DNA Structure and Protein Synthesis (also known

as Gene Expression)

Protein Synthesis

• The process of making proteins…

• Boring stuff?

• Nope

• This is how the information in your genes is used to build…

you!

DNA

• Deoxyribonucleic Acid (DNA) is found in what part of the cell?

• How is the DNA organized?Chromosomes!

Nucleus

Each strand of DNA is a POLYMER!!

• Individual nucleotides are the monomers!

• Monomers (nucleotides) are linked to form a long polymer of single-stranded DNA

• In our cells, 2 DNA polymers are bonded together to form a LONG double-stranded polymer

The Parts of a Nucleotide• SUGAR – deoxyribose

• Phosphate group (PO4)

• Nitrogen-containing base

A nucleotide

What are the 4 BASES?

ADENINETHYMINE

CYTOSINE

GUANINE

A DNA POLYMER!!

• Strong bonds hold the nucleotides together to form a ‘backbone’.

• They occur between the sugar of one nucleotide and the phosphate of the next nucleotide.

MORE ABOUT THE BASES…

• Adenine always bonds to thymine

• Cytosine always bonds to guanine

• Adenine –Thymine (A-T)

• Cytosine-Guanine (C-G)

How does DNA Replicate?

• DNA replication is making a COPY of ALL the genetic information (ALL the bases of DNA).

• This has to happen BEFORE cell division (either Mitosis or Meiosis) can occur.

• WHY does it have to happen?

The role of DNA• The material that genes are made of…

• Gene - segment of DNA that carries the information necessary to build a protein.

• Information is encoded in the sequence (order) of the four DNA bases (ATGC).

• A gene is a sequence of thousands of these bases that codes for a protein!

• The DNA in a single human cell = 3,000,000,000 bases (3 Billion!)

• However, scientists were surprised that there are only about 30,000 genes!!

DNA is Double Stranded Molecule• The four bases that make up the

genetic code (ATGC) form complimentary pairs.

• A pairs with T… G pairs with C.

• If one strand is ACGCAATTGCATT

• The other is TGCGTTAACGTAA

• This makes it possible for DNA copy it’s self…

Make a complementary strand!

• TTCCGATCGGCGTATCTGAGCGATCAG….

AAGGCTAGCCGCATAGACTCGCTAGTC

What is a gene?

• A Segment of DNA that contains the information that codes for a protein!!!

How do genes result in proteins?

• The DNA is in the NUCLEUS of the cell.

• Proteins are made on the ribosomes- where?

• In the cytoplasm!• So, the information needs to leave the

nucleus…..

• Can the DNA can leave the nucleus?

• NO, it cannot!

• The information for the gene needs to be copied in a way that the information CAN leave the nucleus!

• This process is the 1st step in Protein Synthesis- TRANSCRIPTION

Transcription:• The information in the DNA is

copied into a molecule of RNA (Ribonucleic acid).

• DNA can’t leave the nucleus so …a messenger (copy) is sent.

• mRNA is the messenger.

How is RNA different from DNA?•Monomer is a nucleotide with Ribose sugar, nitrogen base, and phosphate group

•In RNA, nitrogen bases are: Adenine, Guanine, Cytosine, and URACIL

•Complementary base pairs are C-G; A-U)

• RNA is Single Stranded; DNA is double stranded

• DNA: ATGCGTTAC

• mRNA: UACGCAAUG

• http://www.dnalc.org/resources/3d/03-mechanism-of-replication-basic.html

Transcribe this DNA sequence!

• DNA: GCCTTAAGACATTGTATGCCTAGCTAG

• Complementary mRNA:

CGGAAUUCUGUAACAUACGGAUCGAUC

What are differences between mRNA & DNA

• Location?

• Nucleotides?

• Double stranded? Single Stranded?

• How much genetic information is contained?

TRANSLATION• What do you do when you go from

one language to another? You TRANSLATE!

• mRNA carries the instructions for building the protein

• It takes place on the ribosomes (cellular machine that makes the protein by joining amino acids)

Translation

• The Sequence (order) of bases in the DNA/RNA determines the order of amino acids in the protein!

• The information is translated from the language of DNA/RNA (nucleic acids) to the language of proteins (amino acids).

What does the cell need to translate a mRNA?

• mRNA- information for making the protein

• tRNA- type of RNA that actually translates the information from nucleic acid (RNA) to amino acid (protein)

• Ribosome- the “machine” where translation takes place; binds the mRNA, tRNA, and joins the corresponding amino acids (the monomers of proteins!)

How is the mRNA translated to make a protein?

• Correct tRNA with an amino acid attached “reads” 3 nucleotides (a codon) in the mRNA and puts the correct amino acid in the growing polypeptide (unfolded protein!).

• This happens in the ribosome!!

Summary of transcription and translation

• Transcription – A copy of the information in DNA for a gene is encoded into RNA (takes place in nucleus).

• Translation – The RNA (messenger) serves as the plan for building a protein using tRNA as the translator and the ribosome as the “machine” (takes place in cytoplasm)

• http://www.lew-port.com/10712041113402793/lib/10712041113402793/Animations/Protein%20Synthesis%20%20long.swf