do cell culture conditions influence the carrier-mediated transport of peptides in caco-2 cell...

European Journal of Pharmaceutical Sciences 19 (2003) 433–442www.elsevier.com/ locate/ejps

D o cell culture conditions influence the carrier-mediated transport ofpeptides in Caco-2 cell monolayers?

*Isabel Behrens, Thomas KisselDepartment of Pharmaceutics and Biopharmacy, University of Marburg, Philipps-University, Ketzerbach 63, D-35032 Marburg /Lahn, Germany

Received 5 September 2002; received in revised form 7 May 2003; accepted 26 May 2003

Abstract

Despite the fact that different laboratories have reported large differences in permeability for actively transported substrates, Caco-2 cellmonolayers are widely used as in vitro model to study small intestinal drug transport. Therefore, we investigated the effect of cell cultureconditions, such as time in culture, membrane support, seeding density and supplements to the medium, on the morphology, the formationof tight junctions, as well as the expression of two peptide transporters (PepT1, HPT1) and the efflux pump, P-glycoprotein (Pgp), inCaco-2 cell monolayers. Tight junction formation was assessed by transepithelial electrical resistance measurements; multi-cell layerformation by confocal laser scanning microscopy, the expression of transporters by RT-PCR and the permeability of the PepT1 substrate,cephradine. Both morphology and the expression of carrier-mediated transporters, varied strongly as a function of culture conditions. Anincrease of differentiation, as documented by tight, homogeneous cell monolayer formation displaying a strong expression of allcarrier-mediated transporters, was found up to 3 weeks post seeding. One week later, multi-layer structures were observed and theexpression of Pgp decreased. Polyester and polyethylene terephthalate membrane supports decreased the paracellular transport ratessubstantially, while collagen-coating of PC inserts showed no influence on the morphology and even increased carrier-mediated

4 2transporter expression. An average seeding density of 6310 cells /cm seemed to be most favorable, since lower seeding densities led tothin monolayers with altered tight junctions and higher seeding densities to the formation of multilayers. In summary, the expression ofcarrier-mediated transporters was strongly affected by the culture conditions. The full differentiation was reached after 21 days on

4 2collagen-coated polycarbonate inserts at an initial seeding density of 6310 cells /cm . 2003 Elsevier B.V. All rights reserved.

Keywords: P-Glycoprotein; PepT1; HPT1; Caco-2 cells; Cephradine

1 . Introduction for their affinity to specific receptors, as well as theirbiopharmaceutical properties. In this context, the FDA is

Recent advances in combinatorial chemistry have re- currently developing a new regulatory guideline for bio-volutionized the field of drug discovery, thus producing an equivalence studies based on the biopharmaceutical classi-increasing amount of compounds which need to be tested fication system (BCS) (van de Waterbeemd, 1998). This

system provides a basis for establishing in vitro–in vivocorrelations and for predicting drug absorption problems.

Abbreviations: FD-4, fluorescein isothiocyanate-dextran Mw 4400; The compounds are then classified into four groups as aFITC, fluorescein isothiocyanate; HD, Caco-2 cell line from Heidelberg; function of their in vitro solubility and in vivo permeabili-HPT1, human intestinal transporter (peptide transporter); Col, collagen- ty: class 1 (high permeability, high solubility), class 2coated polycarbonate membrane support;P , apparent permeabilityapp (high permeability, low solubility), class 3 (low per-coefficient; PC, polycarbonate membrane support; PE, polyester mem-

meability, high solubility) and class 4 (low permeability,brane support; PET, polyethylene terephthalate membrane support;PepT1, peptide transporter; PCR, polymerase chain reaction; PBS, low solubility) (Amidon et al., 1995). While the solubilityphosphate-buffered saline; Pgp, p-glycoprotein; RT-PCR, reverse tran- of a drug substance can be easily determined, drugscriptase polymerase catterchain reaction; TEER, transepithelial electricalpermeability coefficients are less accessible in humans.resistance

Therefore, the in vitro cell culture model of the gastroin-*Corresponding author. Tel.:149-6421-282-5881; fax:149-6421-testinal tract, Caco-2, has been frequently employed to282-7016.

E-mail address: [email protected](T. Kissel). estimate drug permeability and metabolism (Hidalgo et al.,

0928-0987/03/$ – see front matter 2003 Elsevier B.V. All rights reserved.doi:10.1016/S0928-0987(03)00146-5

mailto:[email protected]

434 I. Behrens, T. Kissel / European Journal of Pharmaceutical Sciences 19 (2003) 433–442

1989; Adson et al., 1995). In comparison to animal studies, Since, in an earlier study (Behrens et al., 2003), it hasthe Caco-2 model represents a relatively inexpensive and been shown that the origin and the passage numberreproducible tool and show a good correlation to in vivo dramatically affect the expression of carrier-mediateddata (Artursson and Karlsson, 1991). Moreover, Caco-2 transporters, the aim of this study was to investigate thecells are derived from human tissue and spontaneously morphology, multi-layer formation, and development ofdifferentiate into polarized absorptive cell monolayers that tight junctions, as well as the expression of the carrier-allow a detailed investigation of transport pathways and mediated transporters PepT1, HPT1 and Pgp in Caco-2mechanisms on a cellular level. Finally, they express a cells as a function of (1) time in culture, (2) type ofnumber of carrier-mediated transport systems and enzymes membrane support, (3) seeding density and (4) supple-(Delie and Rubas, 1997). ments to the medium. On the basis of these results, a

Among such systems, the oligopeptide transporters, standardized protocol for Caco-2 cell cultures was de-PepT1 and HPT1, have become a popular target for drug veloped.development, since not only nutrients, but also drugs, suchasb-lactam antibiotics and thrombin inhibitors, are active-ly transported by these transporters (Dantzig et al., 1994;Walter et al., 1995). Moreover, the secretory transport 2 . Materials and methodssystem P-glycoprotein (Pgp) has been investigated inten-sively, since it limits the bioavailability of a wide variety 2 .1. Materialsof chemotherapeutic agents and hydrophobic drugs(Hosoya et al., 1993). FITC-dextran (Mw 4400) and fetal calf serum (FCS)

However, variability from laboratory to laboratory with were obtained from Sigma (Taufkirchen, Germany). Tissuerespect to the permeability of compounds through Caco-2 culture reagents were purchased from Gibco (Eggstein,cell monolayers limits the application of permeability data Germany) and tissue culture articles from Nunc (Wies-and makes the standardization of all cell culture parame- baden, Germany). Primers for PCR were supplied byters, such as time in culture, type of membrane support and MWG-Biotech (Ebersberg, Germany). All other chemicalsseeding density (Braun et al., 2000), inevitable. For were obtained from Merck (Darmstadt, Germany) ininstance, controversial results have been reported for Pgp. analytical quality.While Wils et al. (1994) could not find a change oftransporter expression with culture time, others did (Hos-kins et al., 1993; Hosoya et al., 1993). Anderle et al. 2 .2. Cell culture(1998)observed that the time-dependent expression of Pgpwas affected by the membrane support. While Caco-2 cells Mycoplasma-free Caco-2 cells were used at passagecultured on polycarbonate (PC) filters did not elicit a numbers 39–40 (HD, DKFZ, German Cancer Researchsignificant change in Pgp expression during 4 weeks, Center, Heidelberg, Germany) under conditions describedexpression decreased when polystyrene plastic flasks were earlier (Walter and Kissel, 1995). Briefly, cells wereused. routinely maintained in Dulbecco’s modified Eagle’s

Sun et al. (2002)recently found significant differences medium (DMEM) supplemented with 10% fetal calf serumin gene expression profiles for a large number of active (FCS), 1% nonessential amino acids and 1%L-glutaminetransporters, e.g., PepT1 and Pgp, between Caco-2 cells at 10% CO , 95% R.H. and 378C. Cells were passaged2

and human duodenum which may account for differences every 5 days at a split ratio of 1:5 to 1:1. Cells were seeded4 2in carrier-mediated drug permeabilities. One attempt to at a density of 6310 cells /cm on cell culture inserts;

overcome the variability of Caco-2 cells is to clone the either on uncoated polycarbonate, polystyrene (Costar,2DNA of specific transporters, e.g., Pgp, into Caco-2 cells Bodenheim, Germany, 0.4-mm pore size; area, 4.71 cm )

or other cell lines (Artursson and Borchardt, 1997). or polyethylene terephthalate membranes (Falcon�, Bec-Unfortunately, transfected cells frequently lose contact ton-Dickinson, Heidelberg, Germany, 0.4mm; area, 4.6

2inhibition and grow in multilayers (Braun et al., 2000). cm ). They were cultivated for 21 days unless otherwiseTherefore, it would be desirable to induce transporter stated. To coat filters with collagen, 300ml of rat tailexpression using classical cell culture methods, such as collagen I (0.2 mg/ml in 70% ethanol) was pipetted insupplements to the medium. Previously, induction of polycarbonate filter inserts and allowed to evaporate underPepT1 was observed when insulin (Thamotharan et al., the clean bench. To investigate the effect of various1999) and the dipeptides, glycyl-L-glutamine (Gly–Glu) medium supplements, cells were incubated with mediumand glycyl-L-sarcosine (Gly–Sar), were supplemented to containing 1% GlutaMAX I� or GlutaMAX II� (Gibco),Caco-2 culture medium (Thamotharan et al., 1998; Walker 10% peptone from meat (Merck, prepared according to theet al., 1998). Moreover,Erickson et al. (1995)observed manufacturer’s protocol) or 100 U/ml penicillin /strep-the increase of HPT1 and PepT1 expression in rats tomycin (Gibco) 2 days before the experiment. Mediumfollowing a protein diet. was changed every second day.

I. Behrens, T. Kissel / European Journal of Pharmaceutical Sciences 19 (2003) 433–442 435

2 .3. RNA isolation and RT-PCR with PBS and treated with 1% Triton X-100 (Gibco) on icefor 5 min. After repeated washings and air-drying, the

Total RNA was extracted from cells incubated on monolayer was stained with FITC-phalloidin under lightTranswell� filter inserts for 21 days using a commercial exclusion for 20 min.RNA isolation kit (RNA Clean�, AGS, Heidelberg,Germany) according to the manufacturer’s protocol. The

2 .4.2. DAPIRNA integrity was confirmed by agarose-native gel elec-After staining with FITC-phalloidin, monolayers weretrophoresis (1mg RNA, 100 V, 60 min). 1.0mg total RNA

counter-stained with DAPI (1mg/ml in PBS) for 20 minwas transcribed to cDNA by MMLV Reverse Transcriptaseunder light exclusion and washed three times with PBS.(Promega, Heidelberg, Germany), 500mmol dNTP’s, 3.5

mM Oligo(dT)–10, 1.0ml 103 reaction buffer, 0.5 Uribonuclease inhibitor, and sterile water at a final volume

2 .5. Measurement of transepithelial electrical resistanceof 25 ml for 60 min at 378C. 1 ml of cDNA was used perPCR reaction in a mixture of 5ml buffer, 200mM of each

The integrity of the monolayer was checked at 21 daysof the four dNTPs, 10 pM of each primer (actin1PepT1/

post seeding, as well as at the beginning and end of eachHPT1/Pgp), and 0.05 units of Taq polymerase Dynazyme

transport experiment by measuring the TEER, as described¨II (Biometra, Gottingen, Germany). Mixtures were incu-

elsewhere (Behrens et al., 2001a).¨bated in a thermocycler (T Gradient, Biometra, Gottingen,

Germany) for 25 cycles under the following conditions:94 8C 30 s, X8C 30 s, 728C 30 s. X represented the 2 .6. Transport studiesannealing temperature and was set to 588C for PepT1,60 8C for HPT1 and 618C for Pgp, respectively. The Transport studies were performed 21 days post seedingsequence of primer pairs for HPT1 and Pgp was taken or as otherwise indicated. Filter inserts were rinsed withfrom the literature (Erickson et al., 1995; Gutmann et al., Hank’s balanced salt solution (HBSS) pH 7.4 sup-1999). The primers selected for PepT1 were CATCAG- plemented with 15 mM glucose and 10 mM Hepes (4-CAGCTACAATGCCA (sense strand) and GGTAGTAC- hydroxylethylpiperazin-N9-2-ethansulfonacid) and allowedCGAGCCAAGATA (antisense strand), whereas the prim- to equilibrate at 378C for 15 min. Cephradine (1 mM) anders for actin were ATTTGGCACCACACTTTCTAC FD-4 (250mg/ml) were dissolved in HBSS supplemented(sense strand) and TCACGCACGATTTCCCTCTCA (anti- with 15 mM glucose and 10 mM MES (2-(N-morpholino)-sense strand). PCR reaction products were processed asethansulfonic acid), pH 6.0. Experiments were initiated bydescribed elsewhere (Behrens et al., 2003). Each experi- replacing the apical (1.5 ml) buffer with the test solutionment was carried out in triplicate. and the basolateral buffer with fresh HBSS, pH 7.4 (2.5

ml). Every 20 min up to 120 min a 1.0-ml sample was2 .4. Confocal laser scanning microscopy collected from the basolateral chamber and replaced with

fresh buffer. Each experiment was run in triplicate.Cells were grown on Transwell filter inserts for 21 days

and fixed with 3% (v/v) formalin in phosphate-bufferedsaline (PBS) (0.1 M, pH 7.4) at room temperature for 15 2 .7. Sample analysismin. They were subsequently stained with FITC-phalloidinand DAPI (496-diamidino-2-phenylindole) (see below), Samples were analyzed by reverse-phase HPLC consist-embedded in PBS–glycerol (2:1), and examined under a ing of a pump (model L-6200A), an automatic samplerconfocal laser scanning microscope (Axiovert, Zeiss (model As-200A), a column thermostat (model T-6300), aCLSM 501, Jena, Germany) equipped with a Zeiss Neofl- fluorescence detector (model F-1050) and an UV-lightuor 340/1.3 objective. Excitation wavelengths were 364 detector (model L-4000) (all from Hitachi, Merck). FD-4nm (long pass filter (LP) 385 nm) for DAPI and 488 nm analysis was performed using a RP 18, 3mm, 3034 mm(LP 505 nm) for FITC. A gallery of 80 optical sections column with a mobile phase of 10% acetonitrile and 90%(0.4 mm) was collected andxz, yz composites were KH PO (2 mM, pH 7.2) and a flow of 1 ml /min.2 4

processed using Zeiss LSM 510 software package. Sen- Cephradine was analyzed using a 200 Superspheresitivity was kept constant during all experiments. LiChroCart� column 100 RP-18, 2534 mm (Merck) at a

flow rate of 1 ml /min with a mobile phase of 0.1%2 .4.1. Actin trifluoroacetic acid (TFA) in water and acetonitrile (60:40).

F-actin was stained using FITC-labeled phalloidin Samples were quantified using a fluorescence- (FD-4: Ex,(Sigma), as previously described byAnderberg et al. 490 nm; Em, 515 nm) or a UV-detector (263 nm) and a run(1993). Briefly, 10 ml of the stock solution (0.1 mg/ml time of 2 and 2.5 min for FD-4 and cephradine, respective-phalloidin in methanol) were evaporated and redissolved in ly. The detection limits of cephradine and FD-4 were 0.2400 ml PBS, pH 7.4. Monolayers were rinsed three times mg/ml and 2 ng/ml, respectively.


2 .8. Calculations and statistics PET and PE, respectively. Moreover, PET grown cellsdisplayed flower-like clusters of microvilli with their apical

The apparent permeability coefficient (P ) was calcu- ends sticking together (Fig. 1e, asterisk), whereas theapp

lated from concentration–time profiles using the following distribution of actin staining on PE grown cells was similarequation: to PC inserts (Fig. 1f).

Seeding density also showed an impact on the morphol-4P 5dc /dt ? 1/A ?V/c (cm/s),app o ogy. Compared to an average cell density of 6310

2 4 2cells /cm , lower seeding densities of 1310 cells /cm ledwhere dc /dt (mg/s) represents the flux across the mono- to a more intense apical staining of actin, which was also2 3layer, A (cm ) the surface area of the monolayer,V (cm ) visible in paracellular spaces (Fig. 1h, yellow arrow). Athe volume of the receiving chamber andc (mg) the initial 5 2o higher seeding density of 1.2310 cells /cm led to theconcentration in the donor compartment. Results were formation of multilayers (Fig. 1i), but showed no effect onexpressed as mean value6S.D. from at least three the intensity of actin staining.experiments. Significance between the mean values wascalculated using ANOVA one-way analysis (GraphPad

3 .2. Monolayer integrity and development of tightInStat version 3.00 for Windows 95, GraphPad Software,junctionsSan Diego, CA, USA). Probability valuesP.0.05 were

considered significant.An inverse relationship between the transepithelial

electrical resistance (TEER) and the permeability of FITC-dextran MW 4400 (FD-4), a widely used paracellular

3 . Resultsmarker compound (Kamm et al., 2000), was observed(Fig. 2). An increase in TEER was associated with a

3 .1. Cell morphologydecrease inP of FD-4.app

After an initial increase of TEER at day 7, it dropped toTo visualize the formation of tight junctions, as well as 2281613 V?cm at day 14 and increased thereafter until

the cytoskeletal organization, Caco-2 cell layers were 2reaching a maximum of 647652 V?cm at day 28.double-stained with FITC-labeled phalloidin (actin, green)

Highest TEER values and lowest permeabilities of FD-4and DAPI (cell nuclei, blue) (Fig. 1). Phalloidin binds to

were observed with PE and PET filters inserts (9586108actin on and within the cells and stains F-actin fibers close 2 28 29

V?cm , 2.21310 66.6310 cm/s, and 807691 V?to the cellular junctions, on the inner surface of the cell 2 28 29cm , 1.2310 63.8310 cm/s), respectively (Fig. 2b).membrane and in the core of microvilli. This method has

Compared to PC-inserts, TEER increased between 78 andbeen previously successfully used to investigate cell

112% and FD-4 permeability decreased to 31–62%. Col-morphology with regard to multilayer formation (Rothen-

lagen coating of PC-filters and seeding of different cell¨Ruitshauser et al., 2000). Moreover, indirect conclusions

numbers did not show any significant effect on theon the distribution of microvilli can be made. Over a

paracellular permeability (Fig. 2b,c).period of 4 weeks, the structure of cell layers changedconsiderably. While at day 7 large cells formed thinmonolayers (22mm) and displayed a weak actin staining, 3 .3. mRNA expression levels of peptide transporters andat day 21 monolayers consisted of columnar-shaped cellsPgp(31.6 mm) with strongly stained perijunctional actin-ringsand a well-established brush border (Fig. 1c). Moreover, at An analysis of transporter expression in Caco-2 cellsday 7 a large number small nuclei with a strong DAPI was performed using RT-PCR in a semi-quantitative waystaining were visible, probably indicating dividing cells. (Fig. 3). The housekeeper gene actin was used as internalAs judged from the arrangement of cell nuclei inxz andyz standard, since it is widely used as a reporter gene tosections, multi-layer structures were detected at day 28 estimate the amount and integrity of RNA, as well as for(Fig. 1d, white arrow). comparing gene expression in different tissues (Biragyn et

Regarding different membrane supports, no large differ- al., 1994). Moreover, in a previous study (Behrens et al.,ences in monolayer structure were observed between2003), the correlation between the transcription and thecollagen-coated (Col) and uncoated polycarbonate (PC) translation of the transporters genes was confirmed byinserts. Monolayers consisted of tall columnar-shaped cells immunofluorescence.covered with a thick carpet of microvilli (Fig. 1c,g, red Amplification performed on reverse-transcribed RNAarrow). yielded the expected size of 484 bp for PepT1 (Fig. 3a),

In contrast, Caco-2 cells grown on polyethylene tere- 1783 bp for HPT1 (Fig. 3b), 237 bp for Pgp (Fig. 3c) andphthalate (PET) or polyester (PE) membrane supports 380 bp for actin (Fig. 3a,c). Time in culture was a majorshowed an increase in actin staining and a diminished determinant for the expression level of different transpor-thickness of monolayers, reaching only 14 and 26mm for ters.


Fig. 1. FITC-phalloidin staining for actin (green) and nucleus counter-staining with DAPI (blue) as a function of cell culture condition after 7 (a),14 (b),4 2 421 (c, e–i) or 28 (d) days in culture on PC (a–d, h–i), PE (e), PET (f) and Col (g) membranes at a seeding density of 1310 cells /cm (h), 6310

2 5 2cells /cm (a–g) and 1.2310 cells /cm (i). White arrows in (d) and (h) indicate multi-layer structures. Red arrows in (c) and (g) point to cells with a thickcarpet of microvilli, while the white asterisk in (e) marks a cell with a flower-like cluster of microvilli. The yellow arrow in (h) points at the phalloidinstaining in the paracellular spaces. The bar indicates 20mm.

While mRNA levels of the peptide transporters, PepT1 of all transporters between15% (PepT1) and131%and HPT1, continuously increased reaching a maximum (Pgp), as compared to uncoated PC inserts. PET supportsbetween the third and the fourth week, Pgp expression also showed a stimulating effect on the Pgp and HPT1reached a peak at day 21 and decreased until reaching expression, whereas mRNA levels of PepT1 were slightlyapproximately values of day 7 at day 28. The strongest decreased (ca.22%). No differences in transporter expres-increase of transporter expression was always found sion were detectable between PS and PC filter inserts.between the first and the second week. Different seeding densities had no effect on PepT1 expres-

Different membrane supports (Fig. 3b) showed no sion, however, mRNA levels of HPT1 and Pgp were4 5strong variations in carrier-mediated transporter expres- significantly lowered for both 1310 and 1.2310 cells /

2sion. However, collagen-coating increased the expression cm to approximately the same extent.


shown to be a substrate of the PepT1-transporter in Caco-2cells (Inui et al., 1992).

Moreover, our own investigations suggested an carrier-mediated transport, since an excess of Gly–Sar (25 mM)decreased the permeability of cephradine by 49% (com-petitive inhibition) and transport at 48C decreased thepermeability by 67% (data not shown).

The P of cephradine increased in the following rankapp

order: d7,d14,d21̄ d28 (Fig. 4). At day 21, a maxi-26 27mum of cephradine permeability, 2.03310 66310

cm/s, was reached. The highestP was measured forapp26 27collagen-coated filter inserts (3.79310 61.48310

cm/s), the lowest for cells grown on PET and PE-mem-branes (Fig. 4b). A slight, however, non-significant in-crease ofP was found from the lowest to the highestapp

seeding density.

3 .5. Supplements to the medium

The influence of different supplements to the cell culturemedium, such as dipeptides:L-alanyl-L-glutamine (Ala–Glu) and L-glycyl-L-glutamine (Gly–Glu), a mixture ofproteins and peptides (peptone), or penicillin /streptomycin(pen/strep), on the expression of peptide transporters wasexplored. Results are shown inFigs. 5 and 6.Whiledifferences in morphology and TEER-values could not bedetected (data not shown), it was demonstrated that mRNAlevels (Fig. 5) and the permeability of cephradine (Fig. 6)in Caco-2 cells varied strongly as a function of thesupplement.

No difference in transcription-level, as well as in thepermeability of cephradine, was found for cells treatedwith pen/strep as compared to the control. However,translation of PepT1 (ratio PepT1/actin) significantlyincreased in the following rank order: Control,Gly–Glu(121%),Ala–Gly (130%),peptone (158%) (Fig. 5a).In contrast, when examining HPT1-expression, the highestvalues in comparison to the control was found for Ala–Gly, followed by Gly–Glu, peptone and pen/strep (Fig.5b). The increase of cephradine permeability compared tothe control decreased from peptone (168%) over Ala–Gly

Fig. 2. Transepithelial electrical resistance (TEER) and apparent per- (16%) to Gly–Glu (13%).meability coefficient (P ) for the paracellular marker FD-4 as a functionapp

of cell culture conditions: time in culture (a), membrane support (b) andseeding density (c) (n56). Significance between the mean values was

4 . Discussioncalculated using ANOVA one-way analysis as described under Section 2.Probability valuesP.0.05 were considered significant. (n.s., not sig-nificantly different atP,0.05, *P,0.05, **P,0.01 and ***P,0.001). Since the Caco-2 cell culture model has been previously

shown to exhibit a number of favorable characteristics,such as the reproducible, spontaneous formation of tight,

3 .4. Transport of cephradine confluent monolayers, as well as the expression of anumber of important, carrier-mediated transporters and

To demonstrate that a lower transcription-level of efflux pumps (Delie and Rubas, 1997), it would betransporters correlates with a diminished permeability of desirable to use this cell line in drug design and develop-their substrates, the apparent permeability coefficient (P ) ment for the screening of possible substrates, as well as theapp

for the PepT1 substrate, cephradine, was investigated. This investigation of structure-transport relationships. Due topeptide-like cephalosporin derivative has previously been the inter-laboratory variability of cell morphology and


Fig. 3. mRNA transcription of PepT1 (484 bp), HPT1 (1783 bp), and Pgp (237 bp) by RT PCR as a (A) function of time in culture (7, 14, 21 and 28 days4 4 4 4 5on PC at 6310 ), (B) type of membrane support (PC, PS, PET and Col for 21 days at 6310 ) and (C) seeding density (1310 , 6310 and 1.2310

2cells /cm on PC). Actin (380 bp) was used as an internal standard to confirm the integrity and the amount of cDNA subjected to PCR reaction.PCR-products were investigated on a 1.5% agarose gel stained with ethidium bromide at 100 V for 45 min. M was the marker in all pictures.

expression levels of carrier-mediated transporters, the observed a complete differentiation of Caco-2 monolayersapplication of Caco-2 cells requires careful characteriza- after 21 days.tion. In a previous study, we found that the origin of clone As indicated by mRNA levels and the transport ofand the passage number strongly affected the carrier- cephradine, the expression of carrier-mediated transportersmediated transporters PepT1 and HPT1 (Behrens et al., also reached a maximum after 21 days. While the peak of2003). Therefore, the influence of (1) time in culture, (2) Pgp expression in our studies correspond to results fromtype of membrane support and (3) seeding density on the the literature (Hosoya et al., 1993; Anderle et al., 1998),morphology, paracellular permeability, and the expression Matsumoto et al. (1995)observed a peak of PepT1of three relevant transporters, PepT1, HPT1 and Pgp, was expression already at day 14. Differences might be due toinvestigated. Moreover, a possible induction of PepT1 and the different type of Caco-2 clone, passage number and/orHPT1 expression was explored following incubation with culturing conditions.different supplemented media. During the first 2 weeks, monolayers were not fully

differentiated, as demonstrated by the weak actin-stain, flat4 .1. Time in culture monolayer morphology and low transporter expression.

The initial peak of TEER at day 7, which contradictsUnder our conditions, Caco-2 cells seemed to have earlier results (Briske-Anderson et al., 1997), can be

reached complete differentiation after 3 weeks. Using explained by the low cell density at that time (Walter andCLSM in combination with two fluorescent markers for Kissel, 1995). On the other hand, after 4 weeks, cell layersF-actin and the nucleus, Caco-2 cells were observed to seemed increasingly disorganized. Multilayer formationform homogeneous monolayers of tall, columnar-shaped could clearly be observed, possibly causing the finalcells. Most of the cells were covered by a thick carpet of increase in TEER, and lowering of Pgp expression.microvilli and only some displayed clusters of microvilli.This finding emphasized the great homogeneity of that 4 .2. Membrane supportparticular Caco-2 clone (Behrens et al., 2003). Moreover, astrong formation of tight junctions limiting the passive Transport experiments are usually performed on porousparacellular permeability of small hydrophilic molecules membrane supports. Apart from the most frequently usedand allowing the differentiation into polarized cell layers opaque PC inserts, translucent materials, such as PET andwas found. TEER-values were high, FD-4 permeability PE, are commercially available. Although Caco-2 cellslow, and actin staining strong. These observations are in grown on PET and PE membranes showed only slightagreement withBriske-Anderson et al. (1997),who also differences in carrier-mediated transporter expression as


caused by an increase of tight junctions’ organization,since actin staining of cell layers was stronger on PET andPE inserts than on PC inserts. A further explanation couldbe different cell–support interactions between the basola-teral cell surface with the extracellular filter matrix (Yuand Sinko, 1997). Increased tightness of the monolayerscan cause differences between the expression level ofPepT1 and cephradine permeability, especially when con-sidering that the permeability of cephradine consists of anactive and a passive component. Both PET and PE grownCaco-2 cells formed flat monolayers, indicative of a poordifferentiation. Moreover, PET caused differences in mi-crovillus structure. By contrast, no effect on the morpholo-gy and paracellular transport was found after collagen-coating prior to cell seeding. It even seemed to enhancedifferentiation and induce the expression of all carrier-mediated transporters. This agrees with the previousreports of the stimulating effect of collagen for differentia-tion of cell layers (East et al., 1992).

4 .3. Seeding density

Similar to time in culture, the seeding density of Caco-2cells varies strongly in the literature. Some authors have

4 2reported data using cultures seeded at 1310 cells /cm(Borchard et al., 1996), while others have used as many as

5 25310 cells /cm (Thwaites et al., 1993). No significantdifferences in TEER andP of FD-4 were observed,app

between the different seeding densities. Utilizing CLSMrecent observations showed that the monolayer structureand carrier-mediated transporter expression were stronglyaffected by this parameter. Higher seeding densities led tothe formation of multilayers, reflecting a disorganization ofthe cell layers. Lower seeding densities led to thin mono-layers, exhibiting a strong actin staining, which was alsofound in the paracellular spaces. This observation iscompatible with an alteration of the tight junction organi-zation. Moreover, a significant decrease of HPT1 and PgpmRNA expression levels could be regarded as a sign for adecreased differentiation of cell layers at higher and lowerseeding densities.

4 .4. Supplements to the medium

To investigate a possible induction of peptide transporterexpression, the standard cell culture medium was sup-plemented with various substrates of these transporters,Fig. 4. Apparent permeability coefficient (P ) of cephradine as a (a)app

4function of time in culture (7, 14, 21 and 28 days on PC at 6310 ), (b) such as Ala–Glu, Gly–Glu, peptone, and a common4membrane support (PC, PS, PET and Col for 21 days at 6310 ) and (c) antibiotic additive, pen/strep. Surprisingly, the addition of

4 4 5 2seeding density (1310 , 6310 and 1.2310 cells /cm on PC). The pen/strep did not increase mRNA levels and cephradinebars indicate mean6S.D. (n53).

transport, althoughb-lactam antibiotics are reported to besubstrates of PepT1 (Delie and Rubas, 1997). Ala–Glu and

compared to PC inserts, their cell morphology was sig- Gly–Glu showed an increase in expression levels for bothnificantly altered. Similar to the observations ofYu and transporters. The level of increase was lower than thatSinko (1997), PET and PE membranes decreased the reported earlier for Gly–Glu (Walker et al., 1998). Theparacellular permeability. This decrease was probably strongest increase of PepT1 expression was observed


Fig. 5. mRNA transcription of (a) PepT1 (484 bp) and (b) HPT1 (1783 bp) by RT-PCR as a function of supplements to the medium. HD39 represents thecontrol without any supplements and P the supplementation with 1% peptone. Actin (380 bp) was used as an internal standard to confirm the integrity andthe amount of cDNA subjected to PCR reaction. PCR-products were investigated on a 1.5% agarose gel stained with ethidium bromide at 100 V for 45min. M was the marker in all pictures.

following incubation with peptone. Expression levels establish its application as a model to predict the bioavail-increased by a factor of 1.5- to 2-fold. This increase of ability of drug substances in the context of the BCS, theHPT1 and PepT1 expression correlates with results in rats following culture conditions should be considered:(Erickson et al., 1995).

(1) Filter inserts: PC, since PE and PET filters stronglyrestrict the passive paracellular transport.

5 . Conclusions (2) Collagen coating, since it significantly enhances car-rier-mediated transporter expression without changing

Our results suggest that even small changes in culture morphology and paracellular permeability.4 2conditions, such as culture time, seeding density, and (3) Average Seeding density of 6310 cells /cm , since

membrane support, (Basic culturing conditions, such as this prevents changes in cell morphology, monolayerpassage number and origin of cells were kept constant), formation, and carrier-mediated transporter expres-lead to significant differences in the phenotype of cells and sion.carrier-mediated transporter expression. To ensure the (4) Medium supplement for investigating substrate-trans-reproducibility of the Caco-2 cell culture model and to porter interactions, since this increases the expression

levels.

Using these standardized conditions and appropriatecontrols, comparison of permeability data from differentlaboratories could be facilitated. More investigations ad-dressing inter-laboratory comparison of transport dataobtained in Caco-2 monolayers are clearly desirable and ithas to be noted that these guidelines may not be directlyapplicable when different clones or passage numbers areused.

R eferences

A dson, A., Burton, P.S., Raub, T.J., Barsuhn, C.L., Audus, K.L., Ho,N.F., 1995. Passive diffusion of weak organic electrolytes across

Fig. 6. Apparent permeability coefficient (P ) of cephradine as a Caco-2 cell monolayers: uncoupling the contributions of hydro-app

function of supplements to the medium. The bars indicate mean6S.D. dynamic, transcellular, and paracellular barriers. J. Pharm. Sci. 84,(n53). Significance between the mean values was calculated using 1197–1204.

¨ANOVA one-way analysis as described under Section 2. Probability A midon, G.L., Lennernas, H., Shah,V.P., Crison, J.R., 1995. A theoreticalvaluesP.0.05 were considered significant. (***P,0.001). basis for a biopharmaceutical drug classification: the correlation of in


vitro drug product dissolution and in vivo bioavailability. Pharm. Res. human colon carcinoma cell line (Caco-2) as a model system for12, 413–420. intestinal epithelial permeability. Gastroenterology 96, 736–749.

A nderberg, E.K., Lindmark, T., Artursson, P., 1993. Sodium caprate H oskins, J., DeHerdt, S.V., Moore, R.E., Burtol, T.F., 1993. The develop-elicits dilatations in human intestinal tight junctions and enhances drug ment and characterization of Vinca alkaloid-resistant Caco-2 humanabsorption by the paracellular route. Pharm. Res. 10, 857–864. colorectal cell lines expressing mdr-1. Int. J. Cancer 53, 680–688.

A nderle, P., Niederer, E., Rubas, W., Hilgendorf, C., Spahn-Langguth, H., H osoya, K., Kim, K.J., Lee,V.H.L., 1993. Expression of p-glycoprotein, aWunderli-Allenspach, H., Merkle, H.P., Langguth, P., 1998. P- drug efflux pump, in Caco-2 cell monolayers as a function of age.Glycoprotein (P-gp) mediated efflux in Caco-2 cell monolayers: the Pharm. Res. 13, 885–890.influence of culturing conditions and drug exposure on P-gp expres- I nui, K., Yamamoto, M., Saito, H., 1992. Transepithelial transport of oralsion levels. J. Pharm. Sci. 87, 757–762. cephalosporins by monolayers of intestinal epithelial cell line Caco-2:

A rtursson, P., Karlsson, J., 1991. Correlation between oral drug absorp- specific transport systems in apical and basolateral membranes. J.tion in humans and apparent drug permeability coefficients in human Pharmacol. Exp. Ther. 261, 195–201.intestinal epithelial (Caco-2) cells. Biochem. Biophys. Res. Commun. K amm, W., Jonczyk, A., Jung, T., Luckenbach, G., Raddatz, P., Kissel, T.,175, 880–885. 2000. Evaluation of absorption enhancement for a potent cyclopeptidic

A rtursson, P., Borchardt, R.T., 1997. Intestinal drug absorption and a b -antagonist in a human intestinal cell line (Caco-2). Eur. J.n 3

metabolism in cell cultures: Caco-2 and beyond. Pharm. Res. 14, Pharm. Sci. 10, 205–214.1655–1658. M atsumoto, S., Saito, H., Inui, K., 1995. Transport characteristics of

B ehrens, I., Stenberg, P., Artursson, P., Kissel, T., 2001a. Transport of ceftibuten, a new cephaloporin antibiotic, via the apical H1 /dipeptidelipophilic drug molecules in a new mucus-secreting cell culture model cotransport system in human intestinal cell line Caco-2: regulation bybased on HT29-MTX cells. Pharm. Res. 18, 1138–1145. cell growth. Pharm. Res. 12, 1483–1487.

¨B ehrens, I., Kamm, W., Dantzig, A.H., Kissel, T., 2003. Variation of R othen-Ruitshauser, B., Braun, A., Gunthert, M., Wunderli-Allenspach,peptide transporter (PepT1 and HPT1) expression in Caco-2 influences H., 2000. Formation of multilayers in the caco-2 cell culture model: asubstrate transport as a function of cell culture conditions. J. Pharm. confocal laser scanning microscopy study. Pharm. Res. 17, 460–465.

¨Sci. (submitted). S un, D., Lennernas, H., Welage, L.S., Barnett, J.L., Landowski, C.P.,B iragyn, A., Arkins, S., Kelley, K.W., 1994. Riboprobe expression Foster, D., Fleisher, D., Lee, K.-D., Amidon, G.L., 2002. Comparison

cassettes for measuring IGF-I, beta-actin and glyceraldehyde 3-phos- of human duodenum and Caco-2 gene expression profiles for 12,000phate dehydrogenase transcripts. J. Immunol. Methods. 168, 235–244. gene sequence tags and correlation with permeability of 26 drugs.

B orchard, G., Luessen, H.L., de Boer, A.G., Verhoef, J.C., Lehr, C.-M., Pharm. Res. 19, 1400–1416.Junginger, H.E., 1996. The potential of mucoadhesive polymers in T hamotharan, M., Bawani, S.Z., Zhou, X., Adibi, S.A., 1998. Mechanismenhancing intestinal peptide drug absorption on epithelial tight junc- of dipeptide stimulation of its own transport in a human intestinal celltions in vitro. J. Control. Release 39, 131–138. line. Proc. Assoc. Am. Phys. 110, 361–368.

¨B raun, A., Hammerle, S., Suda, K., Rothen-Rutishauser, B., Gunthert, M., T hamotharan, M., Bawani, S.Z., Zhou, X., Adibi, S.A., 1999. HormonalKramer, S.D., Wunderli-Allenspach, H., 2000. Cell cultures as tools in regulation of oligopeptide transporter pept-1 in a human intestinal cellbiopharmacy. Eur. J. Pharm. Sci. 11, S51–60. line. Am. J. Physiol. 276, C821–826.

B riske-Anderson, M.J., Finley, J.W., Newman, S.M., 1997. The influence T hwaites, D.T., Hirst, B.H., Simmons, N.L., 1993. Passive transepithelialof culture time and passage number on the morphological and absorption of thyrotropin-releasing hormone via paracellular route inphysiological development of Caco-2 cells. Proc. Soc. Exp. Biol. Med. cultured intestinal and renal epithelial cells. Pharm. Res. 10, 674–681.214, 248–257. v an de Waterbeemd, H., 1998. The fundamental variables of the bio-

D antzig, A.H., Hoskins, J.A., Tabas, L.B., Bright, S., Shepard, R.L., pharmaceutics classification system (BCS): a commentary. Eur. J.Jenkins, I.L., Duckworth, D.C., Sportsman, J.R., Mackensen, D., Jr Pharm. Sci. 7, 1–3.Rosteck, P.R., 1994. Association of intestinal peptide transport with a W alker, D., Thwaites, D.T., Simmons, N.L., Gilbert, H.J., Hirst, B.H.,protein related to the cadherin superfamily. Science 264, 430–433. 1998. Substrate upregulation of the human small intestinal peptide

D elie, F., Rubas, W., 1997. A human colonic cell line sharing similarities transporter, hPepT1. J. Physiol. 507, 697–706.with enterocytes as a model to examine oral absorption: advantages W alter, E., Kissel, T., 1995. Heterogeneity in the human intestinal celland limitations of the Caco-2 model. Crit. Rev. Ther. Drug Carrier line Caco-2 leads to differences in transepithelial transport. Eur. J.Syst. 14, 221–286. Pharm. Sci. 3, 215–230.

¨E ast, J.A., Langdon, S.P., Townsend, K.M., Hickman, J.A., 1992. The W alter, E., Kissel, T., Reers, M., Dickneit, G., Hoffman, D., Stuber, W.,influence of type I collagen on the growth and differentiation of the 1995. Transepithelial transport properties of peptidomimetic thrombinhuman colonic adenocarcinoma cell line HT-29 in vitro. Differentia- inhibitors in monolayers of a human intestinal cell line (Caco-2) andtion 50, 179–188. their correlation to in vivo data. Pharm. Res. 12, 360–365.

E rickson, R.H., Gum, Jr. J.R., Lindstrom, M.M., McKean, D., Kim, Y.S., W ils, P., Phung-Ba, V., Warney, A., Lechardeur, D., Raeissi, S., Hidalgo,1995. Regional expression and dietary regulation of rat small intestinal I.J., Scherman, D., 1994. Polarized transport of docetaxel and vin-peptide and amino acid transporter mRNAs. Biochem. Biophys. Res. blastine mediated by P-glycoprotein in human intestinal epithelial cellCommun. 216, 249–257. monolayers. Biochem. Pharmacol. 48, 1528–1530.

G utmann, H., Fricker, G., Torok, M., Michael, S., Beglinger, C., Drewe, Y u, H., Sinko, P.J., 1997. Influence of the microporous substratum andJ., 1999. Evidence for different ABC-transporters in Caco-2 cells hydrodynamics on resistances to drug transport in cell culture systems:modulating drug uptake. Pharm. Res. 16, 402–407. calculation of intrinsic transport parameters. J. Pharm. Sci. 86, 1448–

H idalgo, I.J., Raub, T.J., Borchardt, R.T., 1989. Characterization of the 1457.

do cell culture conditions influence the carrier-mediated transport of peptides in caco-2 cell...

Documents