 5.8 483 ± 14 (437–508)

a 33.3 33.2 ± 2.6 (28.3–39.5) 7.6 37.8 ± 1.4 (31.7–39.8)

b 5.4 5.5 ± 0.2 (5.2–5.8) 3.7 5.0 ± 0.4 (4.4–5.4)

c 6.8 6.9 ± 0.4 (6.2–8.0) 6.2 6.5 ± 0.3 (6.2–7.0)

c' 8.2 8.0 ± 1.1 (5.8–9.2) 12.5 7.8 ± 0.3 (5.9–7.9)

V 65.6 67.9 ± 2.9 (63.3–71.1) 3.8 -

stylet 8 8.8 ± 0.3 (8–9) 4.0 8.2 ± 0.1 (8–9)

Conus 4 3.9 ± 0.4 (3–5) 10.5 3.4 ± 0.1 (3–4)

m (conus/stylet %) 41.5 43.7 ± 2.2 (40.5–47.2) 5.3 41.2 ± 0.9 (40.1–42.2)

DGO 0.9 1.1 ± 0.2 (0.9–1.5) 16.7 0.9 ± 0.2 (0.8–1.1)

Pharynx 90 93 ± 4 (86–98) 4.9 99 ± 6 (94–106)

Median bulb 40 41.7 ± 2.4 (38–45) 6.7 45.1 ± 3.1 (43–50)

MB 44.2 46.0 ± 2.6 (41.7–50.5) 4.7 45.7 ± 0.5 (45.2–46.5)

Excretory pore 75 76 ± 4 (67–81) 5.3 77 ± 6 (74–85)

Nerve ring 61 62 ± 3 (58–68) 4.6 63 ± 0.4 (62–63)

Hemizonid 71.7 73 ± 4 (66–78) 5.3 73 ± 5.5 (66–79)

Head-vulva 350 340 ± 16 (309–389) 5.9 -

Head-anus 421 439 ± 26 (383–469) 5.6 407 ± 11 (369–426)

Vulva-anus 71 84 ± 13 (65–100) 17 -

Tail length 73 73 ± 4 (66–78) 6.4 74 ± 6 (68–82)

Body width 15 15.2 ± 1.2 (13–17) 7.6 12.4 ± 0.8 (12–14)

Vulval body width 14 14.5 ± 0.8 (14–16) 5.9 -

Anal body width 9 9.5 ± 1.5 (9–13) 11.5 10.0 ± 0.6 (9–11)

Vagina (µm) 6 6.0 ± 0.7 (5–7) 12.6 -

Lateral field width 3 3.1 ± 0.3 (3–4) 11.2 2.5 ± 0.2 (2–3)

Lateral field/BW % 20.2 20.4 ± 2.1 (15.9–23.7) 10.5 19.5 ± 0.3 (19.2–20.0)

Annulus width 0.8 0.9 ± 0.1 (0.8–1.0) 9.5 0.9 ± 0.1 (0.8–1.0)

PUS 6 5.6 ± 0.5 (5–7) 11.2 -

PUS/BW 0.4 0.4 ± 0.6 (0.3–0.4) 8.5 -

Spicule - - - 14.1 ± 0.9 (13–16)

Bursa - - - 18.5 ± 1.1 (17–20)

Gubernaculum - - - 4.3 ± 0.2 (4–5)

Zootaxa 4290 (1) © 2017 Magnolia Press · 169DISCOTYLENCHUS LORESTANENSIS SP. N.

FIGURE 1. Photomicrographs of Discotylenchus lorestanensis sp. n. Female (A–D, F–I, K, L) and male (E, J). A: Pharyngeal region; B: Head and stylet; C: Amphid; D: PUS; E: Male posterior end; F: Female tail; G: Entire body; H: Cross section of female showing lateral field; I: Lateral field; J: Bursa; K: spermatheca; L: tail terminus (all scale bars = 10 μm). (A: anus; B: bursa; L.L: lateral line; PUS: post-vulval uterine sac; S: spermatheca; V: vulva).

MEHRABIAN ET AL.170 · Zootaxa 4290 (1) © 2017 Magnolia Press

FIGURE 2. Line drawings of Discotylenchus lorestanensis sp. n. female. A, B: Pharynx; C, D: Head and stylet; E: Entire body; F: Lateral field; G: PUS; H–J: tail; K: Cross section at mid-body.

Zootaxa 4290 (1) © 2017 Magnolia Press · 171DISCOTYLENCHUS LORESTANENSIS SP. N.

FIGURE 3. Line drawings of Discotylenchus lorestanensis sp. n. male. A: Entire body; B: Head and stylet; C: Pharynx; D, E: Tail and spicule; Head and stylet; F: Cross section at mid-body.

higher c value (6.2–8.0 vs 3.5–4.6), lower c’ (5.8–9.2 vs 10.0–13.3), and higher V (63–71 vs 57–61). Differences with D. longicauda include the shorter tail (66–78 vs 140–188 μm), median bulb shape (oval vs spindle), basal bulb shape (saccate vs elongated), spermatheca shape (round to ellipsoid vs elongated), and longer stylet (8–9 vs 6.5–7.5 μm). It differs from D. discolabialis by the longer stylet (8–9 vs 6–7 μm), median bulb shape (oval vs spindle), basal bulb shape (saccate vs elongated), spermatheca (filled vs empty), and in the presence of males. The new species differs from members of the second group, above, in several features in addition to the number of lateral field incisures. In comparison with D. attenuatus, it differs by having a longer stylet (8–9 vs 6–7 μm), and in tail shape (not filiform, tapering to a rounded tip vs filiform, with extremely narrow terminus). It can be separated from D. brevicaudatus by the longer stylet (8–9 vs 6–8 μm), greater body length (449–566 vs 320–360 μm), tail length (66–78 vs 35–47 μm), and vulva position (63–71 vs 79–81%), as well as in the presence of males. It can be distinguished from D. discretus by having a longer stylet (8–9 vs 7–8 μm), by tail shape (elongated, not filiform

MEHRABIAN ET AL.172 · Zootaxa 4290 (1) © 2017 Magnolia Press

tapering to rounded vs gradually tapering, filiform), and shorter tail length (66–78 vs 80–115 μm). D. lorestanensis

sp. n., differs from Discopersicus iranicus Yaghoubi, Pourjam, Ortega, Liebanas, Atighi & Pedram 2016 by its longitudinal amphidial aperture on the lip region (vs oblique amphidial aperture), as well as in having a shorter stylet (8–9 vs 12–15 μm) and body (449–566 vs 681–748 μm).

Locality and habitat. The specimens were collected from the rhizosphere of oak trees (Quercus brantii) in Sholabad region, Khoram-Abad county, Lorestan Province, western Iran (GPS coordinates: N 33°26' 37'', E 48° 12' 47''), in May, 2014.

Type material. Holotype female (slide number DL 200), 16 paratype females, 6 paratype males and 2 juveniles on slide numbers DL 201–DL 208, kept in the nematode collection of the Department of Plant Protection, College of Agriculture, University of Lorestan, Iran; 4 paratype females, 2 paratype males and 1 juvenile on slide numbers WT3698; WT3699; WT3700 and WT3701 in the Nematode Collection of Plantenziektenkundige Dienst, Wageningen, The Netherlands.

Etymology. The specific epithet is derived from the Lorestan province of Iran, the region where the new species was collected.

Molecular characterization and phylogenetic relationships. For our molecular analyses, we sequenced two fragments of ribosomal DNA: 563 bp of LSU (28S D2–D3), and 1747 bp of SSU (18S) each from two separate individuals. The newly obtained sequences were used for phylogenetic reconstructions along with available sequences of members of Tylenchidae obtained from GenBank. We chose a sequence of Cephalenchus

hexalineatus as to serveoutgroup taxon for each dataset. In the SSU analysis, our D. lorestanensis sp. n. sequences are tentatively placed as sister taxa to Filenchus misellus (Andrássy, 1958) Raski & Geraert, 1987 (differing by 16–17 out of 1747 bp) and Filenchus chilensis Raski & Geraert, 1987 (differing by 16 of 1747 bp). These three species are placed in a well-supported (0.95 pp) cluster with Filenchus discrepans (Andrássy, 1954) Raski & Geraert, 1987 and Filenchus longiurus (Siddiqi & Lal, 1992) Brzeski, 1997, all species of Tylenchinae Örley, 1880 (Geraert 2008). The main clade of Boleodorinae Khan, 1964 (Geraert 2008) in this phylogenetic tree includes Basiria

duplexa (Hagemeyer & Allen, 1952) Geraert, 1968, D. iranicus, Basiria sp. and Neopsilenchus magnidens

(Thorne, 1949) Thorne & Malek, 1968, placed together with strong support (1.00 pp). The relatively high number of autapomorphic characters, as well as the maximal support of the relevant branching points, supports the status of D. lorestanensis sp. n. as a distinct species. Based on the type of amphidial aperture and the results of our phylogenetic analyses of SSU sequences, this new species belongs to the subfamily Tylenchinae (Geraert 2008). Analysis of the LSU sequences (figure 4) shows that two individuals of D. lorestanensis sp. n. were identical.

FIGURE 4. Bayesian tree inferred using sequences D2–D3 region of the LSU rDNA gene. Posterior probabilities (pp) exceeding 0.5 are given on appropriate clades, bifurcations with pp above 0.95 are considered to be well-supported. Nematode

species and GenBank accession numbers are listed for each taxon. Newly generated D2–D3 LSU rDNA sequences are in bold.

Zootaxa 4290 (1) © 2017 Magnolia Press · 173DISCOTYLENCHUS LORESTANENSIS SP. N.

FIGURE 5. Bayesian tree inferred from SSU rDNA sequences. Posterior probabilities (pp) exceeding 0.5 are given on

appropriate clades, bifurcations with pp above 0.95 are considered to be well-supported. Nematode species and GenBank accession numbers are listed for each taxon. Newly generated SSU rDNA sequences are in bold.

Key to the species of Discotylenchus

1. Lateral field with two incisures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2

- Lateral field with four incisures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5

2. Stylet 8–9 µm . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3

- Stylet 6–8 µm . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4

3. Tail 63–78 µm . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .D. lorestanensis sp. n.

(L=449–566, Body width= 13–17, V= 63–71, c= 6.2–8.0, c'= 5.8–9.2, spermatheca lobed, basal bulb saccate to elongated)

- Tail 100–105 µm . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . …………………………………………………D. azadkashmirensis

(L=350–460, Body width= 9.5–10.5, V= 57–61, c= 3.5–4.6, c'= 3.5–4.6, spermatheca elongated, basal bulb elongated)

4. Tail 69–90 µm . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . D. discolabialis

(L=270–320, V= 56–61, a = 28–35, c'= 12–16, spermatheca rounded,)

- Tail 140–188 µm . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . D. longicauda

(L=480–550, V= 51–54, a= 43–53, c'= 20–29, spermatheca elongated,)

5. Tail 35–47 µm . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . D. brevicaudatus

(L=320–360, V= 71–73, c=8.1–9.8, c'= 4.5–6.0, tail terminus rounded)

- Tail 68–96 µm . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . D. attenuatus

(L=330–400, V= 60–64, c= 4.1–5.0, c'= 9–12, tail terminus extremely thin)

- Tail 80–115 µm . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . D. discretus

(L=440–610, V=63–67, c= 5.0–6.2, c'= 9–11, tail terminus thin)

Acknowledgements

We gratefully acknowledge Dr. Hans Helder, Dr. Martijn Holterman and Sven Van Den Elsen (University of Wageningen, The Netherlands) for valuable help with our molecular study; Miss Zahra Mirzaipoor (Department of Plant Pathology, Lorestan University, Iran) for valuable help; and Lorestan University (Iran) for technical assistance.

MEHRABIAN ET AL.174 · Zootaxa 4290 (1) © 2017 Magnolia Press

References

Andrássy, I. (1954) Revision der Gattung Tylenchus Bastian, 1865 (Tylenchidae, Nematoda). Acta Zoologica Hungaricae, 1, 5–42.

Andrássy, I. (1958) Erd- und Susswassernematoden aus Bulgarien. Acta Zoologica Academiae Scientiarum Hungaricae, 4, 1–88.

Andrássy, I. (1963) Freilebende Nematoden aus Angola.I. Einige moosbewohnende Nematoden. Publicafoes Culturais da

Companhia de Diamantes de Angola, Lisboa, 66, 57–79.

Azizi, K., Eskandari, A., Karegar, A., Ghaderi, R., van den Elsen, S., Holterman, M. & Helder, H. (2016) Morphological and molecular characterization of Pratylenchoides persicus n. sp. (Nematoda: Merliniidae) and additional data on two other species of the genus from Iran. Zootaxa, 4205 (5), 459–474. https://doi.org/10.11646/zootaxa.4205.5.4

Brzeski, M.W. (1963) On the taxonomic status of Tylenchus filiformis Butschli, 1873, and the description of T. vulgaris sp.n. (Nematoda: Tylenchidae). Bulletin de I 'Academie Polonaise des Sciences, 11, 531–535.

Brzeski, M.W. (1986) Four new species of Tylenchidae (Nematoda). Nematologica, 31, 424–432. https://doi.org/10.1163/187529285X00517

Brzeski, M.W. (1997) Redescription of some species of the genus Filenchus Andrassy,1954 (Nematoda: Tylenchidae). Miscellimia Zoologica, 20, 45–64.

De Grisse, A.T. (1969) Redescription ou modifications de quelques techniques utilisées dans l’étude des nematodes phytoparasitaires. Mededelingen Faculteit Landbouwwetenschappen Rijksuniversiteit Gent, 34, 351–369.

De Man, J.G. (1884) Die frei in der reinen Erde und im siiben Wasser lebenden Nematoden de der niederlandischen Fauna.

Brill, Leiden, 206 pp. De Man, J.G. (1921) Nouvelles recherches sur les nematodes terricoles de la Hollande. Capita Zoologica, 1, 3–62.Geraert, E. (1962) Bijdragen tot de kennis der plantenparasitaire en der vrijlevende nematoden van Kongo. II. De

nematodenfauna in en om de wortels van Musa parasidiaca normalis. Ganda-Congo, Rijksuniversiteit, Gent, 1962, 5–73.Geraert, E. (1968) The Genus Basiria (Nematoda: Tylenchina). Nematologica, 14, 459–481.

https://doi.org/10.1163/187529268X00156Geraert, E. & Goodey, J.B. (1964) The priority of Tylenchus hexalineatus over T. megacephalus. Nematologica, 9 (1963), 471.Geraert, E. (2008) The Tylenchidae of the world. Identification of the family Tylenchidae (Nematoda). Academia Press, Ghent,

540 pp.Ghaemi, R., Pourjam, E., Atighi, M.R., Pedram, M. & Karssen, G. (2012) First record of the genus Discotylenchus Siddiqi,

1980 (Nematoda: Tylenchidae) from Iran, with description of one new and data on two known species. Zootaxa, 3493, 72–82.

Hagemeyer, I.W. & Allen, M.W. (1952) Psilenchus duplexus n. sp. and Psilenchus terextremus n. sp., two additions to the nematode genus Psilenchus de Man 1921. Proceedings of the Helminthological Society of Washington, 19, 51– 54

Hall, T.A. (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series, 41, 95–98.

Holterman, M., Rybarczyk, K., Van Den Elsen, S., Van Megen, H., Mooyman, P., Peña-Santiago, R., Bongers, T., Bakker, J. & Helder, J. (2008) A ribosomal DNA-based framework for the detection and quantification of stress-sensitive nematode families in terrestrial habitats. Molecular Ecology Resources, 8, 23–34. https://doi.org/10.1111/j.1471-8286.2007.01963.x

Holterman, M., Van Der Wurff, A., Van Den Elsen, S., Van Megen, H., Bongers, T., Holovachov, O., Bakker, J. & Helder, J. (2006) Phylum-wide analysis of SSU rDNA reveals deep phylogenetic relationships among nematodes and accelerated evolution toward crown clades. Molecular Biology and Evolution, 23, 1792–1800. https://doi.org/10.1093/molbev/msl044

Husain, K. & Khan, A.M. (1967) A new subfamily, a new subgenus and eight new species of nematodes from India belonging to superfamily Tylenchoidea. Proceedings of the Helminthological Society of Washington, 34, 175–186.

Lownsberry, L.W. & Lownsberry, B.F. (1985) Plant-parasitic nematodes associated with forest trees in California. Hilgardia,

53, 1–16.Maqbool, M.A. & Shahina, F. (1985) Two new species of the genus Ottolenchus Husain & Khan, 1967 (Nematoda:

Tylenchidae) with a key to the species and observation on O. facultativus (Szczygieł, 1969) Brzeski, 1982 from Pakistan. Revue de Nématologie, 8, 329–333.

Mizukubo, T. (1993) Description of Filenchus discolabialis sp. n. and additional records of F. helenae (Szczygieł, 1969) Raski & Geraert, 1987 (Nematoda: Tylenchidae). Nematologica, 39, 466–475.

Nunn, G. (1992) Nematode Molecular Evolution. Ph.D. thesis. University of Nottingham, Nottingham, 228 pp.Örley, L. (1880) Az anguillulidak maganrajza. A kir.m. termeszettudom. Tersulat altaI a bugatdijjal jutalmazott palyamii.

Termeszetrajzi Fuzeetek, 4, 16–50.Raski, D.l. & Geraert, E. (1987) Review of the genus Filenchus Andrassy, 1954 and descriptions of six new species (Nemata:

Tylenchidae). Nematologica, 32, 265–311. [1986]Ronquist, F,, Teslenko, M., Van Der Mark, P., Ayres, D.L., Darling, A., Hohna, S., Larget, B., Liu, L., Suchard, M.A. &

Huelsenbeck, J.P. (2012) MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model

Zootaxa 4290 (1) © 2017 Magnolia Press · 175DISCOTYLENCHUS LORESTANENSIS SP. N.

space. Systematic Biology, 61, 539–542.Siddiqi, M.R. (1963) Four new species of the genus Tylenchus Bastian, 1865 (Nematoda)from North India. Zeitschrift fUr

Parasitenkunde, 23, 170–180.Siddiqi, M.R. (1978) The unusual position of the phasmids in Coslenchus costatus (de Man, 1921) gen.n., comb.n., and other

Tylenchidae (Nematoda: Tylenchida). Nematologica, 24, 449–455. https://doi.org/10.1163/187529278X00597

Siddiqi, M.R. (1980) Two new nematode genera, Safianema (Anguinidae) and Discotylenchus (Tylenchidae), with descriptions of three new species. Proceedings of the Helminthological Society of Washington, 47, 85–94.

Siddiqi, M.R. (2000) Tylenchida: Parasites of Plants and Insects. 2nd Edition. CABI Publishing, Wallingford, 833 pp. https://doi.org/10.1079/9780851992020.0000

Siddiqi, M.R. & Lal, A. (1992) Taxonomy of the genus Ottolenchus Husain & Khan, 1967 (Nematoda: Tylenchidae) with descriptions of fifteen new species. Afro-Asian Journal of Nematology, 2, 89–106.

Thorne, G. (1949) On the classification of the Tylenchida, new order (Nematoda: Phasmida). Proceedings of the

Helminthological Society of Washington, 16, 37–73.Thorne, G. & Malek, R.B. (1968) Nematodes of the Northern Great Plains. Part 1. Tylenchida (Nemata: Secernentea). South

Dakota Agricultural Experiment Station Technical Bulletin, 31, 1–111.Whitehead, A.G. & Heming, J.R. (1965) A comparison of some quantitative methods of extracting small vermiform nematodes

from soil. Annals of Applied Biology, 55, 25–38. https://doi.org/10.1111/j.1744-7348.1965.tb07864.x

Wu, L.Y. (1969) Five new species of Tylenchus Bastian, 1865 (Nematoda: Tylenchidae Tylenchidae) from the Canadian High Arctic. Canadian Journal of Zoology, 47, 1005– 1010. https://doi.org/10.1139/z69-162

Yaghoubi, A., Pourjam, E., Alvarez-Ortega, S., Liebanas, G., Atighi, M.R. & Pedram, M. (2016) Discopersicus n. gen., a new member of the family Tylenchidae Örley, 1880 with detailed SEM study on two known species of the genus Discotylenchus Siddiqi, 1980 (Nematoda; Tylenchidae) from Iran. Journal of Nematology, 48, 214–221.

MEHRABIAN ET AL.176 · Zootaxa 4290 (1) © 2017 Magnolia Press