dna based analysis of thrips diversity and thrips...

DNA based analysis of thrips

diversity and thrips-borne Iris yellow

spot virus (Tospovirus: Bunyaviridae)

from Pakistan

Submitted in partial fulfillment of

Doctor of Philosophy

By

Romana Iftikhar

2015

Department of Biotechnology (NIBGE)

Pakistan Institute of Engineering and Applied Sciences

Nilore-45650 Islamabad, Pakistan

National Institute for Biotechnology and Genetic Engineering

P. O. BOX 577, JHANG ROAD, FAISALABAD.

(Affiliated with PIEAS, Islamabad)

Declaration of Originality

I hereby declare that the work accomplished in this thesis is the result of my own research

carried out in Agricultural Biotechnology Division (NIBGE). This thesis has not been

published previously nor does it contain any material from the published resources that

can be considered as the violation of international copyright law.

Furthermore, I also declare that I am aware of the terms “copyright” and “plagiarism” and

if any copyright violation was found out in this work, I will be held responsible of the

consequences of any such violation.

Signature: _______________

Name of the Student: Romana Iftikhar

Registration No. 10-7-1-017-2008

Date: ______________

Place: NIBGE, Faisalabad

National Institute for Biotechnology and Genetic Engineering

P. O. BOX 577, JHANG ROAD, FAISALABAD.

(Affiliated with PIEAS, Islamabad)

Research Completion Certificate

Certified that the research work contained in this thesis entitled “DNA based analysis

of thrips diversity and thrips-borne Iris yellow spot virus (Tospovirus:

Bunyaviridae) from Pakistan” has been carried out and completed by “Romana

Iftikhar” under my supervision during her PhD studies in the subject of Biotechnology.

---------------------------- ----------------------------

Date Dr. Muhammad Ashfaq (FFP)

Research Supervisor

Submitted Through

------------------------ ---------------------------

Dr. Shahid Mansoor Controller of Examination

Director NIBGE

Certificate of Approval

This is to certify that the work contained in this thesis titled “DNA based analysis of

thrips diversity and thrips-borne Iris yellow spot virus (Tospovirus:

Bunyaviridae) from Pakistan” was carried out by “Romana Iftikhar” in our

opinion is fully adequate in scope and quality for the degree of Doctor of Philosophy

in Biotechnology from Pakistan Institute of Engineering and Applied Sciences

(PIEAS).

Approved by:

Signature: _____________________

Dr. Muhammad Ashfaq

Internal Examiner/Supervisor

Verified by:

Signature: _____________________

Dr. Shahid Mansoor

Head, Department of NIBGE (Biotechnology)

Stamp:

i

ACKNOWLEDGEMENT

All praises are for Almighty Allah (the most affectionate, the most merciful), and

Holy Prophet Muhammad (May Allah Bless Muhammad & Descendants of

Muhammad). I bow before Almighty Allah with limitless humility and modesty that He

granted me with potential and ability to this material contribution to already existing

ocean of knowledge. I thank from the deep core of heart to Holy Prophet Muhammad

(May Allah bless and peace be upon him) forever a torch of guidance and knowledge

for humanity as a whole.

Special gratitude is due to Higher Education Commission (HEC) of Pakistan for

providing a scholarship under the “Indigenous 5000 fellowship programme Phase

IV” with out which such a costly research project could not be completed.

I crave to thank my eminent supervisor Prof Dr. Muhammad Ashfaq, HEC foreign

faculty member for accepting me as his PhD student. He is a wonderful man and

scientist. He taught me from pipetting to data analysis and how to present scientific

data. I have learned a lot from his experiences not only in research but also in other

fields of life. I am really obliged to him for holding me to a high research standard

and enforcing strict validations for each research result, and thus teaching me how to

do research. His supervision and suggestions helped me in overcoming many

technical difficulties and for all the useful insightful discussions to improve my

research. His presence was always a source of confidence for me. It was indeed an

honor to work under his guidance.

It is my pleasure to thank Dr. Zafar Mehmood Khalid and Dr. Sohail Hameed

former Directors, National Institute for Biotechnology and Genetic Engineering

(NIBGE), Faisalabad, who have been very kind to provide every possible facility to

carry out this research work. I express my deepest gratitude to current Director Dr.

Shahid Mansoor Deputy chief Scientist for facilitating me during research work.

My sincerest appreciations are due to Dr. Hanu R. Pappu, Department of Plant

Pathology, Washington State University, Pullman, USA for my training in virology. I

am very thankful for his precious suggestions, dedicated efforts, kind supervision,

affectionate criticism, extremely encouraging behavior, and inspiring guidance

provided to me throughout the course of virus study. He helped me in each step of

research during my stay in USA. I can never forget the invaluable help and guidance

of Dr. S.V. Ramesh and Dr. Sudeep bag during my research work in USA and Dr.

Khalid Naveed for his helping and friendly behavior to make my stay in USA more

comfortable.

I am very grateful to Dr. Paul Hebert, Director, Biodiversity Institute of Ontario,

University of Guelph Canada and his co-workers at the Canadian Centre for DNA Barcoding for sequencing barcodes of my thrips specimens.

I am extremely thankful to Dr. R. Srinivasn, University of Georgia, Tifton, USA for

giving the opportunity to learn the morphological identification and thrips rearing in

his laboratory and Mr. Stan Diffie, University of Georgia, Tifton, USA for giving me

training in morphological identification and helping me with thrips identification. I

thank to Mr. Sueo Nakahara, USDA ARS, Beltsville MD (retired) for reviewing the

ii

thrips species identification. I am also thankful to Valerie Lynch-Holm, Ph.D.

Franceschi Microscopy & Imaging Center, Washington State University, Pullman,

USA for giving me training and help in electron microscopy of thrips.

I am thankful to my lab colleagues Dr. Akhtar Rasool, Mr. Saleem Akhtar, Dr.

Innam Ullah, Mr. Tayyib Naseem, Dr. Arif M. Khan, Mr. Qamar Abbas, Mr. Shah

Sawar and all others for their cooperation and help in experimental work. I want to

thank to my dear friend, Afshan Mashkoor. The time spent with you is really

memorable. I cannot forget the moments spent with you. I have no words to pay

sincerest thanks to classfellows and hostelmates for their help, encouragement. Their

company made my stay comfortable at NIBGE.

No acknowledgements would ever adequately express my obligation to my loving

brothers, Arbab Iftikhar and Usman Iftikhar, and my cute, loving sister Asna

Iftikhar who always wished me health and success.

Last but not the least, I find it hard to express my gratitude and appreciations in

words to my affectionate parents Mr. Muhammad Iftikhar (Late) and Farhat

Iftikhar who always wished to see me glittering high on the skies of success. None of

this would have been possible without their love, patience and prayers. I am in short

of words to thank my Appo Ji (Late) and uncles, Mr. Israr Ahmad (Late) and Mr.

Isar Javed and my grandparents (Late) for their love, care and support. Finally, it

has been a great pleasure for me to conduct my PhD work but I still have a long way

to go….

Romana Iftikhar

August, 2014

iii

Table of Contents

Contents Page #

Acknowledgment I

Table of contents iii

List of Figures viii

List of Tables ix

List abbriviations x

Abstract xiii

Chapter 1 .................................................................................................................................... 1

INTRODUCTION AND REVIEW OF LITERATURE ........................................................... 1

1.1 Thrips ................................................................................................................... 1

1.1.1 Morphology ......................................................................................................... 1

1.1.2 Feeding behavior ................................................................................................. 1

1.1.3 Dispersal .............................................................................................................. 3

1.1.4 Reproduction....................................................................................................... 4

1.1.5 Life cycle of thrips ............................................................................................... 4

1.2 Taxonomic classification .................................................................................... .5

1.3 Thrips diversity……………..……………………..………………………...……………………………. 6

1.4 Importance of thrips ........................................................................................... 8

1.5 Identification of thrips ........................................................................................ 9

1.5.1 Morphological identification ............................................................................. 10

1.5.2 Molecular identification .................................................................................... 10

1.5.2.1 Use of COI and emergence of DNA Barcoding .................................................. 11

1.6 Thrips and Tospovirus transmission .................................................................. 12

1.7 Tospoviruses ..................................................................................................... 13

1.7.1 Genome Organization ....................................................................................... 14

1.8 Importance of tospoviruses .............................................................................. 16

1.9 Rationale for this study ..................................................................................... 16

1.10 Objectives .......................................................................................................... 17

iv

Chapter 2 .................................................................................................................................. 19

GENERAL MATERIALS AND METHODS ......................................................................... 19

2.1 Thrips collections .............................................................................................. 19

2.1.1 Locations surveyed ............................................................................................ 19

2.1.2 Habitats surveyed ............................................................................................. 19

2.1.3 Collection of specimens .................................................................................... 20

2.2 Tospovirus survey, sample collection (plants and thrips), preservation and

identification ..................................................................................................... 20

2.3 Enzyme-linked immunosorbent assay (ELISA) for thrips and plant samples .... 24

2.3.1 Direct Antigen-Coated (DAC) ELISA for testing thrips for IYSV ......................... 24

2.3.2 Double Antibody Sandwich (DAS) ELISA testing of plants for IYSV ................... 24

2.4 IYSV nucleocapsid (N) gene fragment isolation and cloning of PCR products .. 25

2.4.1 RNA extraction .................................................................................................. 25

2.4.2 RNA quantification ............................................................................................ 25

2.4.3 cDNA synthesis .................................................................................................. 26

2.4.4 DNA polymerase chain reaction (PCR) .............................................................. 26

2.4.5 Agarose gel electrophoresis of PCR products ................................................... 26

2.4.6 Ligation .............................................................................................................. 27

2.4.7 Transformation ................................................................................................. 27

2.4.8 Colony PCR ........................................................................................................ 27

2.4.9 Screening of clones through restriction analysis .............................................. 28

2.4.10 Glycerol stocks of the confirmed clones ........................................................... 29

2.4.11 Sequencing ........................................................................................................ 29

2.4.12 Nucleotide sequence alignments and Phylogenetic analysis ........................... 29

Chapter 3 .................................................................................................................................. 30

THYSANOPTERA DIVERSITY: SURVEY IN PAKISTAN ................................................ 30

3.1 INTRODUCTION ................................................................................................. 30

3.1.1 Thrips taxonomy ............................................................................................... 30

3.1.2 Thrips diversity in South-East Asia .................................................................... 30

3.1.3 Thrips diversity in Pakistan ............................................................................... 31

3.1.4 Objectives of this study ..................................................................................... 32

v

3.2 MATERIAL AND METHODS ................................................................................ 32

3.2.1 Locations and havitats surveyed and collection of specimens ......................... 32

3.2.2 Slide preparation ............................................................................................... 32

3.2.3 Labeling ............................................................................................................. 32

3.2.4 Morphological characters ................................................................................. 33

3.2.5 Identification ..................................................................................................... 33

3.3 RESULTS ............................................................................................................. 35

3.3.1 Thrips diversity .................................................................................................. 35

3.3.2 Thrips species recorded during the survey ....................................................... 35

3.4 DISCUSSION ....................................................................................................... 42

Chapter 4 .................................................................................................................................. 44

ANALYSIS OF THRIPS BY DNA BARCODING ................................................................ 44

4.1 INTRODUCTION ................................................................................................. 44

4.1.1 Identification of thrips ...................................................................................... 44

4.1.2 Thrips identification based on molecular studies ............................................. 45

4.1.2.1 Introduction of DNA barcoding ......................................................................... 45

4.1.2.2 DNA barcoding in thrips species identification……………………………. ...47

4.1.3 Objective of the current study .......................................................................... 48

4.2 MATERIALS AND METHODS .............................................................................. 48

4.2.1 Collection of insects and storage ...................................................................... 48

4.2.2 Database ........................................................................................................... 48

4.2.3 Plate arrays........................................................................................................ 49

4.2.4 DNA extraction .................................................................................................. 49

4.2.5 DNA polymerase chain reaction (PCR) .............................................................. 49


4.2.7 Data analysis ..................................................................................................... 50

4.2.7.1 Species discrimination using DNA barcodes….………………………………………......…50

4.2.7.2 Genetic diversity and phylogenetic analysis…………………….………………..….……...50

4.2.8 Scanning Electron Microscopy (SEM) ................................................................ 51

vi

4.2.9 Haplotype and distribution analysis .................................................................. 52

4.3 RESULTS ............................................................................................................. 52

4.3.1 DNA barcode analysis of thrips species ............................................................ 52


4.3.3 SEM of cryptic thrips vector species ................................................................. 71

4.3.4 Global haplotype diversity ................................................................................ 72

4.4 DISCUSSION ....................................................................................................... 79

Chapter 5…………………….……………………………………………………………………………………………… ……..82

GLOBAL ANALYSIS OF POPULATION STRUCTURE, SPATIAL AND TEMPORAL

DYNAMICS OF GENETIC DIVERSITY, AND EVOLUTIONARY LINEAGES OF IRIS

YELLOW SPOT VIRUS (TOSPOVIRUS: BUNYAVIRIDAE) ............................................ 82

5.1 INTRODUCTION ................................................................................................. 82

5.1.1 Tospoviruses: Introduction and importance .................................................... 82

5.1.2 Genome organization ........................................................................................ 83

5.1.3 Tospovirus transmission ................................................................................... 87

5.1.4 Iris yellow spot virus: Introduction and importance ......................................... 88

5.1.5 Importance of Onion in Pakistan ...................................................................... 91

5.1.6 Epidemiology of IYSV ........................................................................................ 92

5.1.7 Assay, detection and diagnosis of Tospoviruses ............................................... 92

5.1.8 Importance of this work .................................................................................... 93

5.1.9 Objectives .......................................................................................................... 93

5.2 MATERIAL AND METHODS ................................................................................ 94

5.2.1 Collection of thrips and plant samples for tospovirus studies .......................... 94

5.2.2 Enzyme-linked immuno-sorbent assay (ELISA) ................................................. 94

5.2.3 Reverse-transcriptase polymerase chain reaction (RT-PCR) ............................. 94

5.2.4 Sequence annotation and analysis ................................................................... 95

5.2.5 In silico RFLP Analysis of the nucleoprotein gene ............................................. 95

5.2.6 Temporal analysis of IYSV genotype distribution ............................................. 95

5.2.7 Recombination detection Analysis .................................................................... 95

5.2.8 Population selection studies and neutrality tests ............................................. 96

vii

5.2.9 Genetic differentiation and gene flow estimates ............................................. 96

5.3 RESULTS ............................................................................................................. 96

5.3.1 Symptomatology ............................................................................................... 96

5.3.2 Enzyme-linked immune-sorbent assay (ELISA) for IYSV.................................... 97

5.3.3 Molecular characterization ............................................................................... 97

5.3.4 Restriction fragment length polymorphism .................................................... 100

5.3.5 Sequence diversity, DNA polymorphism and phylogeny of the N gene ......... 103

5.3.6 Temporal shift in IYSV Genotype .................................................................... 106

5.3.7 Recombination detection ................................................................................ 106

5.3.8 Population selection and test of neutrality .................................................... 110

5.3.9 Genetic differentiation .................................................................................... 111

5.4 DISCUSSION ..................................................................................................... 113

Chapter 6 ................................................................................................................................ 116

GENARAL DISCUSSION .................................................................................................... 116

RECOMMENDATIONS/ FUTURE WORK ........................................................................ 119

Chapter 7 ................................................................................................................................ 120

REFERENCES ...................................................................................................................... 120

APPENDICES ....................................................................................................................... 166

SUPPLEMENTARY TABLE………………………….…………………………………………………......…...…….…...174

PUBLICATIONS……………………………….…………………………...……………………………………………….191

viii

LIST OF FIGURES

Figure 1.1 Schematic model of tospovirus transmission cycle 15

Figure 1.2 Schematic diagram of tospovirus genome 15

Figure 2.1 Physical map of Pakistan with locations of thrips collections indicated

by black triangles

21

Figure 3.1 Diagram of Frankliniella tritici (Fitch) representing the standard

morphological characters used in morphological identifications

34

Figure 4.1 A) Pictures of thrips species (Terebrantia) from Pakistan on BOLD. B)

Pictures of thrips species (Tubulifera) from Pakistan on BOLD

58

Figure 4.2 Barcoding gap analysis (BGA) of thrips species from Pakistan (A)

Maximum intraspecific distance of thrips species versus nearest

neighbor distances (B) Mean intraspecific distance of thrips species

versus nearest neighbor distances (C) Number of individuals per thrips

species versus maximum intraspecific distance (D) Frequency

histogram of distance to nearest neighbor

64

Figure 4.3 Pairwise distance analysis of thrips species from Pakistan generated by

Automatic Barcode Gap Discovery (ABGD)

66

Figure 4.4 NJ tree based on COI sequences (with 500 boot strap value) constructed

with the Kimura two-parameter model

67

Figure 4.5 Barcode-based Phylogenetic analysis of thrips using the Bayesian

inference

69

Figure 4.6 Cluster and distance analysis of 3’COI region of cryptic thrips vector

species (A) T. palmi (B) T. tabaci. Two letter country code provided

with each accession number used in this analysis

70

Figure 4.7 Scanning electron micrographs of cryptic thrips vector species (A) T.

palmi (B) T. tabaci

71

Figure 4.8 Barcode haplotype network analysis of four major thrips vector species

from Pakistan (A) T. tabaci (B) T. palmi (C) S. dorsalis (D) T. flavus

77

Figure 5.1 Phylogeny based on amino acid sequences of nucleocapsid protein of

known tospoviruses

85

Figure 5.2 Schematic representation of the genome organization and replication

strategy of tospoviruses, showing the tree RNAs: Large (L), Medium

(M) and Small (S). The rectangular boxes indicate the proteins coded

86

Figure 5.3 Plant samples showing the IYSV specific symptoms 99

Figure 5.4 PCR amplification of IYSV N gene (1100bp) 99

Figure 5.5 Genotyping of IYSV accessions based on in silico RFLP simulation of

nucleocapsid (N) gene (percentage of accessions under various

genotypes)

101

Figure 5.6 Geographical distribution of various IYSV genotypes 101

Figure 5.7 Host distribution of various IYSV genotypes 102

Figure 5.8 Phylogenetic tree of nucleotide sequences of the nucleocapsid gene of

IYSV isolates available in GenBank

104

Figure 5.9 Temporal shift in genotypes of IYSV (A) IYSV genotypes reported

during the period (1997-2005) (B) IYSV genotypes reported during the

period (2006-2013)

107

Figure 5.10 Recombination events within N gene of various accessions as detected

by RDP v4

108

ix

LIST OF TABLES

Table 2.1 Collection date of samples (onion plants and thrips), location and GPS

coordinates in Pakistan

22

Table 3.1 A check list of thrips species recorded from Pakistan (1947- to date). A)

Family Phlaeothripidae B) Family Aeolothripidae C) Family

Thripidae

36

Table 3.2 GPS coordinates and plant sources of newly recorded thrips species in

current study

40

Table 4.1 Percentage K2P sequence divergence at the COI barcode region among

the 33 thrips species with >2 specimens, among 5 genera with two or

more species and among the 2 families with two or more genera

55

Table 4.2 Barcode Index Numbers (BINs) and maximum intraspecific distances

for thrips species from Pakistan and other countries

56

Table 4.3a Comparisons between geographic region (Asia, Europe, Australia and

America) by AMOVA using COI gene sequences of T. tabaci

75

Table 4.3b Comparisons between geographic region (East Asia, South Asia,

Southeast Asia and Europe) by AMOVA using COI gene sequences of

T. palmi

75

Table 4.3c Comparisons between geographic region (East Asia, South Asia,

Southeast Asia and North America) by AMOVA using COI gene

sequences of S. dorsalis

76

Table 4.3d Comparisons between geographic region (East Asia and South Asia) by

AMOVA using COI gene sequences of T. flavus

76

Table 5.1 List of currently accepted and tentative tospovirus species

(http://ictvonline.org/virusTaxonomy.asp?bhcp=1) and the GenBank

accessions numbers used for comparisons

84

Table 5.2 List of Iris yellow spot virus (IYSV) isolates first reports from different

countries

89

Table 5.3 Genetic diversity of the nucleocapsid gene in various IYSV genotypes

and the population as a whole

105

Table 5.4 Summary of codon substitution studies in nucleocapsid gene of IYSV

genotypes

109

Table 5.5 Summary of Neutrality tests in IYSV population 112

Table 5.6 Genetic differentiation and gene flow of the nucleocapsid gene between

among different IYSV genotypes

112

http://ictvonline.org/virusTaxonomy.asp?bhcp=1

x

LIST OF ABBREVIATIONS

A- Adenine

Amp- Ampicillin

°C- Degree Celsius

%- Percent

µg- Micrograms

µL- Microlitre

µM- Micromolar

ng- Nanogram

BLAST- Basic Local Allignment Search Tool

BOLD-Barcode of Life Data Systems

bp- Base pair

C- Cytosine

cDNA- Complementary DNA sequence

dATP- Deoxyadenosine Triphosphate

dCTP- Deoxycytidine Triphosphate

ddH2O-Double Distilled Water

dGTP- Deoxyguanosine Triphosphate

DEPC- Diethylpyrocarbonate

DNA- Deoxyribonucleic acid

dNTP-DeoxyriboNucleotide TriPhosphate

dTTP- Deoxythymidine Triphosphate

EB- Elution Buffer

EDTA- Ethylenediaminetetraacetic acid

EtBr- Ethidium Bromide

g- Grams

xi

G- Guanine

GDP- Gross Domestic Product

GPS- Global Positioning System

h- Hour

IPTG- Isopropyl β-D-1-thiogalactopyranoside

kDa- KiloDalton

kg- Killogarm

LB- Lura Bertani

LSD- Least Significant Difference

M- Molar

mg- Milligrams

min- Minutes

ml- Millilitres

mM- Millimolar

mm- Millimeter

mRNA- Messenger RNA

NCBI- National Center for Biotechnology Information

nt- Nucleotide

PCR- Polymerase Chain Reaction

pM- Picomole

RT-PCR- Reverse Transcription PCR

RdRp- RNA dependant RNA Polymerase

RNA- Ribonucleic Acid

rpm- Resolution Per Minute

rRNA- Ribosomal RNA

RT- Reverse Transcription

xii

SDW- Sterile Distilled Water

T- Thymine

TAE- Tris Acetate EDTA

TE- Tris EDTA

U- Units

UV- Ultra Violet

V- Volts

xiii

ABSTRACT

Thrips (Thysanoptera) are one of the most economically important groups of

crop pests at a global scale which damage a wide range of field and horticultural

crops. Some thrips species also serve as vectors of plant viruses. Despite the

importance of this tiny insect as pests, predators, fungal feeders, gall formers,

pollinators and virus vector, scant work was carried out on their systematics in

Pakistan. Currently thrips taxonomy in Pakistan is solely based on morphological

identification. Present study focused on thrips species identification based on the

morphological characters, and developing a database of thrips fauna and their

characterization based on DNA barcoding. Thrips were collected from multiple plants

during 2009-2012 at 158 sites in three climatic regions of Pakistan. Twelve species

from five genera of the suborder Tubulifera and twenty nine species from seventeen

genera of the suborder Terebrantia were identified following standard taxonomic

keys. A checklist of species reported in Pakistan since 1947 including thrips from the

current survey was compiled. A comparison of our species with those previously

reported from this region showed that one species (Apterygothrips

pellucidus Ananthakrishnan) from Tubulifera and seven species (Chaetanaphothrips

orchidii Moulton, Chirothrips meridionalis Bagnall, Megalurothrips distalis Karny,

M. usitatus Bagnall, Neohydatothrips samayunkur Kudo, Taeniothrips major, Thrips

trehernei Priesner) from Terebrantia and four genera (Apterygothrips,

Chaetanaphothrips, Neohydatothrips, Taeniothrips) were the first reports from

Pakistan. Mitochondrial COI sequences were used for discriminating 471 thrips that

represented 55 species in the current survey. Sequence analysis revealed that the

intraspecific and interspecific distances ranged from 0.0% to 7.5% and 2.3% to

22.3%, respectively. In addition, the study showed that four of the major thrips

species in the region, Aeolothrips intermedius, Haplothrips reuteri, Thrips palmi and

Thrips tabaci were cryptic species complexes. The study showed that DNA barcoding

successfully discriminated regional thrips species including those which were

morphologically cryptic. A barcode reference library for thrips from Pakistan was

compiled and regional lineages of four important virus-vector thrips were connected

with those from other countries by haplotype networks. A survey to determine the

xiv

incidence of selected tospoviruses was carried out in onion-growing regions of the

Punjab province of Pakistan during February-May and September-October 2012 in

thirteen administrative districts. Plants with symptoms suggestive of Iris yellow spot

virus (IYSV) infection were collected and tested for the presence of the virus by

ELISA and RT-PCR. Sequence analysis of RT-PCR amplified nucleocapsid (N) gene

confirmed IYSV infection of onion in Pakistan. This was the first report of IYSV

infecting onion in Pakistan. A global analysis of more than 100 IYSV N gene

sequences was carried out to determine the comparative population structure, spatial

and temporal dynamics with reference to its genetic diversity and evolution. Global

IYSV population could be grouped into two genotypes, IYSVBR and IYSVNL and the

analysis showed that the two genotypes were almost equally distributed. A temporal

shift was observed from IYSVNL to IYSVBR genotype over a period of 15 years (1997

to 2013). The diversity in IYSV population and temporal shift in IYSVBR genotype is

attributable to genetic recombination, abundance of purifying selection, insignificant

positive selection and population expansion. Restricted gene flow between the two

major IYSV genotypes (IYSVBR and IYSVNL) further emphasizes the role of genetic

drift in modeling the population architecture, evolutionary lineages and epidemiology

of IYSV.

Chapter 1 Indtroduction and review of literature

1

Chapter 1

INTRODUCTION AND REVIEW OF LITERATURE

1.1 Thrips

1.1.1 Morphology

Thrips are tiny, slender insects belonging to the order Thysanoptera. Their size

ranges from 0.5 to 10 mm. This insect was given the scientific name Thrips by

Linnaeus in 1758 (Lewis, 1997) because of its fringed wings, Thysanos (Fringe) and

Petron (wing). Thrips are commonly known as thunder flies, thunder bugs, storm

flies, thunder blights and corn lice. They have characteristic piercing and sucking

mouthparts with well-developed left mandible and an eversible pretarsal bladder

(arolium) which is different from other insects (Moritz, 1982; Hunter and Ullman,

1992). They are also referred to as “bladder footed insects” or physapoda as their legs

terminate in a small, protrusible bladder. Their body can be clearly differentiated into

head with antennae, a prothorax, a meso- and metathorax and an 11-segmented

abdomen which bears a well-developed ovipositor in sub-order Terebrantia. The

Antennae comprise of 4 to 9 segments which bear sense organ of different size, shape

and position (Heming, 1975; Moritz, 1982b, 1989b). The abdominal segments II and

VIII of adult bear stigmata while depending on the species, segment VIII often has a

complete comb.

1.1.2 Feeding behavior

Thrips are universal in nature and inhabit different kinds of flowers, grasses,

tender leaves of plants and beneath the bark of living and dead trees and feed on

leaves, pollen, fruits, liquids (Kirk 1995, Lewis 1997). They are phytophagous, most

commonly thought of as flower-living insects but approximately 50% of thrips

species feed only on fungi, on fungal hyphae in leaf litter or on dead wood (Mound

and Palmer, 1983) and a very few are known to be predaceous feeding mostly on


2

mites, thrips, coccids, whiteflies and psocids (Mound and Marullo, 1998). Adult and

larvae of some groups of thrips feed on the flower tissues, including pollen grains as

well as the cells around the bases of anthers and on developing fruits by sucking the

cell sap (Kirk, 1984). Some other groups of thrips feed only on leaves during adult

and larval stages i.e., species of some genera feed on very young leaves (e.g.

Scirtothrips), whereas others (e.g. Selenothrips) are found typically on older leaves

(Fennah, 1965). Many of the flower-living species of genus Aeolothrips are

facultative predators (Kirk, 1985) while some other species of the same genus as well

as few thripidae and a few Phlaeothripidae are obligate predators of small arthropods

(Palmer and Mound, 1990). Ananthakrishnan (1973) has described the basic features,

binomics and ecology, control methods of thrips in general, crop-wise distribution of

economically important thrips and role of thrips in viral disease transmission and gall

formation in India. Thrips larvae and adults feed on the same tissues of the plant and

the difference between the mouth parts of the larvae and adults were insufficient to

account for the difference in viral transmission (Sakimura, 1947). Singh (1947)

recorded Thrips carthami from pampore and reported Liothrips bosei Moulton in

large numbers on wild plant in Tangmarg. Bhatti and Mound (1980) recognized 7 new

genera of Thrips Linnaeus which feed on grasses and cereals.

Feeding apparatus of thrips is unique among insects with only left mandible.

However they are broadly similar across all families of thrips and between larvae and

adults and are used in a similar way. Under the head, individual mouthparts are found

consisting of mouthcone. For feeding a single mandible and a pair of maxillary stylets

protrude out of mouth cone of individual. Mandible, like a microscopic needle is used

to pierce a hole in cell wall of plant cells while the maxillary stylets form a tube

which can enter the tissue through or next to the hole made by mandible and suck the

cell sap. Because of this feeding behavior which include first piercing and then

sucking the liquids from cell, thrips are described as piercing-sucking insects (Hunter

and Ullman, 1992). The maxillary stylets of different species only varies in length and

do not show any adaptation to the food imbibed, except in the spore feeding species

which have broad feeding channel (Mound, 1971). Thrips cause damage to plants by

direct feeding on them. Their feeding behavior on leaves has been studied by direct

observation (Heming, 1978; Hunter and Ullman, 1989) and it appears to be similar to


3

that on fruits and petals (Childers and Achor, 1991; Achor and Childers, 1995).

Round feeding marks are left on tomato by F. occidentalis (Kumar et al., 1995). On

susceptible varieties of cucumber feeding holes are grouped together (Mollema et al.,

1995) whereas trails of feeding sites are found on peanut leaflets (Mitchell et al.,

1995). Gall thrips in a broad sense feed in a similar way like non galling thrips and

have large salivary glands (Heming, 1993) which is involved in stimulating the

galling response of the plants (Mound, 1994). Some thrips species both in Tubulifera

and Terebrantia are specialist predators that feed on prey (Mound and Marullo 1998).

Some phytophagous thrips species i.e., F. occidentalis, T. tabaci can also be predatory

(Trichilo and Leigh, 1986; Wilson et al., 1996). Thrips can also feed on exposed

liquids such as water droplets on leaves, sugar solutions and nectars (Heming, 1978).

1.1.3 Dispersal

Many thrips species have the crawling behavior. They crawl to the top of the

plant or twig by jumping but for the aerial dispersal thrips are not dependent on the

presence of wings as several wingless species of thrips disperse through the air more

effectively than the fully winged species (Mound, 1972). They can disperse by long

distances depending on the wind system of the area. Like many other small insects,

the wings of thrips are fringed with long cilia. In sub order Terebrantia, like normal

setae, these cilia arise from sockets but in family Phlaeothripidae they arise as

extensions of the wing membrane (Ellington, 1980; Mound et al., 1980). Wings are

adjusted before and during flight by rearrangement of fringe cilia to increase the wing

area (Ellington, 1980). During flight, wing movement is maintained by the complex

interaction of an array of oscillatory muscles (Moritz, 1989). After emergence from

the pupae, adults take a short period of teneral development to function their wing

muscles e.g., Limothrips cerealium takes about 5 hours at 20°C (Lewis, 1973) but it is

considerably short for tropical species. Flight capability also differs between sexes. It

is obvious that only female can be airborne in species with wingless males, but

females predominate in aerial populations in some fully winged species. Immature

individuals from several thrips species e.g., Limothrips cerealium, Frankliniella

intonsa predominate in airborne populations distant from host crops during migrations

in spring and autumn whereas gravid females mostly fly locally among host plants


4

and in some species of Thrips and Taeniothrips seem less inhibited flyers (Lewis,

1965).

1.1.4 Reproduction

Reproduction starts with the copulation between adults of opposite sex in most

of the Thysanoptera. Thrips are haplodiploid, as male thrips are haploid as they

emerge from an unfertilized egg formed as a result of parthenogenesis while fertilized

eggs always develop into females which are diploid. Many thrips species belonging to

different genera have evolved the ability to reproduce in the absence of males

(Mound, 1976). Obligate Parthenogenesis occurs in few thrips species which results

only in female progeny (thelytoky) and rarely males (deuterotoky). Sexual and

asexual reproduction is common in T. tabaci (Zawirska, 1976) and virgin females can

produce both sexes in the species Apterothrips apteris (Mound, 1992). This type of

reproduction has clear impact for invading pest thrips species to new area. Sexual

dimorphism is common in thrips and sometime remarkable differences are found

between the male and female (Anathakrishnan, 1969). In flower inhibiting thrips

species males are usually smaller than females while in many fungus-feeding species

of family Phlaeothripidae males are larger than the females with conspicuous

tubercles or fore tarsal teeth that reflects their breeding structure in which male

commonly serves as defender of female or an egg mass from the attention of other

males (Crespi, 1990). As these sexual differences is often the subject of allometric

growth patterns in this order, they result in confusing patterns of intra-specific

variation and create problems in correct species identifications (Palmer and Mound,

1978).

1.1.5 Life cycle of thrips

A variety of biologies are found in order Thysanoptera. The life cycle of thrips

begins with a tiny oval shaped egg; the new born larvae are actively feeding with only

two larval instars, followed by nonfeeding one pro-pupa and one or two pupal stages

and then the fully winged, short winged or wingless adult depending on the sex and

species of thrips (Lewis, 1973). Ovipositor morphology clearly distinguishes the two

sub-orders of Thysanoptera. Terebrantian female have well developed ovipositor


5

which is in upward position in Aeolothripidae and in downward position in other

Terebrantian. This ovipositor is used to pierce the plant tissue to deposit the eggs in

plant tissues. While in Tubulifera this ovipositor is reduced to U shaped chute

(Heming, 1995) and eggs laid on the surface of food substrate (Lewis, 1973). The

members of family Phlaeothripidae deposit their eggs on the food substrate either

horizontally or vertically while members of family Terebrantia insert the eggs into

plant tissues by means of their ovipositor. All Phlaeothripidae members have two

pupal stages found together with the larvae and adults while all members of

terebrantia have one pupa following the propupa and found in the soil away from the

larval feeding site. Life cycle of thrips takes less than 21 days during warm weather

(Brodsgaard, 1994). In many thrips body size of larvae increases rapidly after

hatching and first and second instar larvae resemble to the adult thrips apart from the

wings and genital organs. These two are actively feeding instars. These are followed

by two or three inactive, non-feeding propupal and pupal stages which leads to fully

developed adult thrips.

1.2 Taxonomic classification

Thysanoptera was suggested to be divided into three sub-orders, Terebrantia,

Tubulifera and Polystigmata (Bagnall, 1912). But according to a widely accepted

classification, Thysanoptera is divided into two sub-orders, Terebrantia and

Tubulifera (Halidy, 1836; Priesner, 1968). Tubulifera has a range of distinct

characters including structures of sperm and adult as well as life history but the major

distinguishing character is the presence of tubular tenth abdominal segment. Mound et

al. (1980) has placed family Phlaeothripidae in the sub-order Tubulifera. The family

Phlaeothripidae is composed of two sub-families, Idolothripinae and Phlaeothripinae.

Almost 50% of the species of Phlaeothripidae feed on fungal hyphae found on dead

branches and leaf litter, but a large number of Oriental species produce leaf galls. One

group of species in this family is abundant on flowers of grasses and Asteraceae, and

a few species are predators on arthropods. Two largest families of thrips are

Phlaeothripidae and Thripidae. There are 2400 described species in family Thripidae,

while about 3500 described species are placed in the family Phlaeothripidae (Mound

and Morris, 2007).


6

1.3 Thrips diversity

Stannard (1957) has worked on Thysanoptera and published a monograph on

the phylogeny of Tubulifera of North America. A key to six species of Chirothrips

from the Australian region was provided by Strassen (1960). Priesner (1961)

identified 10 tribes of thrips; Plectrothripini; Haplothripini; Phlaeothripini;

Hoplothripini; Glyptothripini; Hyidiothripini; Leeuweniin; Emprosthiothripini;

Terthrothripini and Rhopalothripini and a sub-family Urothripininae and 13 sub tribes

in the Hoplothripini. Baily (1964) provided a key to 13 species of genus Scirtothrips

from North America. Sakimura (1967a) reworked on the genus Chaetothrips Priesner

and recognized the three taxa with keys to the species. Sakimura (1967b) also

redefined the generic and sub-generic characters of Isoneurothrips Bagnall and thrips

(Isothrips) provided the key to 12 species of Isothrips. Sakimura (1967c) also

provided the key to 7 species of Isochaetothrips.

Ananthakrishnan (1969) documented 154 genus group names in the sub-

family Idolothripinae including six new genera of which 75 names are placed in

synonyms. Ananthakrishnan and Jagdish (1970a, b) recognized 10 species of

Tubulifera from West Bengal. Pitkin (1972) described 14 new species in genus

Odonothripiella Bengal. Sub-family Urothripinae demoted to tribe rank (Mound,

1972). Three genera in the Merothripidae was recognized two namely Damerothrips

and Erotiodothrips with one species each and Merothrips with 13 species (Mound and

O’Neill, 1974). Sub-family Panchaetothripinae comprises 35 genera and 98 species

(Wilson, 1975). Dichromothrips indicus was described from Darjeeling West Begnal

(Mound, 1976a).

Muraleedharan (1982) has described 22 new species including 2 new genera

and 17 species of Tubulifera from North-Eastern India. Ananthakrishnan (1978)

described almost three hundred species of about 90 genera of Tubulifera inducing

galls. Majority of gall thrips belongs to Liothrips, Eothrips, Mesothrips,

Eugynothrips, Liophlaeothrips and Crotonothrips. Bhatti (1980) reported Thrips

flavus Schrank from Tangmarg and Thrips hawaiiensis Morgan from Jammu and

Kashmir. Furthermore Bhatti (1982) revised the Stenchaetothrips Bagnall fauna of

India covering taxonomic studies of 20 species with description and keys. Mound and


7

Palmer (1981) worked on identification, distribution and host plants of pest species of

genus Scirtothrips. Lone and Bhagat (1984) recognized 8 thrips species from Kashmir

valley. Lone and Bhagat (1986) also reported 6 Thrips species belonging to

Terebrantia from Kashmir. Bhatti (1998) has placed 3000 species in the family

Phlaeothripidae. Four families have wingless species.

Nakahara has provided the key to thrips species of Nearctic region. Nakahara

(1991) discussed the systematic of Thysanoptera and several species that are

economically important in United States and Canada and distinguished

morphologically six families of thrips in North America and 6 economic species viz.,

Taeniothrips inconsequens. Thrips calcartus, F. occidentalis, Frankliniella tritici,

Frankliniella fusca, T. tabaci. Nakahara (1994) reported 62 thrips species from new

world including 43 species endemic to Canada and USA. In sub-family

Dendrothripinae, about 95 leaf feeding species in 13 genera were reported that share

structural characters with some species in Panchaetothripinae (Mound, 1994). Mound

and Marullo (1996) described three lineage groups of Phlaeothripidae viz.,

Phlaeothrips lineage, Haplothrips lineage, Liothrips lineage. Lewis (1997) has

reported several thrips species as serious pest of many crops causing great economic

losses. A key was provided for 33 species of Scirtothrips from Mexico (Johansen and

Mojica-Guzman, 1999), 21 Scirtothrips species from Australia (Hoddle and Mound,

2003) including 11 newly described Scirtothrips species. Hoddle et al. (2004) also

reported 238 species under 87 genera and 8 families of Thysanoptera in California

USA. Masumoto and Okajima (2005) reported 31 species of genus Tricomothrips

worldwide. Masumoto and Okajima (2006) also provided the key to the genus

Mycterothrips which includes 27 species from tropical and temperate countries of the

world but none from Central or South America whereas 3 species reported from North

America.

Diffie et al. (2008) gave a list of 275 thrips species from Florida and 202 thrips

species from Georgia; the list was compiled from literature, reviews, museum

collections and new records. Eight species are listed in the genus Stomatothrips, two

of these are from North America (S. brunneus from Arkansas and S. crawfordi from

illinois), one is known from Texas, two from Brazil and one each from Argentina and


8

Trinidad (Bailey, 1952). Cott (1956) reported 9-species in the genus Bagnalliella

Karny of order Tubulefera from North America, New Guinea and Africa.

1.4 Importance of thrips

Thrips are polyphagous and highly mobile insects which have high population

densities because of the rapid reproductive rates. They can damage the plants directly

by feeding on plants and indirectly by transmitting the bacterial, fungal and viral

diseases to the plants (Mound, 1973) resulting in huge economic losses. They are

voracious pests of different ornamental, vegetable plants and fruit crops in open field

and greenhouses worldwide (Tommasini and Maini, 1995). They damage plants by

reducing its photosynthetic capacity with leaf surface disruption and thus removing

the mesophyll cell contents by feeding that leads to yield reduction in crop plants

(Alfredo et al., 2007). Direct feeding of thrips can induce a range of symptoms in

plants including silvering, scarring on fruits and corky tissue development as on

banana fruit (Trochoulias et al., 1984). Premature flower loss and ultimately reduction

of pollen below critical level is caused by large populations of thrips (Kirk, 1984).

Silvering is the typical of thrips damage. S. aurantii in Africa and S. citri in the USA

cause the corky scarring to the citrus fruits (Kamburov, 1991; EPPO/CABI, 1996).

The bean bacterioris (Pseudomonas medicaginis var. phaseolicola) has been shown to

be transmissible by Hercinothrips femoralis and the lesions are always associated

with the feeding damage by thrips (Lewis, 1973). Sakimora (1947) stated that the fig-

spoilage disease in California, USA was caused by a complex of bacteria, yeast, fungi

and thrips, particularly F. occidentalis, T. tabaci and F. tritici.

Thrips cause damage to crops by transmitting tospoviruses. The known vector

species belong to four genera, three of which are from family Thripidae. They are not

from closely related phylogenetic groups but they do share some common characters

i.e, extremely polyphagous and their ability to reproduce on a broad range of host

plants (Mound, 1996). The species of the genera Frankliniella and Thrips are major

pests of many important plant species (Lewis, 1973). For example, a single thrips

species (T. tabaci Lindeman), is a varocious pest of bean, garlic, leeks, onions, peas,

shallots, strawberry and white cabbage all over the world (Edelson et al., 1986;

Mustafa, 1986; MacIntyre Allen et al., 2005; Tunc, 1998).


9

Bacteria and fungi are mainly disseminated by air, and water, while virus

spread often relies on vectors. Several thrips species feed on fungal hyphae and spores

(Mound and Teulon, 1995) and can transfer pathogenic fungal spores and conidia to

healthy plants by carrying on their bodies (Farrar and Davis, 1991). Thrips have also

been associated with bacterial wilt of corn (Pantoea stewartii) (Elliot and Poos,

1940). Thrips also provide entry points for other disease organisms to plants by

causing injury (Lindorf, 1931; Smith, 1931; Hardy and Teakle, 1992).

Flower thrips are also considered as pollinator in many crops (Mackie and

Smith, 1935; Veer, 1978). Thrips are also predator of mites and lepidopterans on

different crops. But these benefits are overshadowed by the pest status of thrips. F.

occidentalis besides its pest and virus vector status also acts as a good predator of

mites on cotton plants (Gonzalez et al., 1982; Pickett et al., 1988). But it is often

considered as a poor biological control agent for mites because its population cannot

increase fast enough to keep up with the mite population (Bailey, 1939; Parrella and

Horsburgh, 1983). Scolothrips sexmaculatus can be the ideal biological control agent

of mites (Gilstrap, 1995). For the control of tetranychid mites in greenhouses and in

fields, potential use of Scolothrips longicornis has been much studied (Gerlach and

Sengonca, 1985, 1986; Sengonca and Gerlach, 1984; Selhorst et al., 1991), but it has

not been used commercially as a biological control agent in greenhouses.

1.5 Identification of thrips

Taxonomy and systematics of the order Thysanoptera is entirely based on

morphology. Until now, multiple classification systems for thrips have been proposed

(Bhatti, 1988, 1992, 2006; Zherikhin, 2002) but there is no harmony to intraordinal

relationships (Mound et al., 1980). Recently, molecular data based identification are

being used along with morphological identification of thrips which helps to overcome

the constrain of morphological identification by the minute size of insect, scarcity of

characters, adult and greater resemblance of nymphal stages of different thrips species

(Brunner et al., 2002), polymorphism (Murai and Toda, 2001) and lack of trained

manpower. Molecular diagnostic technologies supported the morphotaxonomic keys

in few most economically important and global pests e.g. fruit flies (Armstrong et al.,

1997), tussock moths (Armstrong et al., 2003), leaf roller moths (Dugdale et al., 2002)


10

and thrips (Toda and Komazaki, 2002). mtCOI partial sequences of T. palmi and T.

tabaci confirmed their morphological identification.

1.5.1 Morphological identification

Morphological identification based on the distinguishing characters found on

the main body of insects, e.g., head, thorax and abdomen region, and colour of the

body. Thrips species can be identified using conventional morphological characters

based methods. However, identification of thrips based on morphological

characteristics is difficult, although many available standardized morphological keys

for thrips identification have been published as follows: Hoddle et al. (2008) for

Thysanoptera of California, Moritz et al. (2000, 2001, 2004) for pest species of the

world, Mound and Kibby (1998) for major genera of the world, Mound and Marullo

(1996) for the Neotropical Thysanoptera, Zur Strassen (2003) for European

Terebrantia, Priesner (1964) for the Thysanoptera of Egypt, Wilson (1975) for the

world genera of Panchaetothripinae, Mound and Ng (2009) for the Thripinae genera

of Southeast Asia, and Masumoto (2010) for the genera of the subfamily Thripinae

associated with Japanese plant quarantine.

1.5.2 Molecular identification

Molecular methods of species identification have several advantages over

morphological identification. When there is a lack of taxonomic expertise, molecular

methods would be very useful to verify the identity of the species. Molecular

approaches for the species identification and phylogenetic relationships of insects are

increasingly becoming common. DNA polymorphisms in mitochondrial and nuclear

genes have been used for insect molecular systematic (Simon et al., 1994) and

diagnostics (Gariepy et al., 2007). Bertin et al. (2010) used ITS2 region to

discriminate between externally indistinguishable Hyalesthes luteipes and Hyalesthes

scotti and found this molecular tool fast and reliable for species identifications.

Buckman et al. (2013) used nuclear and mitochondrial genes to make the

phylogenetic analysis of thrips. Phylogeny of Acacia gall-forming thrips was

determined using two mitochondrial genes, adult morphology and behavior and gall

morphology (Crespi et al., 1997).


11

Molecular genetic analysis can also detect the morphologically cryptic species

as very limited morphological differences are found in some closely related species

(Knowlton, 1993; Jarman and Elliot, 2000; Witt and Hebert, 2000; Hebert et al., 2004;

Schiffer et al., 2004). Two molecular markers COI and 28S (mitochondrial and

nuclear) barcodes were used to identify two sympatric cryptic species within the

global pest F. occidentalis in its native California (Rugman-Jones et al., 2010).

Many molecular techniques are being used for the identification of insect

fauna. Based on the mitochondrial COI DNA, real time quantitative PCR has been

developed for the identification of thrips species (Kox et al., 2005). Brunner et al.

(2002) developed a method of DNA barcoding for the identification of economically

important thrips species based on COI sequences which were further confirmed (Frey

and Frey, 2004).

1.5.2.1 Use of COI and emergence of DNA Barcoding

Hebert et al. (2003a, b) purposed the use of partial sequence of 5’end of

mitochondrial cytochrome oxidase I (mtCOI) coding gene (barcode region) for the

species level identification of insects universally. COI gene was used to detect several

haplotypes from different thrips species and proved excellent genetic marker (Brunner

et al., 2002; Asokan et al., 2007; Zhang et al., 2011). According to Timm et al. (2008)

mtCOI sequence analysis was a rapid, and accurate, means of identifying thrips

species present in southern Africa. Glover et al. (2010) found varying degrees of

discrimination of thrips species while they compared five different loci, and among

them COI provided sufficient variation to be used for future DNA barcoding studies

of thrips. DNA barcoding has been effectively used for the species identification of

aphids from the Korean Peninsula (Lee et al., 2011). The DNA barcoding has been

used for pest monitoring and quarantine in several hexapod orders: Coleoptera (Lobl

and Leschen, 2005), Diptera (Scheffer et al., 2006), Ephemeroptera (Ball et al., 2005),

Hemiptera (Foottit et al., 2008), Hymenoptera (Smith et al., 2008) and Lepidoptera

(Hajibabaei et al., 2006; Ashfaq et al., 2013).

COI sequence data was used to resolve the cryptic species, Pseudophilothrips

gandolfoi, within Pseudophilothrips with morphometric studies (Mound et al., 2010).


12

Kadrival et al. (2013) used partial sequence of 3’COI gene for grouping of different

thrips species coexisting in a particular cropping system which successfully grouped

with reference sequences of morphologically identified species including F.

occidentalis, F. schultzei, S. dorsalis, T. palmi, T. tabaci and an unclassified group of

species. Phylogenetic analysis of Australian T. tabaci showed that T. tabaci clustered

corresponding to differences in vector competency of TSWV and the host from which

they were collected, instead of the geographical distances so as geographical distances

had no influence on genetic diversity of T. tabaci (Westmore et al., 2013).

1.6 Thrips and Tospovirus transmission

Among more than 6000 species of thrips (Mound, 2014) described worldwide

including 100 serious agricultural pest species which mostly belong to two genera,

Frankliniella and Thrips (Thripidae: Thysanoptera) 14 species have been documented

as vectors of plant pathogenic tospoviruses (Nagata et al., 2004; Ghotbi et al., 2005;

Lin et al., 2005; Premachandra et al., 2005; Ohnishi et al., 2006; Jones, 2005; Pappu

et al., 2009). Thrips have been recognized as exclusive vectors of the virus species

belonging to genus Tospovirus (Family Bunyaviridae) (Ullman et al., 1997; Whitfield

et al., 2005). Riley et al. (2011) provided a list of thrips vector species with their

common names, key diagnostic characters, distribution and important host crop plants

along with the disease symptoms on various crops.

Eight thrips species, five from the genus Frankliniella and three from the

genus thrips are the vectors of TSWV (Mound, 1996; Webb et al., 1998; Sakimura,

1961; Cho et al., 1987; Jenser et al., 2003), and Scirtothrips dorsalis and Thrips flavus

are suspected as TSWV vectors (Mound, 1996; Singh and Krishanareddy, 1996).

These vector species do not encompass a single evolutionary lineage (Mound, 2002),

so possibly other species of thrips have lost the ability to transmit viruses or

attainment of vector ability has occurred independently in several thrips species.

Vector competency to transmit TSWV was found in cryptic species of T. tabaci with

different modes of reproduction and host ranges (Jacobson et al., 2013). At any given

location, the vector competency of T. tabaci also depends on the thrips and virus

populations that are present at that location (Jacobson and Kennedy, 2013).


13

Only those adult thrips are capable of transmitting tospovirus which acquired

these viruses in their first or second larval instars. Tospoviruses then multiply inside

the mid-gut of these larvae, survive through later developmental stages and the

resulting adult thrips become viruliferous and can transmit virus throughout their life

(Ullman et al., 1997; Moritz et al., 2004; Whitfield et al., 2005). The virus enters

thrips midgut epithelial cells which is the first site of viral infection (Ullman et al.,

1993) and then circulates to other organs of thrips localized in the midgut epithelial

cells, muscle cells surrounding the alimentary canal and salivary glands (Ullman et

al., 1995a; Wijkamp et al., 1993). The virus has to cross at least four membrane

barriers in order to circulate to the salivary glands and subsequent egestion for

inoculation of other healthy plants. Virus multiplication and circulation to the salivary

glands occur during the virus acquisition to successful inoculation period, also known

as median latent period. The median latent period in F. occidentalis is temperature-

dependent (Wijkamp and Peters, 1993; Wijkamp et al., 1995). Virus can be acquired

but cannot be transmitted by adult thrips (Paliwal, 1974, 1976; Amin et al., 1981;

German et al., 1992; Ullman et al., 1992, 1995a).

1.7 Tospoviruses

The genus Tospovirus is the only genus of family Bunyaviridae that contains

plant-infecting viruses (Elliott, 1990, 1996; Goldbach and Peters, 1996) while all

other genera of this family include vertebrate or insect-infecting viruses. TSWV is the

type species of the genus after which its name derived as genus Tospovirus (Fauquet

and Mayo, 2001) and the most important and widely occurring tospovirus species

with host range more than 1100 plant species in 80 families (Goldbach and Peters,

1994) and causes significant damage to a wide range of crops in many parts of the

world (Gera et al., 2000; Anfoka et al., 2006; Pappu et al., 2009). In Iran this virus

also infects tomato, cucurbits and soybean (Golnaraghi et al., 2001; Massumi et al.,

2007, 2009). Genus Tospovirus includes more than 30 virus species that can cause

severe losses to a range of vegetable and crop plants (Hallwass, 2012, Pappu et al.,

2009). The greatest diversity of tospoviruses has been found in the Asian continent

where 14 tospovirus species have been identified infecting different crops (Mandal et

al., 2012).


14

1.7.1 Genome Organization

Tospoviruses have quasi-spherical, enveloped particles which has diameter of

80-100 nm and a tripartite single-stranded (ss) RNA genome, containing large (L),

medium (M) and small (S) RNAs (small). The L RNA is negative polarity and the M

and S RNA are ambisense in nature. These RNAs, together, code for at least four

structural proteins that include RNA-dependent RNA polymerase, Gn/Gc (membrane

glycoproteins) and N (nucleocapsid) proteins (Chu et al., 2001).


15

Whitfield et al., 2005

Figure 1.1: Schematic model of tospovirus transmission cycle

Whitefield et al., 2005

Figure 1.2: Schematic diagram of tospovirus genome


16

1.8 Importance of tospoviruses

Tospoviruses cause significant losses in quality and yield of many vegetable,

legume and ornamental crops throughout the world (Mumford et al., 1996; Pappu,

1997; Pearce, 2005; Persley et al., 2006; Pappu et al., 2009; Mandal et al., 2012).

Although the infection at early stages of plant growth causes substantial decrease in

plant stand leading to considerable yield losses, the infection at later stages of plant

growth is also responsible for significant yield and quality losses to the produce

(Culbreath et al., 2003). Serious losses in food and fibre production, as well as in

ornamental crops are caused by these viruses worldwide (Brittlebank, 1919;

Sakimura, 1963; Best, 1968; Francki and Hatta, 1981; Peters et al., 1991; Ullman,

1996). Groundnut bud necrosis virus (GBNV) is the most important tospovirus found

in the Indian subcontinent (Pappu et al., 2009) and can affect a wide range of crops

and substantial losses (Kunkalikar et al., 2011). Iris yellow spot virus (IYSV) is an

emerging tospovirus and its presence and distribution dramatically increased in the

whole world (Gent et al., 2006; Pappu et al., 2009; Mandal et al., 2012) and could

negatively impact Allium species, especially onion seed and bulb crops. Watermelon

bud necrosis virus (WBNV), is also another important tospovirus species from Asia

that caused up to 100% yield losses in various cucurbitaceous hosts in India (Pappu et

al., 2009).

Tospoviruses show a considerable degree of biological diversity as described

by the variation in symptoms, pathogenicity or virulence (Qiu et al., 1998; Mandal et

al., 2006), difference in thrips specificity and transmissibility (Ullman et al., 1997;

Whitfield et al., 2005), and ability to break host plant resistance (Roggero et al., 2002;

Margaria et al., 2004; Ciuffo et al., 2005; Persley et al., 2006). Under field and

protected cropping conditions, the continued occurrence of damaging virus epidemics

in diverse crop species is due to a number of factors. These factors include the

overlapping and wide host ranges of many tospoviruses and their thrips vectors and

lack of effective and economical thrips control options (Daughtrey et al., 1997; Gent

et al., 2006; Pappu et al., 2009). Bosco and Tavella (2010) worked on the integrated

management of vector and pest T. tabaci in Italy and showed that control of T. tabaci

based on the visual inspection of plants is effective. A risk index for TSWV was


17

developed for peanut in Georgia, USA which resulted in significant reduction in the

final disease incidence (Culbreath et al., 2003). Insecticide resistance monitoring

(IRM) should be a component of IPM programs to control thrips as a pest and vector

(Gao et al., 2012).

1.9 Rationale for this study

Most thrips species are invasive in nature and can easily spread due to an

increase in the world-wide trade activities. The identification of thrips species at

juvenile stages is very important to contain the spread of thrips. Due to the minute

size and less developed morphological identification keys thrips identification and

quarantine is challenging. For example, in case of EU quarantine species, T. palmi, is

an A1 quarantine pest for EPPO (OEPP/EPPO, 1989) and an A2 pest for CPPC.

Species identification of thrips has become more difficult because of high

intraspecific variations (Mound and Zur Strassen, 2001). A rapid and accurate

identification method is needed for the identification of quarantine pest species on the

agricultural product imports. It is also important to know the species diversity of a

region as it affects the international trade in case of quarantine pest species. For these

reasons, use of molecular data has been increasingly applied for the thrips

identification (Glover et al., 2010).

Tospoviruses are important worldwide because of international horticultural

trade which has resulted in increased movement of host plants for both the vector and

the viruses they transmit (Latham and Jones, 1997). Intensive investigations have

been done on the relationship of thrips and tospovirus transmission over the last two

decades. An increased understanding of the interrelationships between thrips and

virus determinants that modulate vector specificity has been facilitated by the

availability of number of different tools including serological, biochemical and

molecular tools that permit the sensitive detection (Bandla et al., 1998; Sin et al.,

2005; Whitfield et al., 2005, 2008). The aim of the present research was to determine

the diversity of thrips species in different regions of Pakistan using morphological and

molecular approaches and carry out surveys for selected tospoviruses and characterize

them at the molecular level.


18

1.10 Objectives

The overall goal of this study was to collect, identify, characterize, describe

and document the thrips fauna of Pakistan. To accomplish this, morphological and

molecular markers were utilized. Additionally, surveys of various vegetable crops

were carried out to ascertain the incidence of selected tospoviruses in Pakistan.

Specific objectives were:

1) Document and describe the thrips diversity based on morphological characters.

2) Summarize the molecular taxonomy of morphologically identified thrips species

from current surveys using COI-5’ sequences (DNA barcoding).

3) Identification and molecular characterization of Iris yellow spot virus (IYSV),

analyzing its occurrence in Pakistan and a global analysis of all known IYSV N gene

sequences with reference to the IYSV isolates from Pakistan.

Chapter 2 Materials and Methods

19

Chapter 2

Materials and Methods

2.1 Thrips collection

2.1.1 Locations surveyed

Thrips specimens were collected from 158 localities across the country during

2009-2012. Collection locations were selected based on accessibility, vegetation type,

and habitat type. GPS coordinates were recorded and locations were mapped. The

collection sites spread over an altitude range of 127-2660 m in three climatic regions

of the country in 37 administrative districts that included Abbas Pur, Bahawalpur,

Bagh, Chakwal, Dera Ghazi Khan, Forward Kahuta, Faisalabad, Gujranwala, HariPur

Hazara, Haveli, Hyderabad, Islamabad, Jaranwala, Kaghan, Mirpur Khas,

Muzaffarabad, Multan, Murree, Nagar Parker, Neelum, Naran, Narowal, Nankana,

Pallandri, Paye, Rawalpindi, Rawala Kot, Sheikhupura, Sahiwal, Sargodha, Sialkot,

Shakar Ghar, Seri, Shogran, Sanghar, Tando Allahyar, Taxila and Umer Kot (Fig.

2.1).

2.1.2 Habitats surveyed

Habitats surveyed included agricultural fields (Agricultural research stations,

farmer fields and crop nurseries Azad Jammu and Kashmir, Chakwal, Faisalabad,

Islamabad, Nankana), floricultural fields (Botanical Garden, University of

Agriculture, Faisalabad, Botanical Garden, National Agricultural Research Centre

(NARC), Islamabad, and several other flower farms in Azad Jammu and Kashmir,

Faisalabad, Lahore, Sahiwal), natural forests (Changa-manga Forest, Chinji National

Park, Tobatak Singh Forestation, Harrappa vegetation areas), and disturbed habitats

(home gardens, fallow rice fields, weedy patches and grasslands).


20

2.1.3 Collection of specimens

Thrips were collected by beat method (Bradley and Mayer, 1994). Foliage or

inflorescence of plants and shrubs was beaten on a white blank paper and thrips were

collected with a fine camel hair brush. Specimens were transferred to 1.5 ml

Eppendorf tubes containing 85% ethanol and stored in a freezer until further analysis.

Name of collector, date of collection, location, GPS coordinates, and host plants were

recorded

2.2 Tospovirus survey, sample collection (plants and thrips), preservation and

identification

Onion plants found with characteristic symptoms associated with IYSV

infection such as spindle-shaped straw- colored irregular chlorotic lesions, necrotic to

hay-colored spots were collected from thirteen districts of southern and northern

Punjab in Pakistan (Chiniot, Faisalabad, Gujranwala, Hafizabad, Jaranwala, Jhang,

Jhelum, Layyah, MandiBahauddin, Muzafargarh, Nankana sahib, Sargodha,

Sheikhupura) during February 2012 to March 2013. The GPS co-ordinates of the

collection locations fall between latitude 30.28 -31 degree to 71-73 degree longitude

(Table 2.1). Thrips were also collected from the same fields and preserved in 85%

ethanol. Later, T. tabaci were identified by running the keys based on morphological

characters and were preserved in -20oC until further analysis.

During summer 2011, onion seed and bulb crops showing characteristic

symptoms including chlorotic lesions, spindle and long yellow stripes caused by

IYSV were collected from the commercial fields in the states of Colorado, Idaho,

New Mexico, New York and Washington, USA. The leaf samples were preserved in

-80oC until further analysis.


21

Figure 2.1: Physical map of Pakistan with locations of thrips collections

indicated by black triangles.


22

Table 2.1: Collection date of samples (onion plants and thrips) location and GPS

coordinates in Pakistan.

S No. Date of Collection Location Latitude (°) Longitude (°)

1 5-5-2012 AliPur Saidaan 31.28114 72.37553

2 5-5-2012 Ali abad 31.24719 72.29815

3 5-5-2012 Hasubulail 31.03636 71.099335

4 5-5-2012 Rafiqabad 30.94107 71.31338

5 5-5-2012 Rahmatabad 30.77851 71.22623

6 5-5-2012 Muhammad wala 30.67667 71.23772

7 5-5-2012 Abassi chok 30.4000 71.23967

8 24-5-2012 Paroti 31.64537 73.23488

9 24-5-2012 Hafizabad 32.08767 73.08564

10 24-5-2012 GoharPur Sani 31.52592 74.14623

11 21-3-2012 Maliwala 31.1441 73.5102

12 21-3-2012 Kirchpur 31.2307 73.4649

13 21-3-2012 Mangtawala 31.2102 73.5002

14 21-3-2012 Youngsanabad 31.2844 73.3704

15 21-3-2012 5 chak 31.2941 73.3521

16 27-2-2012 Parray wali 31.2353 73.4626

17 27-2-2012 Dhorkot 31.2728 73.4132

18 27-2-2012 10 chak 31.2845 73.3310

19 27-2-2012 Dalachanda Singh 31.3458 73.3148

20 27-2-2012 Panwan 31.3510 73.3525

21 27-2-2012 Raesainwala 31.2846 73.3551

22 21-3-2012 Chandar Kot 31.3217 73.4106

23 21-3-2012 Manawala 31.3459 73.4135

24 13-4-2012 Said Pur 32.66464 73.33781

25 13-4-2012 Illyas Pur 32.10118 74.16538

26 13-4-2012 Wazirabad 32.47992 74.08982

27 13-4-2012 Tatly wali 31.98014 74.12818

28 13-4-2012 Tulianwala 31.94399 74.10758


23

29 13-4-2012 Sheikhupura 31.58249 73.74887

30 13-4-2012 Malot 32.91570 73.61472

31 13-4-2012 Daira Jumma Khan 32.65755 73.42243

32 13-4-2012 Naiabadi 32.78509 73.56263

33 13-4-2012 Pir Chak 32.66483 73.35577

34 17-4-2012 Painsra 31.2036 72.4947

35 30-4-2012 Jamsher 31.2814 73.2751

36 30-4-2012 Piplanwala 31.2031 73.4545

37 30-4-2012 Khudanwali 31.2203 73.3403

38 30-4-2012 Morkhunda 31.1944 73.4818

39 15-9-2012 Shahkot 31.3453 73.2957

40 15-9-2012 Lundiawala 31.1822 73.3409

41 15-9-2012 Chak 65 31.2303 73.1749

42 15-9-2012 Naaiwala 31.1919 73.4522

43 30-4-2012 Nankana 31.2654 73.4123

44 15-9-2012 Motiwala 31.2156 73.2053

45 15-9-2012 Khurianwala 31.3039 73.1659

46 15-9-2012 Mirpur 31.3246 73.2934

47 30-4-2012 Ghandraan 31.3421 73.3058

48 30-4-2012 Barnala 31.2253 73.1351

49 30-4-2012 Kot Namdar 31.1956 73.4339

50 16-10-2012 Chiniot 31.4240 73.0034

51 16-10-2012 Lalian 31.5006 72.4717

52 16-10-2012 Chak no 38SB 31.5446 72.5334


24

2.3 Enzyme-linked immune-sorbent assay (ELISA) for thrips and plant samples

2.3.1 Direct Antigen-Coated (DAC) ELISA for testing thrips for IYSV

Individual thrips were ground in single 200 µL PCR tubes using micropestles

with 50 ul of ELISA extraction buffer {0.01 M Sodium-Potassium phosphate buffer

pH 7.4, containing 0.02% sodium azide (w/v), 0.8% sodium chloride (w/v), 0.05%

Tween 20 (v/v) and 2% PVP mol.wt. 40,000 (w/v)}to each tube. The samples (in a

total volume of 50 µL) were transferred to a microtiter plate and incubated for 37°C

for 2 hours. The plate was washed for three times with 1X PBST with 3-minute

incubation at room temperature after each wash. Afer the last wash, blocking agent

(1% BSA in 1X PBS) was added to the sample wells (100 ul per well) and incubated

for 2 hours at 37°C or 4°C overnight. The plate was washed for three times with 1X

PBST as before. Polyclonal antiserum prepared against IYSV-coded NSs protein(Bag

et al., 2014) was diluted 1:4000 in antibody dilution buffer, {1X PBST with 0.2%

BSA (w/v), 2% PVP mol.wt. 40,000 (w/v) and 0.02% sodium azide (w/v), pH 7.4 and

stored at 4°C} and 75 µL of the diluted antiserum was added to each well and the

ELISA plate was incubated at 37°C for 2 hours or 4°C overnight. After washing the

ELISA plate for three times with 1X PBST as before, secondary antibody (goat-anti

rabbit IgG conjugated with alkaline phosphatase; Sigma A7539) (dilution used was

1:5000) was added to each well and the plate was incubated at 37°C for 2 hours.

ELISA plate was washed for three times with 1X PBST as before. After the last wash,

substrate solution {1mg/ml pNPP in 1 M diethanolamine buffer containing 0.5 mM

MgCl2 and 0.02% sodium azide} was added to each well of the ELISA plate and

incubated at 37°C for one hour (Appendix 1). Absorbance was taken at 405 nm at 30

min, 1 hour and 2 hours.

2.3.2 Double Antibody Sandwich (DAS) ELISA testing of plants for IYSV

The capture (=coating) antibody was made by diluting the antibody in 1X

coating buffer to a final dilution of 1:200 (Appendix 1). ELISA plate was coated with

capture antibody (100 µL /well) and incubated at 4°C overnight. ELISA plate was

washed for three times with 1X PBST giving 3-minute incubation at room

temperature for each wash. Plant samples were prepared by grinding in liquid


25

Nitrogen and extraction buffer was added (1:10 w/v) that was provided with the kit.

The contens were centrifuged for 2 minutes at 8000 rpm. 100 µl of of the supertanant

of each sample was then transferred to each well of ELISA plate and incubated at 4°C

for overnight. Plate was washed for three times with 1X PBST as previously

described. Secondary antibody (conjugated with -alkaline phosphatase) was diluted in

1X conjugate buffer (1:200) according to the supplier’s directions and 100 µL of the

diluated antibody were added to each well of ELISA plate and the plate was covered

tightly with parafilm and incubated at 37°C for 4 hours. The plate was washed for

three times with 1X PBST as before. Substate was prepared by dissolving pNPP

(para-nitrophenyl-phosphate) in substrate buffer (1 mg/ml) and 200 µL of substrate

solution was added to each test well and was incubated at 37°C. Absorbance values

were taken at 405 nm at 30 min, 1 hour and 2 hours using an ELISA plate reader.

2.4 IYSV nucleocapsid (N) gene fragment isolation and cloning of PCR products

2.4.1 RNA extraction

Following the standard laboratory protocols, all the glassware and all other

equipment were cleaned. For RNA work, all glassware was additionally

washed/cleaned with 0.1% [v/v] diethylpyrocarbonate (DEPC) treated water. Using

the RNeasy Plant Mini kit (Qiagen, Maryland, USA), RNA extraction from sample

plant leaves was done following the manufacturer’s instructions (Appendix 2). RNA

precipitation was done with double the volume of 95% ethanol and 1/10 volume of

3M sodium acetate. Then washing of RNA pellet was done with 75% ethanol and

pellet was re-suspended in DEPC-treated sterile distilled water. Extracted RNA was

stored at −80°C.

2.4.2 RNA quantification

Total RNA was first verified by 1% (w/v) agarose gel electrophoresis,

followed by staining the gel with ethidium bromide. RNA was quantified by using a

NanoDrop® Spectrophotometer ND-1000 (NanoDrop, USA).


26

2.4.3 cDNA synthesis

Superscript cDNA synthesis kit with an oligo (dT)-primer (Invitrogen, Cat.

No.11904-018) was used for the synthesis of first strand cDNA using 500 ng RNA as

suggested by the manufacturer (Appendix 3). RNA and oligo (dT) primers were

mixed and briefly incubated at 65ºC for 5 min. 10 µL reaction mixture including 10X

RT buffer 2 µL, 25mM MgCl2 4 µL, 0.1M DTT 2 µL, RNase out (40U/µL) 1 µL was

added into it, mixed gently and then SuperScript II 1 µL was added into this mixture.

These samples were then incubated at 42ºC for 50 min and final incubation was given

at 70ºC for 10 min.

2.4.4 DNA polymerase chain reaction (PCR)

The optimum reagents and PCR profiles used for the amplification of different

gene fragments from thrips and plant samples were described later in this section.

PCR reaction of 50 µL was made by adding 1X PCR buffer (750 mM Tris-HCl [pH

8.8], 200 mM (NH4)2SO4, 0.1% (v/v) Tween20), 1.5-2 mM MgCl2, 0.2 mM dNTPs

(dGTP, dCTP, dATP and dTTP), both primers (Forward and Reverse) 5pM each, 50-

100 ng of template cDNA and 2.5 U of Taq DNA Polymerase (5 U/µL) and then

volume was made up to 50 µL with SDW.

2.4.5 Agarose gel electrophoresis of PCR products

The amplicons were analyzed by electrophoresis using 1.0% (w/v) agarose gel

and 0.5X TAE buffer (20 mM Tris [pH 8.0] 10 mM Acetic acid and 0.5 mM EDTA)

followed by staining with ethidium bromide (0.5 μg / ml) (Appendix 4). To perform

the electrophoresis, minigel (12 x 9 cm) or midigel apparatus (18 x 15 cm) was used.

The PCR product (5 µL) was mixed with 6X loading dye (Appendix 4) (bromophenol

blue) (2 µL) before loading onto the gel. To determine the fragment size of PCR

product 1kb DNA ladder was used (Fermentas, USA) (Appendix 4). The

electrophoresis was performed in 0.5X TAE buffer for 1h at 80 volts and the gel was

illuminated under ultraviolet (UV) light and photographed using Eagle Eye still video

system (Stratagene, La Jolla, CA, USA).


27

2.4.6 Ligation

Ligation of PCR amplicons into T/A cloning vector (pGEM®-T Easy) was

done using T4 DNA Ligase kit (Fermentas) (Appendix 5). Ligation reactions were

done following the supplier’s instuctions. Reaction mixture, in a 20 µL total vlume,

was made by adding 2 µL of 10X ligation buffer for T4 DNA Ligase, 10 µL PCR

product, 1 µL of T4 DNA ligase, 1 µL of TA cloning vector (pGEM®

-Teasy) and

nuclease-free water. Ligation was carried out at 4°C overnight.

2.4.7 Transformation

Transformation of competent cells was carried out using methods described by

Sambrook (1989). The ligated material was transformed into heat shock competent E.

coli cells. Heat shock competent E. coli cells were prepared following the protocol

described in Appendix 9.

Approximately 10 μL of ligation mixture was added into 200 μL of competent

cells and placed on ice for 30 min. Transformation was carried out by incubating the

mixture at 42°C for 2 min in a dry bath. Reaction was placed on ice then for 2 min.

and then one ml of LB medium was added into it, mixed well and this reaction

mixture was incubated at 37°C for 1 h. Centrifugation was done at 3,000 rpm for 2

min and pelletted cells were recovered by removing the supernatant. Re-suspension

of pellet was done in 100 μL of fresh LB medium (Appendix 6) and ~50 µL of this

liquid culture was evenly spread with the help of a sterile glass rod on LB agar plates

(Appendix 7) supplemented with appropriate antibiotic in the presence of IPTG/X-gal

(Appendix 8). The plates were incubated at 37°C overnight. Blue/white colonies in

the TA cloning was confirmed the transformation.

2.4.8 Colony PCR

A grid was made on a master plate in preparation for transfer of bacterial

clonoies after picking white colonies from transformation plate for toothpick or

colony PCR. 50 ul of sterile ddH2O was pipetted into PCR tubes and individual white

colonies were picked using a toothpick and placed in PCR tube and also dotted the

toothpick on the grid plate to verify the positive colonies for the PCR fragment of


28

interest. PCR tubes with water/colony mix were heated at 94°C for 3-4 minutes in the

PCR machine to burst the cells open. A master mix was prepared with the reagent

ratio of 1.5 mM MgCl2, 0.2 mM dNTPs (dATP, dCTP, dGTP and dTTP), 1X PCR

buffer (750 mM Tris-HCl [pH 8.8], 200 mM (NH4)2SO4, 0.1% (v/v) Tween20),

Forward and Reverse primers 2 pM each and 2 U of Taq DNA Polymerase (5 U/µL)

and then sterile ddH2O for volume of 20 µL per reaction. 15 μl of this mix was

dispensed into each PCR tube and 5 μl colony/water template was added. The

following PCR profile was used to amplify the N-gene of Iris yellow spot virus.

PCR profile:

Temperature Time

Denaturation temperature 94°C 3 min

Denaturation temperature 94°C 30 Sec

Annealing temperature 55°C 45 Sec 35 Cycles

Extension temperature 72°C 1 min

Final extension temperature 72°C 10 min

Hold 15°C ∞

White colonies that gave the PCR amplification of an expected amplicon were

picked from the master plate and individually cultured in 3 ml of LB liquid

supplemented with ampicillin (100 µg/ml) with vigorous shaking at 37°C. Using

GeneJETTm

Plasmid Miniprep Kit, (Fermentas Cat. No. K0503), plasmid DNA was

extracted from bacterial cultures following the provided protocol (Appendices 10, 11).

2.4.9 Screening of clones through restriction analysis

Digestion of plasmid vector DNA was done with specific restriction

endonucleases (New England Biolabs). Two µL of 10X recommended buffer for a

given restriction enzyme, 5-10 U (0.5-1 µL) of restriction enzyme, ~1 µg/2 µL of

substrate DNA, and 15 µL of SDW were used to make 20 µL reaction. Reaction

mixtures were incubated for 3-4 hours at temperature that is optimum for the given

enzyme.


29

2.4.10 Glycerol stocks of the confirmed clones

To preserve the cultures of confirmed clones, glycerol stocks were made.

Glycerol stocks of the confirmed clones were prepared by adding 300 µL of glycerol

into 700 µL fresh overnight cultures of confirmed clones and stored at −80°C.

2.4.11 Sequencing

Cloned genes and PCR products were sequenced bidirectionally using the

dideoxynucleotide chain termination method (Sanger et al., 1977). For sequencing

reactions, PCR-based BIG DYE kit (Perkin-Elmer, Massachusetts, USA) was used

with M 13 forward or reverse primers or gene-specific primers. Contigs were

assembled and edited using EditSeq (DNAStar, Madison, WI).

2.4.12 Nucleotide sequence alignments and Phylogenetic analysis

To determine the evolutionary relationships of IYSV, nucleotide sequences of

N-gene of IYSV from our study and those obtained from GenBank (NCBI) were

aligned. Using Clustal W with default parameters, multiple alignments were carried

out. MEGA version 5 was used to conduct the phylogenetic and molecular

evolutionary analyses and dendrograms developed (Tamura et al., 2013) for thrips and

tospovirus. Neighbor-joining method was used to visualize the patterns of sequence

divergence among taxa. Thrips species identities and sequence comparisons were

performed using BOLD and NCBI.

Chapter 3 Thysanoptera Diversity

30

Chapter 3

THYSANOPTERA DIVERSITY: SURVEY IN PAKISTAN

3.1 INTRODUCTION

3.1.1 Thrips taxonomy

According to the traditional and widely accepted classification of the order

Thysanoptera (Priesner, 1961), the order has been divided into two suborders:

Terebrantia and Tubulifera. The suborder Terebrantia includes eight families, and the

suborder Tubulifera is represented by a single worldwide family (Mound et al., 1980;

Mound and Morris, 2007; Buckman et al., 2013). Phlaeothripidae is the largest family

of Thysanoptera. This family includes 3,500 described species in 455 genera from two

subfamilies, Phlaeothripinae with 160 genera and Idolothripinae comprising about

700 species (Mound and Palmer, 1983; Mound and Marullo, 1996). Whereas families;

Uzelothripidae, Merothripidae, Melanthripidae, Aeolothripidae, Adiheterothripidae,

Fauriellidae, Heterothripidae and Thripidae were placed in the sub-order Terebrantia

(Mound and Morris, 2007). The second largest family of the order Thysanoptera is

Thripidae. It has 2,121 species in 306 genera. Family Thripidae is divided into 4

subfamilies, Thripinae, Dendrothripinae, Sericothripinae, and Panchaetothripinae

(Bhatti, 1989). The largest subfamily Thripinae includes 1,730 species in 248 genera

of which 64 species and 13 genera are fossil records (ThripsWiki, 2014). Family

Aeolothripidae includes 200 species. In 29 genera of Aeolothripidae, 6 genera and 11

species were found in fossil form (ThripsWiki, 2014).

3.1.2 Thrips diversity in South-East Asia

Thrips are distributed worldwide in tropical and temperate zones inhabiting

forests, grasslands, bushes, leaves and flowers (Lewis, 1973), litter and galls (Mound,

1972). Thrips diversity is higher in the warm tropical parts than in the colder regions

of the world. In the Indian subcontinent, several studies documented the thrips

diversity from India. Ananthakrishnan and Sen (1980) provided a critical assessment


31

of the taxonomic criteria, classification, and keys for the identification of 650 species

from India. Nearly 100 species of the genus Thrips Linnaeus were reported in the area

between the Indian peninsula, Australia, and the Pacific islands (Palmer, 1992). Bhatti

(1980) recorded and generated keys to 33 thrips species from India. Palmer and

Mound (1978) reported nine genera of fungus-feeding Thysanoptera from the oriental

region. Ananthakrishnan (1973) published mycophagous Thysanoptera of India. Sen

et al. (1988) gave the keys and description of Thysanoptera of north-eastern India.

Merothrips indicus was described from Tamil Nadu and Kerala in India and

Merothrips morgani Hood was redescribcd from Indian specimens (Bhatti and

Ananthakrishnan, 1975). Twenty six species of the family Phlaeothripidae were

reported from Pakistan by different authors (Akram 2000; Akram et al., 2003b; Ali,

1976; Saeed and Yousuf, 1994; Umar, 2004; Present study).

An illustrated key of 65 genera of Thripinae from South-East Asia was

provided by Mound and Ng (2009). Tillekaratne et al. (2007) described thrips species

from Sri Lanka under three families (Aeolothripidae, Thripidae, and Phlaeothripidae),

46 genera and 78 species. Later, Tillekaratne et al. (2011) provided the list of 72

thrips species in 45 genera from Sri Lanka. Of the nine families of order Thysanoptera

(Mound and Minaei, 2007), Aeolothripidae, Thripidae and Phlaeothripidae are the

more prevalent thrips families of the subcontinent for example, Haplothrips spp.,

Megalurothrips spp., Microcephalothrips abdominalis are widely distributed thrips

species in the subcontinent (Tillekaratne et al., 2011).

3.1.3 Thrips diversity in Pakistan

Pakistan geographically includes the Himalayan and Karakorum highlands of

northern areas of Pakistan to plains of Punjab and deserts of Sindh, and due to this

geography, Pakistan is rich in biodiversity. A large amount and variety of flora and

fauna is found in the area which needs to be identified. Agricultural production in this

area is affected by a wide diversity of insect pests. Being an agricultural country and

with the fertile lands Pakistan needs to be investigated about the insect pest and virus

vectors as well as beneficial insects for IPM (insect pest management) strategies to

increase the crop yield and quality, and for conservation of biodiversity for

ecosystem. As compared to other insect groups, thrips from Pakistan are understudied.


32

Studies conducted so far on the incidence and descriptions of thrips in Pakistan have

provided some information about this important pest (Akram, 2002; Akram et al.,

2003a, b; Palmer, 1992; Saeed and Yousuf, 1994; Umar, 2004) but lack

corresponding molecular data.

3.1.4 Objectives of the study

The objective of this study was to survey, identify and compile a comprehensive list

of thrips species in Pakistan and to generate baseline knowledge on thrips diversity

which could be useful in improved understanding of their distribution.

3.2 MATERIALS AND METHODS

3.2.1 Locations and habitats surveyed and collection of specimens

This part was done as described in section 2.1.

3.2.2 Slide preparation

Slides for specimen identification were prepared using Hoyer’s Medium and a

water-soluble mountant. Individual thrips were removed from the collection fluid into

clean 70% alcohol. Before fixing the specimens on mountant, their wings were

opened and antennae straightened with the help of micro-pins. A drop of Hoyer’s

Mountant was dispensed onto a cover slip (13mm circle, No. 0 or 1) and the specimen

was placed on the drop by ventral side up and a glass slide was gently lowered onto

the drop to fix the specimen. Slide was inverted as soon as the mountant had spread

sufficiently. The slide was placed immediately into an oven, or onto a hot-plate, at

about 50°C and left for 24 hours and then examined under a microscope. The slide

was incubated in the oven for about 3 weeks to let the mountant dry, and then ringed

with nail varnish.

3.2.3 Labeling

Insect specimens were labeled appropriately with the original data, including

the name of collector, collection site, and date of collection. The standard methods

were used for labeling.


33

3.2.4 Morphological characters

Insect morphology was discriminated on the basis of differences found in

colour of body and three main body parts, head, thorax and abdomen. The important

characters studied in head morphology were: shape of head, eye size, color and shape

of ocelli, position of ocellar setae. The distinguishing characters were also studied in

thorax and abdomen region. Body coloration and ocelli, size and number of antennal

segments, sense cone on antennae, size, no and location of major setae on the head,

pronotum, forewing, abdominal tergite, posteromarginal comb on tergite VIII, shape

of tergite X and ovipositor (Fig. 3.1).

3.2.5 Identification

Thrips were identified using the published description

(http://www.ozthrips.org, http://keys.lucidcentral.org/keys/v3/thrips_of_california). In

addition, standardized morphological keys for thrips were used to identify the species.

Morphological characters were studied using a compound microscope (Olympus BX

41) under magnifications, 40X, 100X and 400X. Voucher specimens were verified by

Mr. Stan Diffie, University of Georgia, Tifton campus, USA and Sueo Nakahara,

USDA ARS, Beltsville, MD., USA. ThripsWiki (2014) was accessed on 26 Apr 2014

for the valid species names of thrips reported in Pakistan since 1947 including thrips

from the current survey.

http://www.ozthrips.org/

http://keys.lucidcentral.org/keys/v3/thrips_of_california


34

Figure 3.1: Diagram of Frankliniella tritici (Fitch) representing the standard

morphological characters used in morphological identifications


35

3.3 RESULTS

3.3.1 Thrips diversity

Thrips species from Pakistan documented in prior reports and from this survey

are presented in table 3.1. A total of 85 species in 40 genera have been recorded from

three families (Aeolothripidae, Thripidae and Phlaeothripidae) and two suborders

(Terebrantia and Tubulifera) (Table 3.1). Each family listed by the currently valid

genera and species name, and each species name is referenced to its record from

Pakistan. Source plants and collection localities of thrips species are provided for the

new records in current survey (Table 3.2).

3.3.2 Thrips species recorded during the survey

A total of 41 species of thrips in 21 genera from 3 families were

morphologically identified during the current survey. Family Thripidae included the

most number of species 28 in 16 genera. Family Phlaeothripidae was represented by

12 species in 3 genera making it the second largest family of thrips collected,

followed by family Aeolothripidae with only one species and one genus identified

morphologically in the current survey. Four genera and 8 thrips species are the first

records from Pakistan.

The four newly recorded genera Apterygothrips, Chaetanaphothrips,

Neohydatothrips, and Taeniothrips were each represented by a single newly recorded

species: Apterygothrips pellucidus, Chaetanaphothrips orchidii, Neohydatothrips

samayunkur and Taeniothrips major. One species (Chirothrips meridionalis) from the

genus Chirothrips, two species (Megalurothrips usitatus and M. distalis) from the

genus Megalurothrips, and one species T. trehernei were identified in the genus

Thrips. Twenty six of the species in our survey have been reported as cosmopolitan

pests and five as potential viral vectors (Moritz et al., 2001).


36

Table 3.1: A check list of thrips species recorded from Pakistan (1947- to date)

S.No. Genus Species Reference

A) Family Phlaeothripidae

1 Bamboosiella

Ananthakrishnan

Bamboosiella murreensis Φ Saeed and Yousuf,

1994

2 Bamboosiella varia

Ananthakrishnan and

Jagadish

Akram, 2000

3 Allothrips Hood Allothrips pillichellus

Priesner

Akram et al.,

2003b

4 Apterygothrips Priesner Apterygothrips pellucidus

(Ananthakrishnan) ϯ

Present study

5 Ecacanthothrips Bagnall Ecacanthothrips tibialis

(Ashmead)

Akram, 2000

6 Ethirothrips Karny Ethirothrips longisetis

(Ananthakrishnan and

Jagadish)

Akram et al.,

2003b

7 Gynaikothrips

Zimmermann

Gynaikothrips khushabensis

Φ

Saeed and Yousuf,

1994

8 Gynaikothrips robustus Φ Saeed and Yousuf,

1994

9 Haplothrips Amyot and

Serville

subgenus Haplothrips

Haplothirps (H.) bagrolis

Bhatti *

Ali, 1976

10 Haplothirps (H.) ciliatus *

Φ

Saeed and Yousuf,

1994

11 Haplothirps (H.)

ganglbaueri Schmutz *

Ali, 1976

12 Haplothirps (H.) gowdeyi

(Franklin) *

Saeed and Yousuf,

1994

13 Haplothirps (H.)

longisetosus

Ananthakrishnan

Saeed and Yousuf,

1994

14 Haplothirps (H.) stylatus *

Φ

Saeed and Yousuf,

1994

15 Haplothirps (H.)

tenuipennis Bagnall *

Saeed and Yousuf,

1994

16 Haplothrips (H.) andresi

Priesner *

Akram, 2000

17 Haplothrips (H.) bicolour

(Ananthakrishnan)

Akram, 2000

18 Haplothrips (H.) ceylonicus

Schmutz

Akram, 2000

19 Haplothrips (H.) reuteri *

Karny

Akram, 2000


37

20 Haplothrips (H.) howei

(Mound & Minaei, 2007)

Akram, 2000

21 Trybomiella Bagnall

(subgenus)

Haplothrips (T.) clarisetis

Priesner

Saeed and Yousuf,

1994

22 Plicothrips Bhatti Plicothrips apicalis Bagnall

*

Ali, 1976

23 Ananthakrishnana

Bhatti

Ananthakrishnana

euphorbiae Priesner *

Saeed and Yousuf,

1994

24 Liothrips Uzel Liothrips aberrans

Muraleedharan and Sen

Akram, 2000

25 Liothrips bournieri Sen Akram, 2000

26 Liothrips infrequens

Muraleedharan and Sen *

Akram, 2000

B) Family Aeolothripidae

1 Aeolothrips Haliday Aeolothrips distinctus

Bhatti

Saeed and Yousuf,

1994

2 Aeolothrips intermedius

Bagnall *

Saeed and Yousuf,

1994

3 Aeolothrips collaris

Priesner

Akram, 2000

C) Family Thripidae

1 Anaphothrips Uzel Anaphothrips sudanensis

Trybom *

Akram, 2000

2 Anascirtothrips Bhatti Anascirtothrips arorai

Bhatti

Saeed and Yousuf,

1994

3 Aptinothrips Haliday Aptinothrips rufus Haliday Akram, 2000

4 Arorathrips Bhatti Arorathrips mexicanus

Crawford *

Akram, 2000

5 Astrothrips Karny Astrothrips stannardi Bhatti Saeed and Yousuf,

1994

6 Astrothrips tumiceps Karny Akram, 2000

7 Caliothrips Daniel Caliothrips indicus Bagnall Akram, 2000

8 Chaetanaphothrips

Priesner

Chaetanaphothrips orchidii

Moulton ϯ

Present study

9 Chirothrips Haliday Chirothrips africanus

Priesner

Saeed and Yousuf,

1994

10 Chirothrips meridionalis

Bagnall ϯ

Present study

11 Dendrothripoides

Bagnall

Dendrothripoides ipomoeae

Bagnall

Akram, 2000

12 Dendrothripoides innoxius ϯ Present study

13 Elbuthrips Bhatti Elbuthrips latis Bhatti

(1973)

Saeed and Yousuf,

1994

14 Fulmekiola Karny Fulmekiola serrata Kobus Akram, 2000

15 Frankliniella Karny Frankliniella insularis

Franklin

Saeed and Yousuf,

1994


38

16 Frankliniella schultzei

Trybom *

Ali, 1976

17 Helionothrips Bagnall Helionothrips mube Kudo Akram, 2000

18 Hydatothrips Karny Hydatothrips atactus Bhatti

*

Akram, 2000

19 Hydatothrips ekasi Kudo Akram, 2000

20 Indothrips Bhatti Indothrips religiosus Φ Saeed and Yousuf,

1994

21 Megalurothrips Bagnall Megalurothrips peculiaris

Bagnall *

Akram, 2000

22

Megalurothrips usitatus

Bagnall ϯ

Present study

23

Megalurothrips distalis

Karny ϯ

Present study

24 Microcephalothrips

Bagnall

Microcephalothrips

abdominalis Crawford *

Ali, 1976

25 Mycterothrips Trybom Mycterothrips nilgiriensis

Ananthakrishnan *

Akram et al., 2002

26 Bregmatothrips Hood Bregmatothrips binervis

Kobus

Akram, 2000

27 Neohydatothrips John

Neohydatothrips

samayunkur Kudo ϯ

Present study

28 Pseudodendrothrips

Schmutz

Pseudodendrothrips bhatti

Kudo *

Akram, 2000

29 Rhipiphorothrips

Morgan

Rhipiphorothrips cruentatus

Hood

Saeed and Yousuf,

1994

30 Scirtothrips Shull Scirtothrips bispinosus

Bagnall

Saeed et al., 1994

31 Scirtothrips dorsalis Hood

*

Ali, 1976

32 Scirtothrips mangiferus Φ Saeed et al., 1994

33 Scirtothrips oligochaetus

Karny*

Saeed et al., 1994

34 Scolothrips Hinds Scolothrips rhagebianus

Priesner *

Saeed and Yousuf,

1994

35 Sorghothrips Priesner Sorghothrips jonnaphilus

Ramakrishna

Saeed and Yousuf,

1994

36 Stenchaetothrips

Bagnall

Stenchaetothrips biformis

Bagnall

Akram, 2000

37 Stenchaetothrips faurei

Bhatti

Akram, 2000

38 Taeniothrips (Amyot &

Serville, 1843)

Taeniothrips major Bagnall

ϯ

Present study

39 Thrips Linnaeus Thrips alatus Bhatti * Akram et al.,

2003a

40 Thrips apicatus Priesner * Saeed and Yousuf,

1994

41 Thrips beharensis Saeed and Yousuf,

http://thrips.info/wiki/Bregmatothrips_binervis


39

Ramakrishna and

Margabandhu

1994

42 Thrips carthami Shumsher

*

Palmer, 1992

43 Thrips coloratus Schmutz * Palmer, 1992

44 Thrips decens Palmer * Akram et al.,

2003a

45 Thrips evulgo Palmer Palmer, 1992

46 Thrips flavus Schrank * Palmer, 1992

47 Thrips florum Schmutz * Akram et al.,

2003a

48 Thrips garuda Bhatti Akram et al.,

2003a

49 Thrips hawaiiensis Morgan

*

Palmer, 1992

50 Thrips kodaikanalensis

Ananthakrishnan and

Jagadish

Akram et al., 2000

51 Thrips orientalis Bagnall Saeed and Yousuf,

1994

52 Thrips palmi Karny * Palmer, 1992

53 Thrips subnudula Karny Palmer, 1992

54 Thrips tabaci Lindemann * Palmer, 1992

55 Thrips trehernei Priesner ϯ Present study

56 Thrips unonae Priesner Akram et al.,

2003a

(*) thrips species recorded in the current survey, (ϯ) thrips species first records from

Pakistan. (Φ) previous reported species from Pakistan and I could not find their names

in any database. Specimens are also not available to confirm the valid names.


40

Table 3.2: GPS coordinates and plant sources of newly recorded thrips species in

current study.

Species

Location (GPS

coordinate)

Source plants

Apterygothrips pellucidus

(Ananthakrishnan, 1968)

32˚9167ʹ N, 72˚7167ʹE

32˚5457ʹ N, 72˚4251ʹE

Avena sativa L. (Poaceae),

Evolvulus alsinoides (L.)

L. (Convolvulaceae),

Erigeron sublyratus DC.

(Asteraceae).

Chaetanaphothrips orchidii

(Moulton)

33˚91ʹ N, 73˚4ʹE

33˚7ʹ N, 73˚6833ʹE

33˚5437ʹ N, 73˚243ʹE

33˚4215ʹ N, 73˚4038ʹE

Brassica oleracea var.

botrytis L. (Brassicaceae),

Brassica oleracea L.

(Brassicaceae), Oxalis

annae F. Bol.

(Oxalidaceae), Evolvulus

alsinoides L.

(Convolvulaceae).

Chirothrips meridionalis

(Bagnall)

32˚5333ʹ N, 71˚9333ʹE

33˚75ʹ N, 73˚1333ʹE

33˚91ʹ N, 73˚4ʹE

Triticum aestivum L.

(Poaceae), Bidens pilosus

L. (Asteraceae), Brassica

oleracea L. (Brassicaceae).

Megalurothrips distalis

(Karny) ϯ

34˚3667ʹ N, 73˚45 ʹE

24˚7333ʹ N, 69˚7833ʹE

24˚4331ʹ N, 69˚4850ʹE

Calendula officinali

(Asteraceae),

Lantana montevidensis

(Verbenaceae), Lantana

pastazensis (Verbenaceae).

Megalurothrips usitatus

(Bagnall) ϯ

26˚0333ʹ N, 68˚9333ʹE

33˚8ʹ N, 72˚9167ʹE

33˚8ʹ N, 73˚9667ʹE

33˚7ʹ N, 73˚6833ʹE

33˚8167ʹ N, 73˚8167ʹE

Acacia karoo (Fabaceae),

Sesbania bispinosa

(Fabaceae), Ambrosia

trifida (Asteraceae), Viola

glabella (Violaceae),

Brassica napus L.

(Brassicaceae).

Neohydatothrips

samayunkur (Kudo)

34˚4ʹ N, 73˚3833ʹE

34˚243ʹ N, 73˚239ʹE

34˚2352ʹ N, 73˚2324ʹE

33˚469ʹ N, 73˚5222ʹE

33˚7667ʹ N, 73˚8833ʹE

33˚8ʹ N, 73˚9667ʹE

Eupatorium sp.

(Asteraceae), Melilotus

indicus L. (Fabaceae),

Bidens pilosus L.

(Asteraceae), Euphorbia

sp. (Euphorbiaceae),

Mimosa pudica L.

(Fabaceae), Mimosa invisa

Mart. (Fabaceae).

Taeniothrips

major (Bagnall)

34˚15ʹ N, 73˚6833ʹE

33˚9ʹ N, 73˚3833ʹE

Achyranthes aspera L.

(Amaranthaceae),

http://en.wikipedia.org/wiki/Brassica_oleracea

http://en.wikipedia.org/wiki/Brassica_oleracea


41

33˚542ʹ N, 73˚232ʹE

33˚8167ʹ N, 73˚8167ʹE

Callistephus chinensis (L.)

Nees (Asteraceae),

Capsicum frutescens L.

(Solanaceae), Amaranthus

spinosus L.

(Amaranthaceae).

Thrips trehernei (Priesner) 33˚74ʹ N, 73˚77ʹE

35˚74ʹ N, 71˚7ʹE

35˚4333ʹ N, 71˚4233ʹE

34˚82ʹ N, 74˚34ʹE

Rosa L. (Rosaceae),

Dahlia cav. (Asteraceae),

Chenopodium L.

(Amaranthaceae), Erigeron

sublyratus DC.

(Asteraceae).

http://plants.usda.gov/java/ClassificationServlet?source=display&classid=ROSA5

http://en.wikipedia.org/wiki/Asteraceae


42

3.4 DISCUSSION

This study found that members of Thysanoptera are widely distributed

throughout the country including tropical coastal lands, subtropical continental low

lands, and subtropical continental high lands. Thrips species were found on different

plant hosts including crops, ornamental plants, and weeds. Most thrips species found

during the surveys belonged to the families Thripidae and Phlaeothripidae. Species of

family Phlaeothripidae were mostly found from subtropical continental high lands but

they were also present in the subtropical continental low lands. The most commonly

found genus of family Phlaeothripidae in the current study was genus Haplothrips.

Two species of genus Haplothrips (H. ganglbaueri and H. tenuipennis) were found to

be distributed throughout the country.

The most frequently found species of family Thripidae in our study were

major pests and virus-vectors including, T. palmi, T. tabaci, T. flavus, S. dorsalis, and

F. schultzei. Genus Thrips is the largest genus of the subfamily Thripinae. It includes

more than 280 species (Mound and Masumoto, 2005). This genus is diverse and

found in many parts of the world except the Neotropical region. Several species of

economic importance are included in this genus (Bhatti, 1980) including T.

angusticeps Uzel, T. eridionalis Priesner, T. flavus Schrank, T. hawaiiensis (Morgan),

T. palmi Karny and T. tabaci Lindeman (Moritz et al., 2001). T. palmi is an Asian

polyphagous species that spread around the world during the 1980s (Mound, 2005).

Thrips trehernei was also found for the first time in Pakistan. Scirtothrips is another

important genus of the family Thripidae. It includes 103 species from around the

world (ThripsWiki, 2014), several of which are important pests (Mound and Palmer,

1981; Mirab-balou et al., 2013). Two species of the genus Scirtothrips (S. dorsalis, S.

oligochaetus) were recorded from Pakistan in the current study.

Scolothrips (Thripidae) includes the well known predator species of mites

(Mound, 2011). Sixteen species in this genus are recognized (ThripsWiki, 2014), of

which one species (Scolothrips rhagebianus) was found in the current study.

Microcephalothrips abdominalis (sunflower thrips), was found in Faisalabad region

as well as Sindh. The genus Megalurothrips Bagnall includes thirteen species

(ThripsWiki, 2014), some of them are pests of legume crops (Masumoto, 2010).


43

Although Palmer (1987) has provided details on species of the genus Megalurothrips,

their identification continues to be a challenge. Three species of genus

Megalurothrips (M. usitatus, M. distalis and M. peculiaris) were found at both

highland and lowland sites in Pakistan, on several plant species.

In summary, this study adds new information to the diversity of Thysanoptera

in Pakistan. A total of 41 thrips species were morphologically identified, representing

3 families and 21 genera. The array produced 8 species and 4 genera that were

reported for the first time from Pakistan. Intensive surveys of thrips fauna, with

repetitive collections during different seasons of the year are needed to better

understand the highly diverse thrips fauna from this region.

Chapter 4 DNA Barcoding

44

Chapter 4

ANALYSIS OF THRIPS BY DNA BARCODING

4.1 INTRODUCTION

4.1.1 Identification of thrips

The identification of thrips is mainly based on their biology (e.g.,

developmental stages and host range) and morphology (e.g., number and patterns of

setae on the wings, head, and other parts of the exoskeleton; patterns carved in the

exoskeleton cuticle; antennal segment; and shape of ovipositor). Morphological

identification of thrips is constrained by the minute size of insect, scarcity of

characters, adult and nymphal stages of different thrips species has high degree of

similarity (Brunner et al., 2002), polymorphism (Murai and Toda, 2001) and lack of

trained manpower etc. To study the morphological characters for thrips species

identification traditionally requires slide mounting of specimens and knowledge of

distinct characters of species which are visible through microscopic examination

(Palmer et al., 1989; Bisevac, 1997), whereas it is impossible to examine the

morphological characters of different thrips species at larval stages (Brunner et al.,

2002). Mostly thrips within each of two suborders are inquisitively uniform in

morphology albeit some species exhibit conspicuous features. Like many other small

unrelated insects, thrips also bear a fringe of long setae on their wings. In this

situation it is difficult to identify different thrips species both at adult and at larval

stages with routinely used morphological methods with reliability.

Thrips species from Pakistan have been identified by morphology and the

available taxonomic keys on Thysanoptera of the region are limited in scope (Palmer,

1992). More recent reports on thrips from the families Thripidae and Phlaeothripidae

(Akram et al., 2002, 2003a, b; Ali, 1976; Saeed and Yousuf, 1994; Saeed et al., 1994;

Umar, 2004) are all based on morphology.


45

4.1.2 Thrips identification based on molecular studies

Molecular identification is generally considered reliable for thrips

identification as it overcomes the limitations associated with the developmental stage

(Brunner et al., 2002). Identification of thrips by molecular means has advanced, and

different genes have been used as markers for species discrimination (Walsh et al.,

2005; Kox et al., 2005; Toda and Komazaki, 2002). Molecular markers have the

advantage where polymorphism is a problem e.g., because of the prevailing

temperature, color and size variation occurs in T.tabaci and it hampered correct

identification of insect (Murai and Toda, 2001). Species-specific primers enable a

non-specialist to identify the target species at any developmental stage (Asokan et al.,

2007).

Various molecular techniques have been used for thrips species identification

and for population diversity studies mostly for pest and virus vector thrips species.

These molecular techniques include DNA sequencing (Brunner et al., 2004; Morris

and Mound, 2004) and PCR based methods i.e., real time PCR (Walsh et al., 2005;

Kox et al., 2005), PCR-restriction fragment length polymorphism (PCR-RFLP) (Toda

and Komazaki, 2002; Brunner et al., 2002; Rugman-Jones et al., 2006), amplified

fragment length polymorphism (AFLP) (Fang et al., 2005), and simple sequence

repeat (SSR-PCR) (Brunner and Frey, 2004). Toda and Komazaki (2002) used a PCR-

RFLP method to identify nine species of S. dorsalis. Buckman et al. (2013) reliably

used nuclear and mitochondrial genes for the phylogenetic analysis of thrips of 99

thrips species from seven of the nine families. One of the molecular methods that has

received widespread acceptance is DNA barcoding that is based on the differences in

the DNA sequence of the mitochondrial cytochrome c oxidase I gene (COI) (Hebert et

al., 2003a). Karimi et al. (2010) proposed that the DNA barcoding can be a useful

method for thrips species identification and quarantine purposes.

4.1.2.1 Introduction of DNA barcoding

Use of 658 bp of COI-5ʹ (DNA barcode) (Hebert et al., 2003b) has proved as a

reliable method to discriminate animals to their species and has been widely accepted


46

for resolving insect species including cryptic complexes (Burns et al., 2007; Foottit et

al., 2008; Ashfaq et al., 2014a, b). Inter-specific variations found in mtCOI gene are

more reliable than any other gene markers (Savolainen et al., 2005). The COI

divergence within the species rarely exceeds 2%, while among different species it

typically shows a higher divergence (Hebert et al., 2003a, b). COI has been

extensively used for identification of vertebrate (Hebert et al., 2004; Hajibabaei et al.,

2006) and invertebrate (Costa et al., 2007; Mikkelsen et al., 2007) species

identification.

DNA barcoding provides robust analysis of the specimen taxonomy by

integrating ecological, genetic and morphological data (Dayrat, 2005). Dasmahapatra

and Mallet (2006) discussed the recent successes and future prospects of DNA

barcoding to discriminate different species and they presented the view that

taxonomic approaches integrating morphology, DNA sequencing and ecological

studies will achieve maximum efficiency in species identification. Frohlich et al.

(1999) used the COI to distinguish lineages of B. tabaci and 383 different haplotypes

have now been identified for this gene (de Barro, 2012). Global invasion histories

varied for different species in complex e.g., in B. tabaci (de Barro and Ahmed, 2012)

and these lineages have differential roles in disease transmission to various crops

showing the correlation between vector genotypes and their capacity to transmit

disease pathogens (Legg et al., 2002; Chowda-Reddy et al., 2012; Fansiri et al., 2013).

It is previously reported that some of the thrips species have subspecies (Brunner et

al., 2004; Glover et al., 2010; Karimi et al., 2010). In present studies examination of

sequence diversity in the mitochondrial COI gene has been used for understanding the

genetic relationships in these complexes.

The barcode data in BOLD has been organized in Barcode Index Numbers

(BINs) (Ratnasingham and Hebert, 2013). The BIN system contains the overall

information about the indexing, storage, and retrieval of the OTUs (Operational

taxonomic units). The BIN system is based on the analysis of patterns of nucleotide

variation in the barcode region of the cytochrome c oxidase I (COI) gene. It is

persistant taxonomic registry at species-level for the animal kingdom. BINs have

aided retrospect taxonomy by flagging possible cases of synonymy and also by


47

comparing geographical information, descriptive metadata, and images for specimens

that are likely to belong to the same species, even if it is undescribed.

The development of BIN system (Ratnasingham and Hebert, 2013) has

provided a mechanism to organize animal barcode sequences as studies have shown

that most morphological species and BINs are congruent (Zahiri et al., 2014). The

BINs have been used as a species-level taxonomic registry for various animal groups

(Hausmann et al., 2013) and have aided the discovery of new species (Landry and

Hebert, 2013; Mutanan et al., 2013; Ashfaq et al., 2014a). BINs also play a pragmatic

role in biodiversity as most animal species anticipate a description (Trontelj and Fiser,

2009) and many described taxa in actual represent a complex of species (Bickford et

al., 2007). BIN system allows the examination of many issues that require species

level identifications. It also provides the powerful tool to assess local biodiversity

(Young et al., 2012). BIN analysis permits examination of species turnover in space

and time (Carr et al., 2011).

4.1.2.2 DNA barcoding in thrips species identification

Thrips are mainly identified on morphological basis but molecular approaches

have been advanced in respect to the identification of species in the different genera

of thrips (Brunner et al., 2002). Mitochondrial COI has been considered a suitable

marker for thrips identification as it exhibits reliable inter-species variations

(Savolainen et al., 2005) as compared to other markers (Frey and Frey, 2004; Asokan

et al., 2007; Zhang et al., 2011). Kadirvel et al. (2013) found the partial cytochrome

oxidase I (COI) sequences very useful to identify and classify unknown thrips.

According to Timm et al. (2008) mitochondrial cytochrome oxidase I (mtCOI) gene

sequence analysis is a rapid, accurate, and simple means of identifying the thrips

species present in southern Africa. Glover et al. (2010) found varying degrees of

discrimination of thrips species while compared five different loci and among them

COI provided sufficient variation to be used for future DNA barcoding studies of

thrips. Reference libraries are needed for thrips identification based on the molecular

data but more research studies on biology of thrips have been focused on the pest

thrips species. Most studies are done on crop pests and tospovirus vector species of

thrips (Persley et al., 2010). During the past 30 years the one third of total


48

publications on Thysanoptera has addressed F. occidentalis (Western flower thrips)

(Reitz, 2009).

A rapid increase in global trade warrants the development of a more universal

and anticipatory system to identify the unfamiliar taxa invading a country’s borders.

Invasive species could reduce the local biodiversity and also affect the economy by

damaging crops (Vitousek et al., 1996). Accurate species identification is critical for

controlling arthropod pests (Rosen, 1986; Davies et al., 2004; Armstrong and Ball,

2005), since misidentification of a pest may lead to the use of improper control

measures resulting in the loss of time, money and effort (Rosen, 1986).

4.1.3 Objective of the current study

Current study was aimed at

1) DNA barcode-based identification and analysis of thrips from Pakistan.

2) Development of a regional barcode reference library for Thysanoptera.

3) Analysis of thrips diversity and cryptic species complexes.

4.2 MATERIALS AND METHODS

4.2.1 Collection of insects and storage

Thrips were collected and preserved for further investigation using the method

described in sec. 2.1.

4.2.2 Database

Data was organized in Excel by adding information on sample ID, specimen

field number, museum voucher catalog number, taxonomic identification, identifier’s

name and email, voucher type, extra information, life stage of specimen, date of

collection, continent, country, province, district, location and GPS coordinates and

submitted to the Barcode of Life Data Systems (BOLD) under the project, MATHR


49

"Thrips Species of Pakistan". Each specimen was photographed using a camera fitted

stereo microscope and the images were uploaded to BOLD (Fig. 4.1).

4.2.3 Plate arrays

Thrips specimens were placed in 96 well plate, one specimen per well, in accordance

with the data and images upload in BOLD system.

4.2.4 DNA extraction

DNA isolation was carried out at the Canadian Centre for DNA Barcoding

(CCDB) within the Biodiversity Institute of Ontario following protocols described in

Porco et al. (2010). Vouchers were recovered for slide preparation and morphological

analysis.

4.2.5 DNA polymerase chain reaction (PCR)

Amplification of the 658 bp of the COI-5ʹ barcode region was performed with

the primers C_LepFolF and C_LepFolR. PCR profile followed was; 94°C (1 min), 5

cycles of denaturation at 94°C (40 s), annealing at 45°C (40 s), extention at 72°C (1

min); 35 cycles of denaturation at 94°C (40 s), annealing at 51°C (40 s), extention at

72°C (1 min) and final extension of 72°C (5 min). These primers are the mixtures of

LepF1 (ATTCAACCAATCATAAAGATATTGG)/LCO1490 (GGTCAACAAATCA

TAAAGATATTGG) and LepR1 (TAAACTTCTGGATGTCCAAAAAATCA)/

HCO2198 (TAAACTTCAGGGTGACCAAAAAATCA), respectively. Amplification

of 439 bp of COI-3ʹ was performed with primer pair C1-J-1751

(GGATCACCTGATATAGCATTYCC)/C1-N-2191 (CCCGGTAAAATTAAAATA

TAAACTTC) under the PCR conditions outlined above. PCRs were carried out in

12.5 µL reactions containing standard PCR ingredients and 2 µL of DNA template.

PCR products were analyzed on 2% agarose E-gel® 96 system (Invitrogen Inc.).

BigDye Terminator Cycle Sequencing Kit (v3.1) (Applied Biosystems) on an Applied

Biosystems 3730XL DNA Analyzer was used to sequence the amplicons

bidirectionally. CodonCode Aligner (CodonCode Corporation, USA) was used to

assemble, align and edit the forward and reverse sequences and the sequences were

submitted to BOLD. Sequences were also inspected and translated in MEGA V5 to


50

verify that they were free of stop codons. All sequences generated in this study are

accessible on BOLD under the project MATHR.


Specimen carcasses were retrieved after the genomic DNA extractions from

intact specimens (Rugman-Jones et al., 2010) and were mounted onto the slides using

Hoyer’s medium. Standardized morphological keys for thrips were used for species

level identification. Morphological characters were studied using a compound

microscope (Olympus BX 41) under magnifications, 40X, 100X and 400X. Voucher

specimens were verified by Mr. Stan Diffie, University of Georgia, Tifton campus,

USA and Sueo Nakahara, USDA ARS, Beltsville, MD., USA.

4.2.7 Data analysis

4.2.7.1 Species discrimination using DNA barcodes

Sequence similarities between the sequences from each species generated in

this study and those available in the GenBank were determined by nBLAST

(http://www.ncbi.nlm.nih.gov/blast/). Further, barcode sequence from each specimen

was compared with those on BOLD using the ‘Identification Request’ function. Prior

studies have revealed that most different species of thrips show 2% sequence

divergence at COI (Hebert et al., 2003b), and researchers have used a 2% distance

threshold for species delimitation (Strutzenberger et al., 2011). The BOLD follows

Barcode Index Number (BIN) system (Ratnasingham and Hebert, 2013) to organize

the barcode data for records into operational taxonomic units (OTUs) which are

lacking a formal taxonomic assignment. Different BINs have assigned to the

specimens belong to different species. All thrips sequences in this study were

assigned to a BIN.

4.2.7.2 Genetic diversity and phylogenetic analysis

MEGA 5 (Tamura et al., 2011) was used to perform the ClustalW nucleotide

sequence alignments (Thompson et al., 1994) and NJ clustering analysis. The Kimura-

2-Parameter (K2P) (Kimura, 1980) distance model along with pairwise deletion of


51

missing sites, with nodal support estimated using 500 bootstrap replicates was used.

The online version of Automatic Barcode Gap Discovery (ABGD) was used for

pairwise distance analysis and to generate distance histograms and distance ranks

(Puillandre et al., 2012). As a test of the reliability for species discrimination,

presence or absence of a ‘barcode gap’ (Meyer and Paulay, 2005) was determined for

each species. The ‘Barcode Gap Analysis’ (BGA) was performed using BOLD. Using

the barcode gap criterion, a species is distinct from its nearest neighbor (NN) if its

maximum intraspecific distance is less than the distance to its NN sequence

(Ratnasingham and Hebert, 2007).

Because the morphological species were represented by variable number of

sequences, a consensus sequence for each BIN or species was obtained using the

‘Consensus Barcode Generator’ function of TaxonDNA. Consensus sequences were

used in Bayesian inference (BI) analysis and BI trees were obtained using MrBayes

v3.2.0 and the Markov Chain Monte Carlo (MCMC) technique. The data was

partitioned in two ways; i) a single partition with parameters estimated across all

codon positions, ii) a codon-partition in which each codon position was allowed

different parameter estimates. The analyses were run for one million generations with

sampling every 1,000 generations. Bayesian posterior probabilities were calculated

from the sample points once the MCMC algorithm began to converge. The trees

generated through this process were visualized using FigTree v1.4.0. Rhopalosiphum

padi (HQ979401) was used as outgroup.

4.2.8 Scanning Electron Microscopy (SEM)

For verification of barcode-identified cryptic vector thrips species, SEM

analysis was performed to identify subtle morphological differences found in these

cryptic species. Individual thrips from two cryptic thrips species (T. palmi and T.

tabaci) were placed on double sticky carbon tabs attached to aluminum stubs under

the light microscope and placed in a vacuum desiccator overnight to remove any

residual moisture. The samples were sputter coated with gold prior to viewing with

the FEI Quanta 200F SEM.


52

4.2.9 Haplotype and distribution analysis

Barcode sequences of important tospovirus vectors (S. dorsalis, T. tabaci, T.

palmi and T. flavus) from Pakistan, combined with published records from other

countries were ClustalW aligned in MEGA5 and exported as MEGA files. For this

analysis each morphological species was treated as one taxon regardless of the

number of lineages/BINs in its barcode sequences. Haplotypes for each species were

generated using sequence polymorphism software (DnaSP 5.10) (Librado and Rozas,

2009). For Analysis of molecular variance (AMOVA), the genetic structure of

haplotypes data derived from DnaSP 5.10 saved as Arlequin output file was used.

AMOVA was performed to estimate the genetic structure of different barcode

haplotypes of each thrips species using Arlequin v.3.5 (Excoffier and Lischer, 2010).

For each species, a minimum spanning tree (MST) based on the number of nucleotide

differences between haplotypes was constructed from Arlequin. Arlequin output data

file (minimum spanning tree) of haplotypes was used for the construction of

haplotypes tree using software HapStar Version 0.5 (C) (Teacher and Griffiths, 2011)

to visualize the network of interrelationships between the haplotypes.

4.3 RESULTS

4.3.1 DNA barcode analysis of thrips species

Barcode sequences greater than 500 base pairs (bp) were recovered from 471

of the 504 specimens (93%), providing at least one sequence for each of the identified

species/ genera from three families. The K2P sequence divergence among the 33

thrips species with >2 specimens, among the 5 genera with two or more species and

among the 2 families with two or more genera are shown in Table 4.1. The intra- and

interspecific distances ranged from 0-7.56% and 5.64-27.08%. The nearest-neighbor

(NN) distances for all the species were more than 5% (Table 4.1). Intraspecific

distances could not be determined for 17 species with only a single representative.

Sequence divergence increased with the taxonomic rank (Table 4.1, Fig. 4.2) with a

little overlap between conspecific and congeneric distances. The distances within

families ranged from 6.55 to 35.57% with a mean of 22.67%.


53

Barcode Gap analysis showed that both the maximum and mean distances to the NN

were higher than the respective intra-specific distances for all the species (Fig. 4.2).

The ABGD was used to generate distance (K2P) histograms and distance ranks (Fig.

4.3). The analyses revealed a clear gap between intraspecific and interspecific

distances (Fig. 4.3b). The analysis further showed 51 groups with initial partition,

while 56 groups with recursive partition, which were in congruence with the BINs on

BOLD.

The BIN system assigned the 471 sequences to 55 BINs. Morphological

identifications and BINs were congruent for 39 species while conspecific sequences

from A. intermedius, H. reuteri and T. palmi were assigned to two BINs. All of the 55

BINs were a single species at the 2% threshold with the largest pairwise intra-specific

distance being 1.67%, except for T. flavus (2.7%), and T. tabaci (3.7%).

The Barcode Index Numbers (BINs) and maximum intra-specific distances for

thrips species from Pakistan and other countries are shown in Table 4.2. Sequence

comparison of thrips from this study with those on BOLD and GenBank revealed

close sequence matches (<2% divergence) for only eight species in this study.

NJ clustering analysis showed that each of the 55 BINs formed a

monophyletic cluster (Fig. 4.4). Although all the barcodes from T. tabaci were

assigned to one BIN, the NJ analysis showed two deeply divergent clusters for this

species. The Bayesian analysis supported the results from the NJ analysis clusters and

showed the lineages determined by the BIN system and NJ clustering were

monophyletic. Further, the species from the Tubulifera and Terebrantia were grouped

in the tree with their respective suborders (Fig. 4.5).

DNA barcoding showed that T. palmi and T. tabaci each comprised of two

deeply divergent lineages. The barcode sequences from these species in the published

databases are limited and do not provide a complete identity analysis. COI-3ʹ gene

fragments from both the species were sequenced for identity analysis based on this

region which has been frequently used for thrips analysis and has a comparatively

larger number of published sequences. NJ clustering analysis of COI-3ʹ from T. palmi

revealed two divergent (K2P, 8.4%) lineages; one showed 100% nucleotide identity

with T. palmi from India (EF117830) while the other with that from Dominican

Republic (FN546137) (Fig. 4.6a). Similarly, COI-3ʹ from T. tabaci, showed the

presence of two lineages (K2P, 4.1%); one showed 99% nucleotide identity with T.


54

tabaci from the United Kingdom (FN546168) while the other with that from Israel

(FN546150) (Fig. 4.6b).


Morphological characters indicated the presence of 42 thrips species in the

collection (Table 4.2). Five species were identified only to their genera, including two

from Thrips, two from Aeolothrips and one from Haplothrips. Five more were

identified only to the family. Pictures of the barcoded thrips species with their BOLD

ID are presented in fig. 4.1.


55

Table 4.1: Percentage K2P sequence divergence at the COI barcode region among the

33 thrips species with >2 specimens, among the 5 genera with two or more species

and among the 2 families with two or more genera

Distance class n Taxa Comparisons Min (%) Mean (%)

Max (%)

Intraspecific 426 33 8747 0 0.59

7.56

Congeners 362 5 22197 5.64 18.98

27.08

Confamilial 424 2 28324 6.55 22.71

35.57


56

Table 4.2: Barcode Index Numbers (BINs) and maximum intraspecific distances for

thrips species from Pakistan and other countries.

Max intraspecific

distribution

(individuals) %

Family Species BIN Pakistan Combin

ed

Countries with

matches Aeolothripidae Aeolothrips intermedius AAU0572 0.2(3) ----- -----

Aeolothripidae Aeolothrips intermedius AAZ8618 0.8(10) ----- -----

Aeolothripidae Aeolothrips spp. PK02 AAZ8619 0.2(3) ----- -----

Aeolothripidae Aeolothrips spp. PK01 AAN6626* --- ----- -----

Thripidae Anaphothrips

sudanensis AAV3388* --- ----- -----

Phlaeothripidae Ananthakrishnana

euphorbiae ACA2783* --- ----- -----

Phlaeothripidae Apterygothrips

pellucidus AAY6328 0.0(2) ----- -----

Thripidae Arorathrips mexicanus AAN5064 0.2(2) ----- -----

Thripidae Chaetenaphothrips

orchidii AAP7685 0.6(4) ----- -----

Thripidae Chirothrips

meridionalis AAN5797 0.0(3) 0.8(7) Croatia

Thripidae Dendrothripoides

innoxius AAN5065 0.2(8) ----- -----

Thripidae Frankliniella schultzei AAN6620 0.5(24) 0.5(30) Australia, India, Kenya

Phlaeothripidae Haplothrips andresi AAN5799 0.2(7) ----- -----

Phlaeothripidae Haplothrips bagrolis AAZ8515* --- ----- -----

Phlaeothripidae Haplothrips ciliatus AAU5460 0.5(5) ----- -----

Phlaeothripidae Haplothrips

ganglbaueri ACF1370 0.0(39) ----- -----

Phlaeothripidae Haplothrips gowdeyi AAN5798* --- ----- -----

Phlaeothripidae Haplothrips reuteri ACA2784 0.6(7) ----- -----

Phlaeothripidae Haplothrips reuteri AAI6863* --- ----- -----

Phlaeothripidae Haplothrips spp. PK01 ACA2828* --- ----- -----

Phlaeothripidae Haplothrips stylatus AAU6351* --- ----- -----

Phlaeothripidae Haplothrips tenuipennis AAN4488 2.3(25) ----- -----

Thripidae Hydatothrips atactus AAN9110* --- ----- -----

Thripidae Lefroyothrips lefroyi ACI6048* --- ----- China, India (sequences

not public)

Phlaeothripidae Liothrips infrequens ACA2829* --- ----- -----

Thripidae Megalurothrips

pecularis AAN6623 0.3(10) 0.7(20) China

Thripidae Megalarothrips usitatus AAM8053 1.1(5) 1.7(11) Australia, India

Thripidae Microcephalothrips

abdominalis AAI0410 0.3(15) 1.4(27) Australia, United States,

Canada, China Thripidae Mycterothrips

nilgiriensis ACA2806* --- ----- -----

Thripidae Neohydatothrips

samayunkur AAP7680 0.2(7) 0.2(10) South Africa

Phlaeothripidae Plicothrips apicalis AAN6622 0.3(4) ----- -----

Thripidae Pseudodentothrips

bhattii ACG8261* --- ----- -----

Thripidae Scirtothrips dorsalis AAC9748 1.7(10) 3.2(48) China, India, Japan,

Thailand, United States Thripidae Scritothrips AAZ8518* --- ----- -----


57

oligochaetus

Thripidae Scolothrips

rhagebianus AAZ8517* --- ----- -----

Thripidae Taeniothrips major AAN6621 0.2(4) ----- -----

Thripidae Thrips alatus AAN6625 0.0(2) ----- -----

Thripidae Thrips apicatus AAY6262 0.2(5) --- -----

Thripidae Thrips carthami AAP7682 0.5(7) --- ----

Thripidae Thrips coloratus AAK1804 0.5(15) --- -----

Thripidae Thrips decens AAP7679* --- ----- -----

Thripidae Thrips flavus AAN6624 2.7

(105)

2.7

(113)

China

Thripidae Thrips florum AAP7683 0.2(2) ----- -----

Thripidae Thrips hawaiiensis AAZ8516 0.0(2) 1.3(10) China, India

Thripidae Thrips palmi AAE7913 0.3(8) 2.0(46) China, India, Japan,

Thailand, Dominican

Republic, United Kingdom Thripidae Thrips palmi AAN2747 0.3(38) 1.6(145) India

Thripidae Thrips tabaci AAB3870 3.7(38) 6.5(211) New Zealand, Australia,

Canada, China, Norway,

United States, Tanzania,

Madagascar, Serbia, Japan,

United Kingdom, Bosnia

and Herzegovina,

Israel, Germany, Peru,

India, South Africa Thripidae Thrips trehernei AAN9105 0.0(4) 2.4(106) Canada, China, Iran,

United Kingdom, Croatia,

Germany

Thripidae Thrips spp. PK01 AAN9111 2.2(7) --- -----

Thripidae Thrips spp. PK02 AAP7684* --- ----- -----

Phlaeothripidae --- ACA9557* --- ----- -----

Phlaeothripidae ---- ACK3864 0.2(6) ----- -----

Thripidae ---- AAP7681 0.4(5) ----- -----

Thripidae --- ACA3048 0.0(3) ----- -----

Thripidae --- ACP4916* --- ----- -----

(*) species have single representative sequences so no intraspecific distance could be

determined


58

Figure 4.1: A) Pictures of thrips species (Terebrantia) from Pakistan on BOLD.


59


60


61


62

Figure 4.1: B) Pictures of thrips species (Tubulifera) from Pakistan on BOLD.


63


64

a)

b)

0

5

10

15

20

25

30

0 2 4 6 8 10 12 14

Max. intraspecific dist. (%)

Dis

tance

to N

N

0

5

10

15

20

25

30

0 2 4 6 8 10 12 14

Mean intraspecific dist.(%)

Dis

tance

to N

N


65

c)

d)

Figure 4.2: Barcode gap analysis (BGA) of thrips species from Pakistan by Bold.

a) Maximum intraspecifid dististance of thrips species versus nearest neighbor

distances b) Mean intraspecific distance of thrips species versus nearest neighbor

distances c) Number of individuals per thrips species verses max. intra-specific

distance and d) frequency histogram of distance to nearest neighbour.


66

a) Histogram of distances

b) Ranked distances

Figure 4.3: Pairwise distance analysis of thrips species from Pakistan generated

by Automatic Barcode Gap Discovery (ABGD).


67

Thrips flavus

Thrips carthami shamsher

Thrips trehernei

Thrips coloratus

Thrips hawaiiensis Thrips apicatus

Microcephalothrips abdominalis

Mycterothrips nilgiriensis Thrips decens

Thrips alatus Thrips PK02

Thrips florum

Thrips palmi (AAE7913)

Thrips palmi (AAN2747)

Thripidae2 (AAP7681) Thripidae1 (ACA3048)

Thrips tabaci (AAB3870)

Thrips tabaci (AAB3870)

Lefroyothrips lefroyi Thrips PK01

Chirothrips meridionalis

Neohydatothrips samayunkur Pseudodendrothrips bhattii

Taeniothrips major

Megalurothrips pecularis

Megalurothrips usitatus Scolothrips rhagebianus

Hydatothrips atactus

Dendrothripoides innoxius

Scirtothrips oligochaetus

Scirtothrips dorsalis

Frankliniella schultzei

Anaphothrips sudanensis Thripidae3 (ACP4916)

Chaetanaphothrips orchidii Aeolothrips PK01

Aeolothrips PK02 Aeolothrips intermedius (AAU0572)

Aeolothrips intermedius (AAZ8618)

Arorathrips mexicanus Phlaeothripidae1 (ACK3864)

Plicothrips apicalis

Apterygothrips pellucidus Haplothrips bagrolis

Haplothrips stylatus Haplothrips reuteri (ACA2784)

Haplothrips reuteri (AAI6863) Haplothrips andresi Haplothrips gowdeyi

Phlaeothripidae2 (ACA9557)

Haplothrips tenuipennis

Liothrips infrequens Ananthakrishnana euphorbiae

Haplothrips PK01 Haplothrips ciliatus

Haplothrips ganglbaueri

Rhopalosiphum padi (HQ979401: outgroup)

99

99 99

99

99

99

99

99

99

99

99

99

99

51

59

81

66

86

50

86

99

99

99

99

99

99

99

99

99

99

99

99

99

99

99

99

99

83

99

99

99

99

99

99

99

96

99

99

99

99

99

99

69

99

84

54

52

99

0.05


68

Figure 4.4: NJ tree based on COI sequence (with 500 boot strap value)

constructed with the Kimura two-parameter model

Taxa are labeled with the BIN numbers. Bootstrap support ≥ 50% is indicated at

branches. The node for each species with multiple specimens was collapsed to a

vertical line or triangle, with the horizontal depth indicating the level of intraspecific

divergence. Number of individuals analysed are shown in brackets next to each

species name. COI barcode sequences (658bp) of species Rhopalosiphum padi

(HQ979401), order Hemiptera was used as the out group. Morphological

identifications of thrips species used in Cluster analysis and Bayesian analysis are

given in Table 4.2.


69

Figure 4.5: Barcode-based phylogenetic analysis for thrips using Bayesian

inference

Probability values and species names are indicated at branches. COI barcode

sequences (658bp) of species Rhopalosiphum padi (HQ979401), order Hemiptera was

used as the out group.


70

a)

b)

Figure 4.6: Cluster and distance analysis of 3’COI region of cryptic thrips vector

species (Thrips palmi and T.tabaci). Two letters country code provided with each

accession number used in this analysis. a) NJ tree of T. palmi b) NJ tree of T. tabaci


71

4.3.3 SEM of cryptic thrips vector species

SEM analysis did not reveal any unique morphological characters among

specimens from T. palmi or T. tabaci while detailed study was done for each species

including antennal segments with sensorium, pronotum, mesonotum and metanotum

characteristics (Fig. 4.7).

a)

b)

Figure 4.7: Scanning Electron Micrographs of cryptic thrips vector species

a) Scanning Electron Micrographs of T. palmi b) Scanning Electron Micrographs of

T. tabaci


72

4.3.4 Global haplotype diversity

COI-5ʹ sequences of four thrips vector species (T. tabaci, T. palmi, T. flavus,

S. dorsalis) were combined with those from GenBank to construct the haplotype

networks (Fig. 4.8). Sequences for the other species were either too few to generate a

network or they lacked matches from COI-5ʹ region for the haplotype networks.

For T. tabaci, 36 sequences from this study combined with 115 from GenBank

from four partitioned geographic regions (Asia, Europe, Australia and America) were

analysed for number of haplotypes. Sequence polymorphism software (DnaSP 5.10)

revealed 15 T. tabaci haplotypes with haplotypes diversity 0.740 ± 0.030 and 14

polymorphic sites (SNPs). Significance of variance analysis of the genetic structure of

T. tabaci haplotypes among these geographic regions (Table 4.3a) revealed the T.

tabaci populations from different geographic regions of the world showed similar

level of genetic variability regardless of their different geographic regions (-0.01889

% population variance). Population variations among populations within geographic

regions and within populations were 47.35 % and 54.06 %, respectively and these

variations were significant. Haplotypes tree demonstrated that these haplotypes were

clustered into three groups connected through haplotype from United Kingdom

(Figure 4.8a). The most common haplotype (n = 70) was found in nine countries

including Pakistan. Moreover the tree showed a link between haplotypes and

geographic region for some haplotypes. Three low frequency haplotypes were found

and restricted to Pakistan.

The sequences from the 132 T. palmi specimens from four partitioned

geographic regions (East Asia, South Asia, Southeast Asia and Europe) containing 47

sequences from this study combined with 85 from GenBank were analysed. Sequence

polymorphism analysis revealed 16 T. palmi haplotype groups with haplotypes

diversity 0.664 ± 0.028. Moreover there were 43 polymorphic sites (SNPs) among

these haplotypes. For AMOVA the genetic structure of haplotypes data were

partitioned into four groups on the basis of geographic locations; East Asia, South

Asia, Southeast Asia and Europe. AMOVA analysis (Table 4.3b) revealed that the T.

palmi populations from different geographic regions of the world did not show similar

level of genetic variability (9.75607% population variance). While the variations

among populations within geographic regions and within populations were 4.04 %


73

and 16.17 %, respectively and these variations were significant. According to

haplotypes tree (Fig. 4.8b) 16 haplotypes were clustered into two groups connected

through missing haplotype data. Out of 16 haplotypes 9 haplotypes were found in

India with 7 haplotypes restricted to India and two haplotypes shared between India

and Pakistan (Fig. 6b). The network showed the haplotypes were clustered into two

groups with records from Pakistan found in both. Pakistan showed 5 haplotypes of T.

palmi out of which two haplotypes restricted to Pakistan.

The sequences from 41 S. dorsalis specimens from four partitioned geographic

regions (East Asia, South Asia, Southeast Asia and North America) containing 10

sequences from our collection combined with 31 from GenBank were analysed.

Sequence polymorphism analysis revealed 23 S. dorsalis haplotype groups with

haplotypes diversity 0.905 ± 0.034. Moreover there were 32 polymorphic sites (SNPs)

among these haplotypes. For AMOVA the genetic structure of haplotypes data were

partitioned into four groups on the basis of geographic locations; East Asia, South

Asia, Southeast Asia and North America. AMOVA analysis (Table 4.3c) revealed that

the S. dorsalis populations from different geographic regions of the world did not

show similar level of genetic variability (0.21799% population variance). While the

population variations among populations within geographic regions and within

populations were 10.72 % and 77.68 %, respectively but these variations were not

significant. Haplotype tree (Fig. 4.8c) demonstrates that the 23 haplotypes were

clustered into three groups connected through haplotype 8. 21 haplotypes were low

frequency haplotypes represented by only one or two sequence of S. dorsalis. While

13 haplotypes of these were confind to India. 6 haplotypes of S. dorsalis were found

in Pakistan out of which 4 were limited to Pakistan (Fig. 6c).

For T. flavus, 111 sequences from GenBank containing 103 sequences from

Pakistan and merely eight sequences were available in GenBank were analysed for

number of haplotypes. Polymorphism analysis revealed 15 T. flavus haplotype groups

with haplotypes diversity 0.356 ± 0.059 and 23 polymorphic sites (SNPs). Population

variations among populations within geographic regions and within populations were

77.48 % and 22.52%, respectively (Table 4.3d) and these variations were significant.

Haplotype tree demonstrated that the 15 haplotypes were clustered into three groups

connected through haplotype from United Kingdom (Figure 4.8d). 13 T. flavus

haplotypes were of low frequency records only with 1-3 T. flavus sequences 5 of


74

which were restricted to China and rest were limited to Pakistan. Only one haplotype

population was shared between Pakistan and China. One T. flavus haplotype confined

to Pakistan was of very high frequency showed by 89 T. flavus sequences from the

country.


75

Table 4.3a: Comparisons between geographic region (Asia, Europe, Australia and

America) by AMOVA using COI gene sequences of T. tabaci

Model

Hierarchical

levels

Degree

of

freedom

Sum of

square

Variance

components

Fixation

indices

Percentage

of

variation

P-value

Geograph-

ical

regions

Among

Groups

3

31.095

-0.01889

-0.01408FCT

11.60

0.21799

Among

Populations

Within

Groups

12

59.652

0.63518

0.46689FSC

47.35

0.00000

Within

Populations

136

98.635

0.72526

0.45939FST

54.06

0.00000

Total

151

189.382

1.34154

Table 4.3b: Comparisons between geographic region (East Asia, South Asia,

Southeast Asia and Europe) by AMOVA using COI gene sequences of T. palmi

Model

Hierarchical

levels

Degree

of

freedom

Sum of

square

Variance

components

Fixation

indices

Percentage

of

variation

P-value

Geograph-

ical

regions

Among

Groups

3

196.624

9.75607

0.79787FCT

79.79

0.02346

Among

Populations

Within

Groups

3

36.645

0.49445

0.20005FSC

4.04

0.00000

Within

Populations

133

262.967

1.97719

0.83830FST

16.17

0.00000

Total

139

496.236

12.22771


76

Table 4.3c: Comparisons between geographic region (East Asia, South Asia,

Southeast Asia and North America) by AMOVA using COI gene sequences of S.

dorsalis

Model

Hierarchical

levels

Degree

of

freedom

Sum of

square

Variance

components

Fixation

indices

Percentage

of

variation

P-value

Geograph-

ical

regions

Among

Groups

3

11.013

0.25409

0.11596FCT

11.60

0.21799

Among

Populations

Within

Groups

2

6.995

0.23490

0.12126FSC

10.72

0.19746

Within

Populations

37

62.981

1.70218

0.22316FST

77.68

0.00293

Total

42

80.989

2.19117

Table 4.3d: Comparisons between geographic region (East Asia and South Asia) by

AMOVA using COI gene sequences of T. flavus

Model

Hierarchical

levels

Degree

of

freedom

Sum of

square

Variance

components

Fixation

indices

Percentage

of

variation

P-value

Geograph-

ical

regions

Among

Populations

1

57.942

3.82773

-----

77.48

0.00000

Within

Populations

109

121.233

1.11223

0.77485FST

22.52

0.00000

Total

110

179.175

4.93996


77


78

Figure 4.8: Barcode haplotype network analysis of four major thrips vector

species from Pakistan and its comparison with globally reported thrips species.

Circles in haplotype tree show standard haplotypes with branch lengths that are

representative of connection distance. DNA barcoded sequences frequency of each

haplotype is indicated inside circle. Haplotype networks were generated using

minimum spanning network (MSN) values using Kimura 2P model with 1000

permutations. a) Thrips tabaci global haplotype network, b) Thrips palmi global

haplotype network, c) Scritothrips dorsalis global haplotype network and d) Thrips

flavus global haplotype network.

Supplementary Table 1: Process ID of sequences, Haplotype ID, Country of origin

and codes used for each accession in the haplotype analysis.


79

4.4 DISCUSSION

Molecular identification keys have been successfully used for species

determination (Mainali et al., 2008). A major limitation for using molecular

approaches for identification is the limited proportion of reference taxa that is

available. Using molecular identification techniques, incorrect identification of a

particular species could be possible if there is no representative species found in

reference database (Virgilio et al., 2010). In our study, 24 % of thrips species from

our collection were successfully identified based on the COI sequences data.

The effectiveness of DNA barcoding has facilitated development of DNA

barcode reference libraries for several animal groups (Guralnick and Hill, 2009;

Janzen et al., 2009; Zhou et al., 2011; Webb et al., 2012). For example non-biting

midges (Diptera: Chironomidae) could not be identified, even to their correct genus, if

well-matching COI sequence were not already available in the library (Ekrem et al.,

2007). Lee et al. (2011) used COI barcodes to identify the Aphid species from the

Korean Peninsula. These reference libraries aid in the documentation of biodiversity

(Janzen et al., 2005; Naro-Maciel et al., 2010) including endangered species (Elmeer

et al., 2012; Vanhaecke et al., 2012), to disclose endemism (Bossuyt et al., 2004;

Quilang et al., 2011; Sourakov and Zakharov, 2011; Ashfaq et al., 2013) and to

identify the unknow thrips species (Karimi et al., 2010; Kadrival et al., 2013).

The 471 barcode sequences in our study were assigned to 55 unique BINs

which signal the presence of a similar number of species in our collection. We were

able to identify 42 species by morphology and the identitification of the rest of the

specimens could not be validated. Additionally, 39 morphologically identified species

were congruent with the BINs.

Based on cluster analysis, all the morphologically identified species

considered in the current study formed distinct clades. Bayesian analysis further

supported the NJ analysis and the BINs. Results from Bayesian analysis and cluster

analysis in this study are in agreement with those from Crespi (1996) and Mound and

Morris (2007) that stated Frankliniella and Thrips species are associated by molecular

phylogenetic analysis of 18S rDNA using maximum parsimony (MP) and maximum

likelihood (ML) analysis. In present analysis species from genus Thrips did not

constitute a single cluster of closely related species.


80

DNA barcoding is known to resolve cryptic species complexes (Hebert et al.,

2004; Burns et al., 2007; Park et al., 2011; Deng et al., 2012; Ashfaq et al., 2014a)

and aid ecological studies (Valentini et al., 2009; Pramual and Kuvangkadilok, 2012;

Ashfaq et al., 2014b). For example, DNA barcodes revealed the cryptic species of

sphingid moths (Vaglia et al., 2008), while Nieukerken et al. (2012) discriminated

cryptic species of leaf-mining Lepidoptera. Likewise, sibling species of Aphis

gossypii was also discriminated using DNA barcodes (Carletto et al., 2009). In the

current study DNA barcodes revealed that A. intermedius, H. reuteri, T. palmi and T.

tabaci may be species complexes in Pakistan.

The gap between maximum intraspecific and minimum interspecific distances

has been used for species delimitation in various animal groups (Hebert et al., 2004;

Meyer and Paulay, 2005; Meier et al., 2006, 2008; Puillandre et al., 2012). Although

barcode gap analysis showed the intra-specific distances within the populations of A.

intermedius, H. reuteri, T. palmi, and T. tabaci were higher but the maximum

divergence was lower than the NN distance. This enabled the separation of all the

species including the most closely related species. Kadrival et al. (2013) has

suggested the S. dorsalis, T. palmi and T. tabaci may be cryptic species with intra-

specific distances ranging from 1 to 19%. Presence of cryptic species in T. tabaci

(Brunner et al., 2004) and S. dorsalis (Hoddle et al., 2008; Dickey et al., 2012) has

been previously reported. Karimi et al. (2010) has suggested that based on COI

sequences T. palmi falls into two clades. The intra-specific variations between A.

intermedius (3.61%) H. reuteri (3.68%), S. dorsalis (3.46%), T. flavus (4.58%), T.

palmi (7.47%) and T. tabaci (5.62%) suggest these species are complexes of multiple

lineages. Further comparisons of the COI-3' sequences from T. palmi and T. tabaci

with those retrieved from GenBank showed that the two clusters corresponded to each

thrips species from different locations. Morphological identifications of T. tabaci and

T. palmi based on the slide-mounted identification of voucher carcasses by running

the standard taxonomic keys and detailed study by scanning electron microscopy

showed these species lacked any unique visible morphological characters. Further

studies are needed to reveal the possibility of reproductive isolation of these species,

similar to the information available for F. occidentalis (Rugman-Jones et al., 2010).

Analysis of sequence diversity in COI-5' revealed that 15 haplotypes of T.

tabaci have been reported in the world until now. Diversity analysis also revealed the


81

presence of five haplotypes complex of T. tabaci in Pakistan and out of these three

haplotypes was restricted to Pakistan only. Pakistan shared one T. tabaci haplotype

with China, Canada, Australia, India, Madagascar, USA, UK, Norway and that there

may be possibility that the two Pakistani T. tabaci haplotypes originated from this

ancestor haplotype. Other T. tabaci haplotype shared with Serbia, Japan, Norway,

USA, Bosnia, Australia, and China. The one other most commonly found T. tabaci

lineage was shared by USA, Germany, Norway, Canada, Madagascar, UK, Bosnia,

Serbia but it was not found in Pakistan. This information could be helpful in studying

the diversity of vector species around the world and virus transmission efficiency of

different haplotypes as Wijkamp et al. (1995) and Chatzivassiliou et at. (2002) found

that different populations of T.tabaci showed different virus vector efficiencies. Two

haplotypes of T. palmi which were shared by India and Pakistan connected through

many nodes of missing haplotypes, and one of these haplotypes restricted to this

region only. While one major COI haplotype of T. palmi was shared by Pakistan,

China, United Kingdom, Japan, and Dominican Republic. Only one S. dorsalis

haplotype from Pakistan shared the network from India and rest of the S. dorsalis

haplotype from Pakistan were only restricted to the region. T. flavus haplotypes from

Pakistan were not shared with other parts of the world except for one shared with that

of China. In summary, this study represents one of the first attempts to use and apply

DNA barcoding to understand the species diversity of thrips at the molecular level in

Pakistan and should form a basis for further studies in this area.

Chapter 5 Iris yellow spot virus (Tospovirus)

82

Chapter 5

GLOBAL ANALYSIS OF POPULATION STRUCTURE, SPATIAL

AND TEMPORAL DYNAMICS OF GENETIC DIVERSITY, AND

EVOLUTIONARY LINEAGES OF IRIS YELLOW SPOT VIRUS

(TOSPOVIRUS: BUNYAVIRIDAE)

5.1 INTRODUCTION

5.1.1 Tospoviruses: Introduction and importance

Tospoviruses belong to the genus Tospovirus in the family Bunyaviridae.

Members of this genus are the only plant-infecting viruses in the family Bunyaviridae.

All other genera of this family include the animal-infecting virus genera such as

Hantavirus, Nairovirus, Orthobunyavirus, Phlebovirus (Fauquet et al., 2005).

Delineation of of tospoviruses to species level is based on the amino acid sequence

identity of the nucleocapsid protein (N) gene, host range and vector specificity (Pappu

et al., 2009). The genus Tospovirus comprises of more than 30 species reported from

different geographical regions of the world (Table 5.1, Fig. 5.1) (Pappu and Bag,

2014). The genus includes several economically important viruses including

Groundnut bud necrosis virus (GBNV), Impatiens necrotic spot virus (INSV), Iris

yellow spot virus (IYSV) and Tomato spotted wilt virus (TSWV) (Fauquet et al.,

2005; Pappu, 2008; Tsompana and Moyer, 2008; Pappu et al., 2009). Asia has the

widest tospovirus diversity (Pappu et al., 2009) and five tospoviruses, Capsicum

chlorosis virus (CaCV), Groundnut or peanut bud necrosis virus (GBNV), Iris yellow

spot virus (IYSV), Peanut yellow spot virus (PYSV) and Watermelon bud necrosis

virus (WBNV) were reported to be endemic in the Indian subcontinent (Mandal et al.,

2012). Groundnut bud necrosis virus (GBNV) occurs in farmer’s fields in Pakistan

based on ELISA surveys (Delfosse et al., 1995). TSWV is the most important virus


83

economically (Pappu et al., 2009). TSWV causes severe damage to many vegetables

and ornamentals worldwide (Best, 1968; Cho et al., 1987).

5.1.2 Genome organization

Tospoviruses are quasispherical (80-110 nm in diameter) enveloped particles. The

genome of tospovirus is characterized by three RNAs: large (L), medium (M), and

small (S) (Adkins, 2000; Goldbach and Peters, 1996; Moyer, 1999, 2000; Sherwood

et al., 2000). The negative sense L RNA, in virion-complementry sense codes for the

RNA dependent RNA polymerase (RdRp) (de Haan et al., 1991; Bag et al., 2010)

while M RNA and S RNA have ambisense genome organization (Adkins, 2000; Bag

et al., 2009b; Cortez et al., 2002; Moyer, 1999; Nichol et al., 2005; Pappu, 2008;

Tsompana and Moyer, 2008). M RNA in the viral sense codes for a non-structural

movement protein (NSm) and in the viral complementary sense codes for a

glycoprotein precursor (Bag et al., 2009a; Cortez et al., 2002). The S RNA codes for

one non-structural protein (NSs) and the nucleocapsid protein (N) (Cortes et al.,

1998). The genomic RNAs are tightly bound by the N protein and encapsulated in a

lipid envelope (Moyer, 1999, 2000; Sherwood et al., 2000). The complete genome of

several tospoviruses have been sequenced for genetic diversity studies and the

molecular characteristics of N gene were utilized in studying their genetic

relationships (de Avila et al., 1993 ; Nischwitz et al., 2007; Krauthausen et al., 2012;

Pappu et al., 2006).


84

Table 5.1: List of currently accepted and tentative tospovirus species

(http://ictvonline.org/virusTaxonomy.asp?bhcp=1) and the GenBank accessions

numbers used for comparisons

(Source: Pappu and Bag, 2014)

No. Species (Recognized-2013) Abbreviation S RNA

1 Groundnut bud necrosis virus GBNV U27809

2 Groundnut ringspot virus GRSV AF251271

3 Groundnut yellow spot virus GYSV AF013994

4 Impatiens necrotic spot virus INSV X66972

5 Polygonum ringspot virus PolRSV EF445397

6 Tomato chlorotic spot virus TCSV JX244198

7 Tomato spotted wilt virus TSWV AF020659

8 Watermelon silver mottle virus WSMoV U78734

9 Zucchini lethal chlorosis virus ZLCV AF067069

10 Alstroemeria necrotic streak virus ANSV GQ478668

11 Bean necrotic mosaic virus BeNMV JN587268

12 Callalily chlorotic spot virus CCSV AY867502

13 Capsicum chlorosis virus CaCV DQ355974

14 Chrysanthemum stem necrosis virus CSNV AB600873

15 Groundnut ringspot virus-USA GRSV-USA HQ644140

16 Gloxinia tospovirus GlaxRSV AF059578

17 Hippeastrum chlorotic ringspot virus HCRV JX833564

18 Iris yellow spot virus IYSV AF001387

19 Lisianthus necrotic ringspot virus LNRV AB852525

20 Melon yellow spot virus MYSV FJ386391

21 Melon severe mosaic virus MSMV EU275149

22 Pepper necrotic spot virus PNSV HE584762

23 Peanut chlorotic fan-spot virus PCFV AF080526

24 Physalis severe mottle virus PhySMV AF067151

25 Soybean vain necrosis virus SVNV GU722319

26 Tomato necrosis virus TNeV AY647437

27 Tomato necrotic ringspot virus TNRV FJ489600

28 Tomato yellow fruit ring virus TYFRV/TYRV DQ462163

29 Tomato zonate spot virus TZSV EF552433

30 Watermelon bud necrosis virus WBNV GU584184

http://ictvonline.org/virusTaxonomy.asp?bhcp=1


85


Figure 5.1: Phylogeny based on amino acid sequences of nucleocapsid protein of

known tospoviruses

GlaxRSV

TneV

CaCV

WSMoV

GBNV

WBNV

CCSV

TZSV

TNRV

MYSV

PhySMV

IYSV

TYRV

HCRV

PolRSV

BeNMV

SVNV

INSV

MSMV

ZLCV

CSNV

TSWV

GRSV

TCSV

ANSV

PNSV

GYSV

PCFV

LNRV

Bunyamwera

99

100

89 80

85

98

57

58

89

94

35

99

94

99

31

57

40

99

99

99

70

69

96 43

99

80

83

0.2


86


Figure 5.2: Schematic representation of the genome organization and replication

strategy of tospoviruses, showing the tree RNAs: Large (L), Medium (M) and

Small (S). The rectangular boxes indicate the proteins coded


87

5.1.3 Tospovirus transmission

Thrips are pests of both agricultural and horticultural crops directly and

indirectly cause the severe plant damage by transmitting some of the most important

plant viruses worldwide (Ullman et al., 2002). To date, 14 thrips species are reported

to be tospovirus vectors worldwide (Jones, 2005). WBNV is transmitted by Thrips

palmi, while IYSV is transmitted by T. tabaci (Singh and Krishna Reddy, 1996; Ravi

et al, 2006). TSWV is transmitted by F. occidentalis, F. fusca, F. schultzei, S.

dorsalis, T. palmi, T. setusus and T. tabaci (Moyer, 1999; Whitfield et al., 2005). T.

palmi Karni was reported to transmit GBNV in a persistent manner (Palmer et al.,

1990; Rangarao and Vijayalakshmi., 1993; Whiteman and Rao, 1994). In India,

GBNV (what was reported at that time as TSWV) was reported to be transmitted by

two thrips species F. schultzei Trybom and S. dorsalis (Ghanekar et al., 1979; Amin et

al., 1981).

A peculiarity of tospovirus transmission is that only those adult thrips can

transmit virus to other plants which acquire the virus in their nymph stage (Whitefield

et al., 2005). Tospovirus infection cycle starts when female adult thrips lay eggs on a

tospovirus infected plant and the larvae may acquire the virus and the virus is

transtadially passed through different larval stages to adult stage. For TSWV and

IYSV infected larvae, the median latent period was similar, and ranges from 80 to 170

h when they were kept at either 27°C or 20°C (Wijkamp et al., 1993). The adult may

remain viruliferous throughout its life, which may last for 20 to 40 days depending on

the environmental conditions. Virus transmission efficiency of each thrips species

varies greatly. For example, F. occidentalis transmits different tospovirus species

(GRNV, INSV, TCSV and TSWV) with variable efficiency (Wijkamp et al., 1993).

IYSV can be transmitted by two thrips species, F. fusca and T. tabaci with

considerably different efficiencies (Srinivasan et al., 2012). The tospovirus epidemics

can only occur when the biological entities involved in this pathosystem (thrips

vector, tospoviruses and the plant species, serving as hosts for both viruses and the

vector species) coincide in an appropriate environment (Ullman, 1996).


88

5.1.4 Iris yellow spot virus: Introduction and importance

IYSV is a distinct tospovirus species that infects Allium species and has

become an increasingly important constraint to the production of bulb and seed onions

in many onion growing regions around the world (Gent et al., 2006; Mandal et al.,

2012; Pappu et al., 2009; Turina et al., 2012). This is the most damaging disease of

onion crop reducing the bulb size of onion (Gent et al., 2004) and may cause the crop

loss upto 100% (Pozzer et al., 1999). First reports of IYSV came from Brazil in 1981

(de Avila et al., 1981), since then virus has begun to spread rapidly and started

appearing from many parts of the world. This viral disease was characterized by

symptoms of chlorotic and necrotic lesions with green island at the center, also called

diamond eye (Gent et al., 2006). Similar symptoms were observed in onion growing

regions of the Treasure Valley of Idaho and Oregon in the USA in 1989 (Hall et al.,

1993). These symptoms were referred to as “straw bleaching” (Gent et al., 2006).

IYSV was reported in the Netherland as a new tospovirus infecting iris (Iris

hollandica) from fields and in leek and named it as Iris yellow spot virus (Cortes et

al., 1998; Derks and Lemmers, 1996). IYSV is now reported from many other

contries of Asia, America, Australia and Europe where onion is a major crop (Pappu

et al., 2009; Mandal et al., 2012; turina et al., 2012). In addition to cultivatied onion

(Allium cepa), IYSV was also reported from wild onion A. altaicum, (Pappu et al.,

2006; Cramer et al., 2011) and other allium species as A. galanthum (Cramer et al.,

2011), A. porrum (Schwartz et al., 2007; Gent et al., 2007), A. pskemense (Pappu et

al., 2006), A. roylei (Cramer et al., 2011), A. sativum (Bag et al., 2009b), A.

schoenoprasum and A. tuberosum (Cramer et al., 2011) and A. vavilovii (Pappu et al.,

2006; Cramer et al., 2011). IYSV was also reported from other susceptible crops,

ornamentals and weeds that could be serving as potential reservoir sources of virus

inoculums. IYSV was reported from a number of weed hosts from Idaho (Sampangi et

al., 2007), on Atriplex micrantha and Setaria viridis from Utah (Evans et al., 2009 a,

b), in spiny sowthistle (Sonchus asper) from Georgia (Nischwitz et al., 2007) in the

USA. IYSV was reported from many countries around the world from twelve

different Allium and non-allium species (Table 5.2).


89

Table 5.2: List of Iris yellow spot virus (IYSV) isolates first reports from different

countries.

Host Common

Name

Location Year of first observed/Report of

IYSV

Allium cepa Onion Brazil 1994 (Pozzer et al., 1999)

Israel 1998 (Gera et al., 1998)

Japan 1999 (Kumar and Rawal, 1999)

Slovenia 2000 (Mavric and Ravnikar, 2000)

Italy 2003 (Cosmi et al., 2003)

Australia 2003 (Coutts et al., 2003)

Tunisia 2005 (Ben Moussa et al., 2005)

Spain 2005 (Cordoba-Selles et al., 2005)

Chile 2005 (Rosales et al., 2005)

India 2006 (Ravi et al., 2006)

Rèunion

Island

2006 (Robene-Soustrade et al.,

2006)

Peru 2006 (Mullis et al., 2006)

Guatemala 2006 (Nischwitz et al., 2007)

France 2007 (Huchette et al., 2008)

Canada 2007 (Hoepting et al., 2008)

Serbia 2007 (Bulajic et al., 2008)

South Africa 2007 (du Toit et al., 2007)

New Zealand 2007 (Ward et al., 2008)

Greece 2008 (Chatzivassiliou et al., 2009)

Mauritius 2010 (Lobin et al., 2010)

Uruguay 2010 (Colnago et al., 2010)

Mexico 2010 (Velasquez and Reveles,

2011)

Austria 2011 (Plenk and Groger, 2011)

Kenya 2011 (Birithia et al., 2011)

Uganda 2011 (Birithia et al., 2011)

Bosnia and

Herzegovina

2012 (Trkulja et al., 2013)

A.ampeloprasum Egyptian leek Egypt 2011 (Hafez et al., 2011)

A.cepa var.

ascalonicum

Shallot Rèunion

Island


2006)

A. galanthum Snowdrop

Onion

New Mexico 2010 (Cramer et al., 2011)

A. porrum Leek Australia 2003 (Coutts et al., 2003)

Rèunion

Island

2005 (Robene-Soustrade et

al., 2006)

Colorado 2006 (Schwartz et al., 2007)

Greece 2008 (Chatzivassiliou et al., 2009)

Sri Lanka 2009 (Widana Gamage et al.,

2010)

Germany 2010 (Krauthausen et al., 2012)


90

A. sativum Garlic Rèunion

Island


2006)

India 2010 (Gawande et al., 2010)

Egypt 2011 (Hafez et al., 2011)

Non-Allium Species

Alstroemeria sp. Alstroemeria Japan 2001 (Okuda and Hanada, 2001)

Bessera elegans Bessera Japan 2005 (Jones, 2005)

Clivia minata Clivia Japan 2005 (Jones, 2005)

Cycas sp. Cycad Iran 2005 (Ghotbi et al.,2005)

Eustoma

grandiflorum

Lisianthus Japan 2003 (Doi et al.,2003)

E. russellianum Lisianthus Israel 2000 (Kritzman et al.,2000)

Hippeastrum

hybridum

Amaryllis Israel 1998 (Gera et al.,1998)

Iris hollandica Iris The

Netherlands

1996 (Derks and Lemmers, 1996)

Pelargonium

hortorum

Geranium Iran 2005 (Ghotbi et al.,2005)

Petunia hybrida Petunia Iran 2005 (Ghotbi et al.,2005)

Portulaca sp. Purslane Italy 2003 (Cosmi et al.,2003)

Rosa sp. Rose Iran 2005 (Ghotbi et al.,2005)

Scindapsus sp. Pothos Iran 2005 (Ghotbi et al.,2005)

Vigna

unguiculata

Cowpea Iran 2005 (Ghotbi et al.,2005)


91

5.1.5 Importance of Onion in Pakistan

Onion (Allium cepa L.) is an important vegetable crop grown all over the

world and is one of the important constituents of daily dietary intake. Onion along

with garlic is rich in phosphorus, calcium and several antioxidant compounds,

polyphenols such as flavonoids and sulfur-containing compounds (Banerjee et al.,

2002; Block et al., 1997; Gorinstein et al., 2005; Horie et al., 1992; Ly et al., 2005;

Nuutila et al., 2003; Prasad et al., 1995; Suh et al., 1999; Yamasaki et al., 1994). It not

only adds taste and flavor to the food but also supplies active medicinal compounds

as ingredients that helps to ward off cataract and cardiovascular disease due to its

hypocholesterolemic, thrombolitic and antioxidant effects (Block, 1985; Block et al.,

1997; Nuutila et al., 2003; Vidyavati et al., 2010).

Major onion-growing areas of Pakistan include the district of D.G. Khan,

Gujranwala, Jhang, Kasur, Khaniwal, Sheikhupura, Vehari in the Punjab province;

Badin, Hyderabad, Mirpurkhas, Naushero Feroze, Sanghar, Sukkar in Sind province,

Swat in Khyber Pakhtonkawa and Chagi, Kalat, Khuzdar, Mastung and Turbat in

Balochistan province. According to the Food and Agricultural Organization, Pakistan

is the fifth largest onion producer in the World. The agro-ecological diversity in the

country enables production of onions almost around the year. Onion is susceptible to

numerous diseases caused by bacteria, fungi, viruses and nematodes (Schwartz and

Mohan, 2007). Onion thrips, T. tabaci Lindeman (Thysanoptera: Thripidae), is a key

pest of onion and related Allium spp. in all over the world and is an efficient vector of

Iris yellow spot virus (IYSV, Bunyaviridae: Tospovirus) (Gent et al., 2006; Pappu et

al., 2009). As a pest, T. tabaci causes damage to onion crop and can reduce its bulb

yields by >30–50% (Fournier et al., 1995; Rueda et al., 2007) and losses can be

compounded when T. tabaci infects the crop with IYSV since virus infection can

substantially reduce bulb yield (Gent et al., 2004). T. tabaci is widely distributed all

over Pakistan (Akram et al., 2003a) and is the predominant species found on onion in

Pakistan (Hazara et al., 1999a, b). Considering that T. tabaci, vector of IYSV, was the

predominant thrips species on onion, a survey was conducted to determine if IYSV

was present in these fields.

http://link.springer.com/article/10.1007%2Fs13197-011-0369-1/fulltext.html#CR12













92

5.1.6 Epidemiology of IYSV

IYSV presents an interesting case of epidemiological intrigue. In the US,

while the virus was reported in onion as early as in 1990s, it remained inconsequential

with respect to economic damage. However, since 2000, the virus was reported from

several states in the US and started to cause significant economic losses (Gent et al.,

2006; Pappu et al., 2009). Though tospoviruses continue to be production constraint

to several field and horticultural crops in many parts of the world, there is little or no

information on their occurrence in Pakistan. For this reason, surveys followed by

testing of various vegetable crops from thirteen districts of Punjab, Pakistan were

carried out to determine the presence of IYSV.

5.1.7 Assay, detection and diagnosis of Tospoviruses

Different methods used for identifying tospovirus infection include infectivity

assay, electron microscopic examination of infected samples, enzyme-linked

immunosorbent assay (ELISA), direct tissue-blot assay, dot blot immunoassay, PCR

(Mumford et al., 1996). For routine detection and surveys, ELISA has been the

method of choice for tospovirus detection and identification (Daughtrey et al., 1997).

Antisera specific to many of the individual tospoviruses are commercially available.

These antsiera were produce to the N protein of individual tospoviruses. Serveral

researchers reported the application of RT PCR and variations of it such as

Immunocapture (IC) PCR for tospovirus detection (Mumford et al., 1994). Molecular

methods including RT PCR and qPCR were developed and are being used for

tospovirus identification in plants and thrips (Pappu et al., 2008).

In thrips vector, the presence of non-structural protein, NSs, coded by the S

RNA suggests the virus replication in its vector and hence the viruliferous vector. Bag

et al. (2013) have been produced and used a specific and sensitive antibody to the NSs

of IYSV to detect the NS in T. tabaci. Using an ELISA-based assay and NSs-specific

antiserum, Bag et al. (2013) conducted studies on the seasonal dynamics of

trasnmistters along the field collected populations of adult T. tabaci.


93

5.1.8 Importance of this work

Keeping in view of the increasing importance of IYSV on a global sale, we

conducted surveys for IYSV symptomatic plant samples and T. tabaci collection from

the onion fields of Punjab province of Pakistan and characterization of these samples

for IYSV using molecular techniques. We recently reported the occurrence,

distribution and molecular characterization of IYSV from commercial onion crops

from Pakistan (Iftikhar et al., 2013). With increased incidence and economic impact,

research on IYSV was intensified and as a result characterization of IYSV isolates

was carried out with subsequent availability of several N gene sequences in GenBank.

We characterized IYSV at the molecular level in Alliums collected from several

countries (Huchette et al., 2008; Ward et al., 2008; Bag et al., 2009c; Sether et al.,

2010; Lobin et al., 2010; Iftikhar et al., 2013; Pappu and Rauf, 2013). With nearly 100

accessions of complete N gene sequences available in GenBank from more than 23

countries, IYSV N gene sequences now represent a large enough and diverse sample

for detailed genetic diversity studies on a global scale to better understand genetic

drift, population structure and evolutionary lineages of this important emerging viral

pathogen.

5.1.9 Objectives

1. To survey and collect isolates of IYSV and thrips vector species from predominant

onion growing areas of Punjab.

2. To diagnose Iris yellow spot virus by ELISA and RT-PCR.

3. To sequence the NP gene of IYSV.

4. To conduct genetic diversity studies of IYSV on a global scale to better understand

the genetic drift, population structure and evolutionary lineages of this important

emerging viral pathogen.


94

5.2 MATERIAL AND METHODS

5.2.1 Collection of thrips and plant samples for tospovirus studies

Vegetable plants found with symptoms associated with IYSV infection such as

spindle-shaped straw colored irregular chlorotic lesions on onion leaves were

collected from thirteen different districts of southern and northern Punjab in Pakistan

during 2012 within the latitude of 30.28 -31 degree to 71-73 degree longitude. Thrips

were also collected from the infected plants to test for tospoviruses. The samples were

catalogued and preserved at -80°C until further analysis. Details have been described

in section 2.2 and Table 2.1.

5.2.2 Enzyme-linked immune-sorbent assay (ELISA)

ELISA of thrips and plant samples were done using the protocol described in

the section 2.3.

5.2.3 Reverse-transcriptase polymerase chain reaction (RT-PCR)

Total RNA from the symptomatic, ELISA-positive leaf samples was extracted

using the RNeasy Plant Mini kit (Qiagen, Maryland, USA) following the

manufacturer’s instructions. First strand complementary DNA (cDNA) synthesis was

done using SuperScript II reverse transcriptase (Invitrogen, Carlsbad, USA) and IYSV

N gene was amplified using forward primer 5’-CTCTTAAACACATTTAACA

AGCAC-3’ and reverse primer 5’-TAAAACAAACATTCA- AACAA-3’ flanking the

nucleocapsid (N) gene encoded by the small RNA of IYSV. Amplified IYSV N gene

fragments were cloned in pGEM-T easy vector (Promega, Madison, USA) and

sequenced at ELIM Biopharma (Hayward, USA). At least two clones for each isolate

were sequenced. Sequences of IYSV N gene obtained from the samples derived from

Pakistan and the USA were annotated and compared to available IYSV N gene

sequences. Complete N gene sequences of various IYSV isolates reported across the

globe were retrieved from the GenBank for comparative analysis.


95

5.2.4 Sequence annotation and analysis

Sequence alignment and phylogenetic trees were generated using MEGA 6

(Tamura et al., 2013). The phylogenetic tree was constructed using the neighbor

joining method (default parameters with 2000 replicates in the bootstrap analysis). To

study nucleotide diversity and DNA polymorphism, DnaSP (Librado and Rozas,

2009) was used. The analysis included quantifying the levels of DNA polymorphism

such as the number of haplotypes and haplotype diversity in order to analyze the

distribution pattern of DNA variation, or to compare alternative evolutionary

scenarios.

5.2.5 In silico RFLP Analysis of the nucleoprotein gene

Complete N gene sequences (ORFs) available in GenBank, NCBI, were

analyzed for in silico RFLP pattern. The RFLP simulation of N gene was carried out

using Restriction Mapper Version3 (http://www.restrictionmapper.org/) to perform

virtual digest of the gene and to map the sites recognized by restriction enzyme Hinf1

(Zen et al., 2005). IYSV isolates could be grouped into IYSV Netherlands (IYSVNL)

or IYSV Brazil (IYSVBR) types (Pozzer et al., 1999) based on Hinf1 digestion. Those

that did not conform to either genotype were considered as “IYSVother”.

5.2.6 Temporal analysis of IYSV genotype distribution

IYSV genotypes were analyzed for the temporal shift in two time periods that

were arbitrarily chosen- those reported before 2005 and after 2005. The year 2005

bifurcates the periods of study (1997-2013) in to two equal halves (1997-2005 and

2006-2013). For the temporal analysis of IYSV genotypes, date of collection of

sample was considered wherever available; otherwise date of submission to GenBank

was taken for the analysis of temporal study of population based on in silico RFLP.

5.2.7 Recombination detection Analysis

Potential recombination events were detected by Recombination Detection

Program-4 (RDP 4 Beta 4.16) (Martin et al., 2010). All the complete N-gene

sequences available in GenBank were used in the analysis and the sequence alignment

http://www.restrictionmapper.org/


96

was carried out using Bio-edit sequence alignment editor software (Hall, 1999) and

the aligned sequences were used for recombination detection studies. For identifying

recombination events, step-down correction with the highest acceptable p-value

setting of 0.05 was used along with other default settings for all of nine methods

(RDP, Chimaera, BootScan, 3Seq, GENECONV, MaxChi, SiScan and LARD,

PhylPro) available in the RDP 4 (Martin et al., 2010).

5.2.8 Population selection studies and neutrality tests

Codon-based maximum likelihood methods including SLAC (single like

ancestor counting), FEL (fixed effects likelihood), and REL (random effects

likelihood) were used to calculate the mean rates of non-synonymous (dN) and

synonymous substitutions (dS). The dN/dS ratio in every codon in the alignment was

calculated in order to estimate the selection pressure on the N gene belonging to

various genotypes like IYSVBR, IYSVNL and IYSVother using DATAMONKEY server

(http://www.datamonkey.org). To test the theory of neutral evolution test statistics

like Tajimas’s D (Tajima, 1989), Fu & Li’s D and Fu & Li’s F (Fu and Li, 1993; Fu,

1997) were determined employing DnaSP software.

5.2.9 Genetic differentiation and gene flow estimates

In order to estimate genetic differentiation within the populations of IYSV

genotypes, nucleotide test statistics such as Ks, Kst and Snn (Hudson, 2000) and

haplotype statistics such as Hs and Hst (Hudson et al., 1992a) were computed using

DnaSP. The software was further used to study the extent of gene flow between the

IYSV populations by estimating statistic Fst (Hudson et al., 1992b).

5.3 RESULTS

5.3.1 Symptomatology

Symptoms in commercial onion fields surveyed included spindle-shaped

straw-colored irregular chlorotic lesions, necrotic to hay-coloured spots, long yellow

stripes (Fig. 5.3). Symptoms were found on both onion seed and bulb crops.

Symptomatic plants were predominantly noticed in Faisalabad, Gujranwala, Nankana,

http://www.datamonkey.org/


97

and Sheikhupura districts in Pakistan. IYSV infection was confirmed by ELISA. Out

of 13 districts, samples from 5 districts, Faisalabad, Gujranwala, Nankana, Sargodha

and Sheikhupura was found positive. Viral genome from samples from two of these

districts (Faisalabad and Nankana) were cloned and sequenced. Virus isolates were

transferred to and maintained in indicator hosts, Datura stramonium and Nicotiana

benthamaiana by mechanical inoculation.

5.3.2 Enzyme-linked immune-sorbent assay (ELISA) for IYSV

Iris yellow spot virus affected onion samples showing different types of IYSV

symptoms collected from different regions of Punjab province. Plant leaves and stems

were tested for the virus. Fifty-two samples from Pakistan (Table 2.1) and five

samples collected from US were tested by DAS-ELISA for the presence of IYSV. The

absorbance values (optical density (OD)) showed that only five samples from

Pakistan and all five from the USA reacted positive to IYSV-NP specific antiserum

with varied degree of serological affinities. The symptoms considered similar to IYSV

were found to be negative in ELISA for most of the samples from Pakistan. The

highest absorbance (2.480OD to 3.500OD) was observed in samples from Faisalabad,

Jaranwala, Nankana and Sheikhupura districts.

In the present study, thrips from family Thripidae were also collected from the

suspected IYSV diseased fields along with the plant samples. Thrips in the collection

were morphologically identified to T. tabaci and individual specimens were tested

against IYSV-NS antiserum by DAC-ELISA. Thrips from Faisalabad, Jaranwala,

Lahore, Nankana and Sheikhupura districts were deemed positive with absorbance

values ranging from 1.782OD to 3.500OD. Vector thrips from IYSV infected fields

showed positive for IYSV.

5.3.3 Molecular characterization

Samples from plants with IYSV-like symptoms that failed to react to the

antisera give a positive test by RT-PCR. The IYSV N gene was cloned and sequenced

from two isolates from the Punjab province of Pakistan and 5 isolates collected from

the USA in 2012 (Fig. 5.4).The N gene of these isolates was 822 nt long and


98

potentially coded for a 273-amino acid protein. Sequences of N gene reported in this

study were submitted to GenBank (KF171103, KF171104, KF171105 from Pakistan,

and JQ973065, KF263484, KF263485, KF263486 and KF263487 from the USA.


99

Figure 5.3: Plant samples showing the IYSV specific symptoms

Figure 5.4: PCR amplification of IYSV N gene (1100bp)


100

5.3.4 Restriction fragment length polymorphism

The in silico RFLP of N gene was carried out to determine the relative

distribution of the two previously described IYSV genotypes, their distribution pattern

across the geographic regions, hosts and over a 20 year time period. The restriction

enzyme Hinf1 was found to delineate IYSV N gene sequences into two genotypes:

Netherlands (IYSVNL) and Brazil (IYSVBR) based on the RFLP pattern. Hinf1

revealed 6 different types of restriction pattern. The frequency of the restriction site in

the known N gene sequences varied from four to nine. Two thirds of the sequences

had five to seven HinfI site (67 accessions out of 98). HinfI produces two digestion

products, 486 bp and 308 bp and differentiates the N gene into IYSVNL and IYSVBR,

respectively. The Hinf1 restriction pattern of N gene divided the 98 accessions almost

equally (46% as NL and 48% as BR) and the remaining 6% of the accessions could

not be placed in either category and were considered IYSVother (Fig. 5.5).

The geographical distribution of IYSV genotypes was assessed and the Asian

isolates were predominantly of IYSVBR (72%) genotype, while 21% of the accessions

belonged to IYSVNL. Interestingly, isolates reported from North America were

predominantly of the IYSVNL type (Fig. 5.5). Also of interest was, IYSV genotypes

generally were confirmed in their incidence to a particular geographic region for

example, IYSVBR genotypes were reported only from Asia but not from Europe.

Similarly the isolates that did not belong to either genotype (IYSVother) were reported

only from Asia and Europe (Fig. 5.6).

Among the hosts from which the various isolates were reported, onion (A.

cepa) was the most commonly reported host of IYSV, while other crops included

Allium tuberosum, Allium sativum, Allium ampeloprasum, and Eustoma russellianum

(Fig. 5.7). Among the isolates characterized from infected onions, the relative

incidence of NL and BR types was about equal: 45% IYSVBR and 47% IYSVNL.


101

Figure 5.5: Genotyping of IYSV accessions based on in silico RFLP simulation of

nucleocapsid (N) gene (percentage of accessions under various genotypes)

Figure 5.6: Geographical distribution of various IYSV genotypes


102

Figure 5.7: Host distribution of various IYSV genotypes

0 5

10 15 20 25 30 35 40 45

IYSV BR

IYSVNL

Others


103

5.3.5 Sequence diversity, DNA polymorphism and phylogeny of the N gene

The N gene sequences generated during this study and all the available

complete N gene sequences in GenBank were used for determining the genetic

diversity, polymorphism and phylogenetic analysis. Nucleotide diversity (π) of

IYSVBR was slightly higher than that for IYSVNL (0.04194 and 0.03133, respectively).

However it was notably higher in IYSVother N gene sequences (0.08297) (Table 5.3)

suggesting that IYSVother is more diverse than the IYSVNL and IYSVBR as number of

polymorphic sites (S) of IYSVother genotype are 136 in 6 isolates (Table 5.3).

The phylogenetic tree based on the N gene sequences showed clustering of

IYSV genotypes into two distinct nodes one each representing IYSVBR and IYSVNL

(Fig 5.8) with a few exceptions. The type isolate of IYSVBR (AF067070) is found in

the IYSVNL node. All IYSVBR genotypes grouped together, while three NL genotypes

(AF271219, AM900393 and AF001387) also grouped with the IYSVBR. Four among

the six isolates that belonged to IYSVother also grouped with IYSVBR (Fig. 5.8).

The nucleotide sequence identity studies revealed that the three isolates from

Pakistan reported here (KF171104, KF171103, KF171105) had 99% sequence

identity with an isolate from Chile (DQ150107), whereas two of the Pakistan isolates

(KF171104, KF171103) exhibited 99% identity with USA isolates (KF263486,

JQ973065) while one isolate (KF171105) showed 98.7% sequence identity with both

the USA isolates. The isolates from Pakistan (KF171104 and KF171103) also showed

98.9% sequence identity with another isolate from USA (KF263487). The isolates

reported from Washington State, USA (KF263486) showed 100% identity with an

IYSV isolate of Japan (AB180921). Other IYSV isolates from different states of USA

including JQ973065, KF263487, KF263485, KF263484 showed 99.7%, 99.8%,

99.3% and 99.6% sequence identity with a Japanese isolate (AB180921), respectively.


104

Figure 5.8: Phylogenetic

tree of nucleotide

sequences of the

nucleocapsid gene of

IYSV isolates available

in GenBank. The

percentages of replicate

trees in which the

associated taxa clustered

together in the bootstrap

test are shown next to the

branches. Each IYSV

isolates are indicated by its

GenBank accession

number, place of origin

and host.


105

Table 5.3: Genetic diversity of the nucleocapsid gene in various IYSV genotypes and

the population as a whole

Genotype N S π Hd

IYSV NL 44 117 0.03133 0.996

IYSV BR 47 232 0.04194 0.998

IYSV other 6 136 0.08297 1.000

IYSVAll 97 319 0.07712 0.999

N, number of isolates; S, number of polymorphic (segregating) sites; Hd, haplotype

diversity; π, nucleotide diversity within species. IYSV Netherlands (IYSVNL); IYSV

Brazil (IYSVBR); IYSV that belong to neither genotype (IYSVother); entire IYSV

population (IYSVall


106

5.3.6 Temporal shift in IYSV Genotype

Analysis of available sequences was carried out to determine if there was a

potential temporal shift in the IYSV genotypes. For this study, two time periods,

before 2005 and after 2005 were arbitrarily selected. It was found that prior to 2005,

the relative proportion of IYSVNL was higher compared to IYSVBR. However, after

2006 the reversal was seen with a greater percentage of IYSVBR (Fig. 5.9a). Prior to

2005, no IYSVother genotype was observed. Interestingly, however, more of the ‘other’

genotypes were reported post-2005. One noteworthy observation from the temporal

studies was the three-fold increase in IYSVBR between the two periods (before and

after 2005), whereas for the same period, IYSVNL genotypes had a two-fold increase

(Fig. 5.9b).

5.3.7 Recombination detection

One potential recombination event was identified by RDP. The recombination

event was detected by SiScan and 3Seq methodologies of RDP and could be of

evolutionary significance. IYSV infecting Allium in Brazil, the type isolate for

IYSVBR genotype appears to be a recombinant in this event. However, only one

parent could be identified-the onion-infecting IYSV isolate from USA, (DQ233478)

which is an IYSV NL genotype and the other recombination break point could not be

identified even though 3Seq identified an onion isolate from Australia (AY345227) as

another potential parent (Fig. 5.10). IYSVBR might have been potentially generated

from IYSVNL through recombination.


107

a)

b)

Figure 5.9: Temporal shift in genotypes of IYSV

a) IYSV Genotypes reported during the period (1997-2005)

b) IYSV Genotypes reported during the period (2006-2013)

15

12

0

IYSV genotypes reported during the period

(1997-2005)

NL

BR

Others

30

35

6

IYSV genotypes reported during the period

(2006-2013)

NL

BR

Others


108

Figure 5.10: Recombination events within N gene of various accessions as

detected by RDP v4. Recombinant AF067070-Brazil-Allium cepa type isolate of

IYSVBR genotype is a product of recombination involving DQ233478-USA- Allium

cepa as the minor parent. Though the start break-point could not be identified with

certainty, RDP detected nucleotide positions 1-44 as a probable break-point with

accession AY345227-Australia-Allium cepa as a possible major parent.


109

Table 5.4: Summary of codon substitution studies in nucleocapsid gene of IYSV

genotypes

a-codons identified by SLAC at a cut off p-value 0.1; b-codons identified by FEL at a

cut off p-value 0.1; c-codons identified by REL at a cut off Bayes factor value 50

dN, the number of non-synonymous substitutions per non-synonymous site; dS, the

number of synonymous substitutions per synonymous site

ω - ratio of dN/dS from SLAC (single like ancestor counting) methodology,

dN-dS obtained from REL (random effects likelihood)

Genotype Positively

selected codon

positions

Amino acid

substitutions

No. of

negatively

selected codons

ω=dN/dS dN-dS

IYSVNL 139b Asp-Asn

Asp-ser

Asp-Val

15a

59b

105c

0.197 -0.797

IYSVBR 139b Ser-Thr

Ser-Asp

25a

66b

0.198 -0.817

IYSVother 270c - 3

a

39b

0.171 -0.810

IYSV All 109b

Leu-Ile

Ile-Phe

52a

90b

0.214 -

139a&b

Asp-Asn

Asp-ser

Asp-Val

Ser-Thr

Ser-Asp


110

5.3.8 Population selection and test of neutrality

Population selection studies provide a list of gene codons in an alignment that

are under positive or negative selection pressure and thus could shed light on the

molecular evolution patterns in the N gene. The mean dN/dS (dN-rate of non

synonymous substitutions and dS-rate of synonymous substitutions) for N gene

accessions belonging to the BR genotype were found to be 0.198 and did not have a

single positively selected codon site. However, 25 negatively selected codon sites

were identified using SLAC methodology (Table 5.4). The same data set when

analyzed by FEL, revealed one positively selected codon site (codon no. 139:

AGC/ACC) against 66 negatively selected sites. The mean difference between dN and

dS (dN-dS) for the N gene sequences belonging to the BR genotypes based on REL

analysis was found to be -0.817 suggesting that all the codon sites are under purifying

selection acting against deleterious non-synonymous substitutions (Table 5.4).

Similarly, the mean dN/dS of N-gene sequences of NL genotype was found to

be 0.197and the data set did not reveal any positively selected codons. However, 15

negatively selected codon sites were identified from SLAC analysis. The same data

set when analyzed by FEL revealed a positively selected codon site (GAC) at the

same place where BR genotypes also exhibited positive selection, along with 59

negatively selected codon sites. The dN-dS for the N gene sequences belonging to NL

genotypes based on REL analysis were found to be -0.797. REL analysis also did not

identify any positively selected codon sites as against 105 negatively selected sites.

The mean dN/dS for sequence accessions belonging to neither BR nor NL genotypes

was found to be 0.171 with 3 negatively selected codon sites and not a single

positively selected site have been identified by SLAC. Similarly, FEL analysis

revealed 39 negatively selected codon sites. The dN-dS was revealed to be -0.810,

with one positively selected site (codon 270). Taken together, the results revealed that

the codons were generally negatively selected except codon sites (codon no. 139) both

in IYSVBR (AGC/ACC) and IYSVNL (GAC) and codon 270 (GAC) in IYSVother

which was found to be positively selected in both virus genotypes. Thus, positive

selection of codons (at codon positions 139 and 270) indicates that the replacement

substitutions increase the fitness of the N protein codon 139 (AGC/ACC/ GAC) and


111

270 (GAC) in the IYSV population. Negative selection functioning at other sites tends

to remove such substitutions from the N gene. Further, the number of negatively

selected codon sites in BR is higher than in NL genotypes based on SLAC analysis,

suggesting the dominant influence of purifying selection in IYSVBR genotype

compared with IYSV NL.

The population statistic parameters, however, revealed no significant

differences between the two genotypes and the overall population. The statistically

significant and insignificant negative values of Tajima’s D in IYSVBR and IYSVNL,

respectively, suggest the dominance of purifying selection and population expansion

operating in those genotypes (Table 5.5). The test statistic Fu and Li’s D and F also

revealed the same characteristic feature for the IYSVBR and IYSVNL genotypes

underlining the principle of operation of purifying selection and population size

expansion. The statistically significant negative value of Fu’s F further strongly

denotes the expansion observed in IYSVBR population. IYSVother genotype revealed

positive values for both statistical parameters Tajimas’s D and Fu &Li’s D suggesting

a decrease in population size and balancing selection.

5.3.9 Genetic differentiation

The inherent genetic differentiation between the IYSV genotypes was

evaluated by estimating both haplotype-based statistic (Hs and Hst) and nucleotide-

based statistic (Ks, Kst, Snn) (Table 5.6). The statistically significant test values for

Ks, Kst and Z obtained when IYSV populations were compared among themselves

revealed the existence of strong genetic differentiation. Despite the insignificant test

statistical value (Snn) obtained in comparison studies, its value close to one denotes

the genetic differentiation between the IYSV genotypes. The parameter values for Kst

in the comparisons also revealed that IYSVBR is relatively least differentiated from

IYSVother (Kst value of 0.01838*) compared with IYSVNL genotypes (Kst value of

0.06260*). The computed Fst value of 0.68 between IYSVBR and IYSVNL population

indicates restricted gene flow between the populations thus sharing of genetic

information between these two populations is infrequent. While IYSVNL exhibited a

moderate gene flow with IYSVother, IYSVBR exhibited relatively unrestricted gene

flow with IYSVother.


112

Table 5.5: Summary of Neutrality tests in IYSV population

Genotypes Tajimas’s D Fu &Li’s D Fu &Li’s F

IYSVBR -1.47873 -360071** -3.35619**

IYSVNL -1.58197 -0.81168 -1.30718

IYSVother 0.57659 0.87044 -0.88804

Table 5.6: Genetic differentiation and gene flow of the nucleocapsid gene between

different IYSV genotypes

Genotypes Hs Hst χ2 P

value

Kt Ks Kst Snn Z Fst

IYSVBR vs

IYSVNL

0.99700 0.00154 91.000 0.3083 62.97485 3.12600* 0.18548* 0.98901 6.65663* 0.68268

IYSVBR vs IYSVother

0.99830 0.00025 53.000 0.3592 39.69303 3.39689* 0.01838* 0.92453 6.15872* 0.11744

IYSVNL vs

IYSVother

0.99614 0.00060 50.000 0.3175 36.92490 2.98441* 0.06260* 0.98000 5.96030* 0.37528

Hs, Hst: Haplotype based statistic to estimate genetic differentiation

Ks, Kst, Snn, Z: Nucleotide based test statistic to estimate the genetic differentiation

(Kst value close to zero indicates no differentiation; Snn value close to one indicates

differentiation)

Fst: Statistic estimates the extent of gene flow between various genotypes (Value close

to zero indicates free gene flow or panmixis value close to one indicates genotypic

groups are closed to gene flow)


113

5.4 DISCUSSION

Fifty-two IYSV symptomatic plant samples from Pakistan were tested for

reactivity with IYSV-NP antiserum but only few of them were found positive for

IYSV. The symptoms considered similar to IYSV were found to be negative in

ELISA. IYSV as a viral species imply wide diversity which complicates the virus

detection through serological tests. It is noted that some available serological tools

were not optimally recognized some IYSV isolates from southern Europe (Hallwass

et al., 2012) and this is also shown in our serological analysis as we used the kit which

was based on IYSV isolate of Germany for serological diagnostics and it gave very

weak interaction with IYSV isolates from Pakistan. Different behavior in DAS-

ELISA was noted for different IYSV isolates with various detection kits and these

differences were confirmed by phylogenetic analysis (Hallwass et al., 2012).

IYSV is a major constraint to onion production in many onion-growing

regions of the world. Economic loss due to IYSV infection varies with climate,

production practices, vector thrips populations, onion cultivars and virus strains.

Diverse IYSV symptoms in onion under field conditions are suggested due to

existence of different strains of IYSV or the symptom expression may be affected by

time of infection, age of plants, environmental and stress factors and difference in the

genetic makeup of cultivars (Bag et al., 2012). Knowledge on the population

diversity, spatial and temporal dynamics of IYSV population could be useful in

designing appropriate disease control measures. A previous study showed that IYSV

isolates from some western US states grouped distinctly from those from other parts

of world including Australia, Brazil, Japan, and the Netherlands (Pappu et al., 2006).

Similarly, phylogenetic analysis of N gene from IYSV isolates prevalent in Georgia,

USA and Peru revealed that they are related to one another and divergent from those

reported from the western states of the US. This study suggested that the gene flow

occurred from Peru into Georgia, USA as the former region is known to have IYSV

infection even before its detection in Georgia (Nischwitz et al., 2007).

Computational RFLP simulation studies revealed the categorization of IYSV

genotypes into two groups, IYSVBR and IYSVNL. Interestingly, all the known N gene

accessions were grouped about equally into the two genotype groups. However, a few


114

accessions fell into neither category. Interestingly, the IYSVothes genotype was

reported only from Asia and Europe. The plausible role for recombination in the

evolution of IYSVother genotypes could not be disregarded as it tends to rearrange the

genomic regions leading to genetic diversity. Considering the relatively short stretch

of sequence (822nt encoding 273 aminoacids) that was used for identifying potential

recombination events, it was surprising to see even one such event might have taken

place as RDP showed one possible recombination event. The recombination event

involving IYSVNL and IYSVBR is evolutionarily significant as it could have been the

basis for the evolution of the BR from the NL genotype.

The population selection study identified few positively selected codons in the

N gene population as a whole or within the genotypes [codon position 139

(AGC/ACC/ GAC) in all genotypes and overall population), 270 (GAC) in IYSVother)

and 102 (ATT/CTT) in overall population] (Table 5.4). Among the codons of N gene

analyzed as a whole population, 19% of the codon positions were identified to be

negatively selected by SLAC methodology (Table 5.4), whereas 33% of the codon

positions were detected to be negatively selected in FEL methodology. This moderate

level of negative selection of codons operating in N gene population denotes the

action of purifying selection within the IYSV population. The role of positive

selection in amino acid codons have been ascribed to the ability of Tomato spotted

wilt virus (TSWV) to break the host resistance against gene Sw-5 in tomato (Sundaraj

et al., 2014). On the similar lines, the role of negatively selected amino acid codons in

functional properties and their importance to virus survival have been discussed in

case of Tomato mosaic virus (Rangel et al., 2011) and to a lesser extent in Fig mosaic

virus (FMV) (Walia et al., 2014). However most of the N gene amino acid codons are

free from any selection hence they evolve neutrally. This neutral mode of evolution

observed in IYSV population has also been previously observed with the population

of Cucumber mosaic virus (Davino et al., 2012). Findings from our genetic

differentiation studies are in accordance with the phylogenetic analysis of N gene

sequences of various IYSV isolates, wherein IYSVBR and IYSV NL genotypes formed

two distinct groups. The genetic differentiation and the absence of gene flow between

IYSVBR and IYSVNL is also further corroborated from the geographical confinement

of these genotypes as North America had predominantly the NL genotype, whereas


115

Asia had the BR genotype. The relatively frequent gene flow between IYSVBR and

IYSVother when compared with IYSVNL further explains the presence of IYSVother in

Asia and Europe only. In summary, a global analysis of IYSV N gene sequences

revealed important characteristics of the virus population structure, spatial and

temporal distribution patterns and provided insights into the evolution of the virus.

IYSV reduces the bulb size, seed yield and quality of onion crop. Plants also

get more susceptible to other pests and diseases due to the IYSV infection. An

economic loss of IYSV varies with differences in climate, vector thrips populations,

onion cultivars and virus strains. Keeping in view the significance of onion bulb and

seed crops in Pakistan and consequences of IYSV attack on this crop, a more

extensive survey of onion-producing areas should be established giving the particular

attention to the presence of viruliferous thrips and possible alternate hosts of t. tabaci.

Chapter 6 General Discussion

116

Chapter 6

GENARAL DISCUSSION

Thrips (Thysanoptera) are small insects which feed on different plant parts.

Besides being crop pests, thrips transmit several plant viruses in the genus Tospovirus.

Members of Thysanoptera are widely distributed throughout Pakistan on field and

horticultural crops and weeds. Their small size and inconspicuous morphological

characters limit their rapid and accurate identification.

Previous studies have shown that the number of thrips species in Pakistan

ranges from 45-63 (Akram et al., 2002, 2003a, b; Saeed and Yousaf, 1994; Saeed et

al., 1994). All these studies relied on morphological characters for the species

identification. However, morphological identification of thrips is not only difficult but

in the absence of elaborative keys, can be misleading, particularly identification of the

immature stages pose a special challenge. The current study was undertaken keeping

in view the importance of thrips and a lack of comprehensive studies on thrips

diversity in Pakistan. The current study identified 41 morphological species from 158

sites in Pakistan. This included 12 species from 5 genera of the suborder Tubulifera

and 29 species from 17 genera of the suborder Terebrantia. Among them, one species

(Apterygothrips pellucidus Ananthakrishnan) from Tubulifera and seven

(Chaetanaphothrips orchidii Moulton, Chirothrips meridionalis Bagnall,

Megalurothrips usitatus Bagnall, Megalurothrips distalis Karny, Neohydatothrips

samayunkur Kudo, Taeniothrips major Bagnall, Thrips trehernei Priesner) from

Terebrantia were first reports from Pakistan. Additionally four genera

(Apterygothrips, Chaetanaphothrips, Neohydatothrips, Taeniothrips) represented in

this collection were also first records from this region. This point towards

undiscovered fauna of thrips in the region and existence of potential species still need

to be described. More detailed and regular survys need to be carried out in order to

obtain a complete picture of the thrips diversity. Some of the previous reports on

thrips species in the region are contradictory as morphological character based


117

reliable taxonomic keys are not available to researchers for different regions of the

world. Moreover, inadequate exposure of the revised keys for the new species or

endemic species creates challenges for taxonomists. The use of molecular data for

insect species identification has certain advantages over the morphological keys for

resolving the species status with more confidence. The use of mitochondrial COI-5ʹ

(DNA barcode) for the species identification and genetic diversity analysis in animals

has been very effective. Hence barcoding was employed as a molecular tool for

determining the sequence characteristics and variation among thrips from Pakistan.

The Barcode Index Number (BIN) system assigned the 469 sequences to 53

BINs. The recursive partition by Automatic Barcode Gap Discovery (ABGD) also

revealed the presence of 53 groups. Sequence analysis revealed that the intraspecific

and interspecific distances ranged from 0.0% to 7.5% and 2.3% to 22.3%,

respectively. The NJ dendrograms and Bayesian phylogenetic inference supported the

presence of 54 monophyletic lineages. Revelation of a higher number of BINs as

against the number of morphological species identified in the collection points

towards existence of cryptic species. Four of the major pest species in the region, A.

intermedius, H. reuteri, T. palmi and T. tabaci were each comprised of two divergent

lineages indicating their status of species complexes. The DNA barcodes successfully

discriminated thrips to their morphological species. The study compiles the first

barcode reference library for thrips from Pakistan and connects regional lineages of

four important pest and virus-vectors with those from other countries by haplotype

networks.

Onion (Allium cepa L.) is an important vegetable crop in Pakistan and the

agro-ecological diversity in the country enables production of onions almost round the

year. According to the Food and Agricultural Organization (FAO), Pakistan is the

world’s fifth largest onion producer. While onion is known to be infected with a wide

range of viruses belonging to Potyvirus, carlavirus and tospovirus groups, little or no

information is available about the virus status on onions in Pakistan. Tospoviruses are

becoming increasingly important in many parts of the world and thrips-transmitted

Iris yellow spot virus (IYSV, family Bunyaviridae, genus Tospovirus) has become an

important constraint to production of Allium crops worldwide. IYSV is transmitted by


118

T. tabaci and considering the high prevalence of T. tabaci in onion fields, surveyed

the onion bulb and seed crops for IYSV during March to May 2012. Onion plants

showing symptoms suspected to be caused by IYSV were found in farmers’ fields in

Faisalabad, Nankana, Sheikhupura, and Sialkot districts of Punjab. Approximately

60% of the fields surveyed had about 30% of the plants with IYSV symptoms that

included spindle-shaped, straw colored irregular chlorotic lesions with occasional

green islands on the leaves (Gent et al., 2006; Hall et al., 1993). The presence of

IYSV infection was confirmed first by ELISA and was verified by sequencing the

RT-PCR amplified N gene fragment. This is the first report of IYSV infecting onion

in Pakistan. Systematic and more extensive surveys are needed to assess the incidence

and impact of IYSV on onion bulb and seed crops in Pakistan so that appropriate

management tactics could be developed.

Following the identification of genetic characterization of IYSV from

Pakistan, a global genetic analysis of known IYSV nucleocapsid gene (N gene)

sequences was carried out to determine the comparative population structure, spatial

and temporal dynamics with reference to its genetic diversity and evolution. A total of

98 complete N gene sequences in GenBank from 23 countries were characterized by

in silico RFLP analysis. Based on RFLP, 94% of the isolates could be grouped into

NL or BR types while the rest belonged to neither group. The relative proportion of

NL and BR types was 46% and 48%, respectively. A temporal shift in the IYSV

genotypes with a greater incremental incidence of IYSVBR was found over IYSVNL

before 2005 compared to after 2005. The virus population had at least one

evolutionarily significant recombination event, involving IYSVBR and IYSVNL.

Codon substitution studies did not identify any significant differences among the

genotypes of IYSV. Similar studies on additional IYSV isolates from different parts

of the country could provide a better picture of the genetic diversity of IYSV in

Pakistan. RFLP of N gene would facilitate rapid identification of field-collected

isolates and grouping into one of the three groups.

Findings from the current study provided important information on thrips and

virus diversity at the molecular level and could provide a foundation to further expand


119

these studies to generate a more comprehensive database. Information gained will be

useful in practical applications for developing thrips and virus management strategies.

RECOMMENDATIONS/ FUTURE WORK

During the past few years, thrips studies were focused on the pest thrips only

that was useful for agricultural entomologists but not for the students and researchers

who want to fully explore the thrips fauna in the region. Biological diversity of thrips

and there interaction with other organisms on field crops should be studied.

During the current study 53 thrips species were barcoded. These results

provide some information on thysanoptera fauna of Pakistan with support of existing

classification but clearly far more information is still needed to explore the highly

diverse thrips fauna from this area. A comprehensive survey should be conducted to

register still undocumented thrips species of Pakistan.

Molecular data of thrips vector species in current surveys have showed the

existence of cryptic species complexes which can be related to virus vector efficiency.

Population genetic structure of cryptic thrips vector species can be studied in relation

to their competency as a vector of Tospovirus. Investigations should concentrate on

correlation of different thrips species with transmission of different Tospovirus

species in Pakistan.

As it is the first ever study of Tospoviruses in Pakistan, researchers should

turn their focus on researching the presence and epidemiology of different Tospovirus

species in Pakistan to avoid a sudden disaster.

Additional studies should be conducted to assess the incidence of Iris yellow

spot virus and its impact on onion bulb and seed crops so that appropriate

management tactics could be developed.

Chapter 7 References

120

Chapter 7

REFERENCES

Achor, D.S., Childers, C.C., 1995. Fixation techniques for observing thrips

morphology and injury with electron microscopy, in: Thrips biology and

management. Springer, pp. 595-600.

Adkins, S., 2000. Tomato spotted wilt virus-positive steps towards negative success.

Mol. Plant Pathol. 1, 151-157.

Akram, W., 2000. Systematics of Thysanoptera of Pakistan. Ph.D. thesis, University

of Agriculture, Faisalabad, Pakistan. pp. 350.

Akram, W., Oh, S.W., Lee, J.J., 2002. Taxonomic review of the genus Mycterothrips

(Terebrantia: Thysanoptera) and its species from Pakistan. Entomolog. Res.

32, 251-254.

Akram, W., Koh, J.B., Lee, J.J., 2003a. Genus Thrips (Thysanoptera: Thripidae) from

Pakistan with most commonly recorded species. Korean J. Entomol. 33, 277-

286.

Akram, W., Shin, B.S., Lee, J.J., 2003b. Description of two genera of Idolothripinae

(Phlaeothripidae: Tubulifera: Thysanoptera) from Pakistan. Entomol. Res. 33,

53-57.

Alfredo, R., Francisco, R., Badenes, P., Anthony, M.S., 2007. Developing economic

thresholds for onion thrips in Honduras. Crop Prot. 26, 1099-1107.

Ali, R., 1976. Studies on Thripidae of Lyallpur. M.Sc. thesis, University of

Agriculture, Lyallpur, Pakistan. pp. 247.


121

Amin, P.W., Reddy, D.V.R., Ghanekar, A.M., 1981. Transmission of tomato spotted

wilt virus, the causal agent of bud necrosis of peanut, by Scirtothrips dorsalis

and Frankliniella schultzei. Plant Dis. 65, 663-665.

Ananthakrishnan, T.N., 1969. Indian Thysanoptera. C.S.I.R. Zool. Monograph 1, 1-

171.

Ananthakrishnan, T.N., 1973. Mycophagous Tubulifera of India. Loyola College

Madras, Occ. Publications 2, 144.

Ananthakrishnan, T.N., 1978. Thrips galls and gall Thrips. Zool. Monograph 1, 1-69.

Ananthakrishnan, T.N., Jagadish A., 1970a. On three new species of Tubuliferous

Thysanoptera from Darjeeling. Ori. Ins. 4, 259-264.

Ananthakrishnan, T.N., Jagadish A., 1970b. The species of Diceratothrips Bagnall

and allied genera from India (Thysanoptera: Megathripinae; Insecta). Ori. Ins.

4, 265-280.

Ananthakrishnan, T.N., Sen, S., 1980. Taxonomy of Indian Thysanoptera. Zoological

Survey of India (Handbook Series), 1, 1-234.

Anfoka, G.H., Abhary, M., Stevens, M.R., 2006. Occurrence of Tomato spotted wilt

virus (TSWV) in Jordan. EPPO Bull. 36, 517-522.

Armstrong, K.F., Cameron, C.M., Frampton, E.R., 1997. Fruit fly (Diptera:

Tephritidae) species identification: a rapid molecular diagnostic technique for

quarantine application. Bull. Entomol. Res. 87, 111-118.

Armstrong, K.F., McHugh, P., Chinn, W., Frampton, E.R., Walsh, P.J., 2003.

Tussock moth species arriving on imported used vehicles determined by DNA

analysis. NZ Pl. Prot. 56, 16-20.

Armstrong, K.F., Ball, S.L., 2005. DNA barcodes for biosecurity: invasive species

identification. Philosophical Transactions of the Royal Society B: Biol. Sci.

360, 1813-1823.


122

Ashfaq, M., Akhtar, S., Khan, A.M., Adamowicz, S.J., Hebert, P.D., 2013. DNA

barcode analysis of butterfly species from Pakistan points towards regional

endemism. Mol. Ecol. Res. 13, 832-843.

Ashfaq, M., Hebert, P.D.N., Mirza, J.H., Khan, A.M., Zafar, Y., Mirza, M.S., 2014a.

Analyzing mosquito (Diptera: Culicidae) diversity in Pakistan by DNA

barcoding. PLoS ONE, 9, e97268.

Ashfaq, M., Hebert, P.D.N., Mirza, M.S., Khan, A.M., Mansoor, S., Shah, G.S.,

Zafar, Y., 2014b. DNA barcoding of Bemisia tabaci complex (Hemiptera:

Aleyrodidae) reveals southerly expansion of the dominant whitefly species on

cotton in Pakistan. PLoS ONE, 9, e104485.

Asokan, R., Krishna Kumar, N.K., Kumar, V., Ranganath, H.R., 2007. Molecular

differences in the mitochondrial cytochrome oxidase I (mtCOI) gene and

development of a species-specific marker for onion thrips, Thrips tabaci

Lindeman, and melon thrips, T. palmi Karny (Thysanoptera: Thripidae),

vectors of tospoviruses (Bunyaviridae). Bull. Entomol. Res. 97, 461-470.

Bagnall, R.S., 1912. Some considerations in regard to the classification of the order

Thysanoptera. Ann. Mag. nat. Hist. 10, 220-222.

Bag, S., Druffel, K.L., Salewsky, T., Pappu, H.R., 2009a. Nucleotide sequence and

genome organization of the mediumRNA of Iris yellow spot virus (genus

Tospovirus, family Bunyaviridae) from the United States. Arch. Virol. 154,

715-718.

Bag, S., Rogers, P., Watson, R., Pappu, H.R., 2009b. First report of natural infection

of garlic with Iris yellow spot virus in the United States. Plant Dis. 93, 839.

Bag, S., Singh,J., Davis, R.M., Chounet, W., Pappu, H.R.,2009c. Iris yellow spot

virus in Nevada and Northern California. Plant Dis. 93, 674.

Bag, S., Druffel, K.L., Pappu, H.R., 2010. Structure and genome organization of the

large RNA of Iris yellow spot virus (genus Tospovirus, family Bunyaviridae).

Arch. Virol. 155, 275-279.


123

Bag, S., Schwartz, H., Pappu, H.R., 2012. Identification and characterization of

biologically distinct isolates of Iris yellow spot virus (genus Tospovirus,

family Bunyaviridae), a serious pathogen of onion. Eur. J. Plant Pathol. 134,

97-104.

Bag, S., Rondon, S.I., Druffel, K.L., Riley, D.G., Pappu, H.R., 2013. Seasonal

Dynamics of Thrips (Thrips tabaci) (Thysanoptera: Thripidae) Transmitters of

Iris Yellow Spot Virus: A Serious Viral Pathogen of Onion Bulb and Seed

Crops. J. Econ. Entomol. 107, 75-82.

Bailey, S.F., 1939. The six-spotted thrips, Scolothrips sexmaculatus (Perg.). J. Econ.

Entomol. 32, 43-47.

Bailey, S.F., 1952. A review of the genus Stomatothrips Hood. Pan-Pacific Entomol.

28, 154-162.

Bailey, S.F., 1964. A revision of the genus Scirtothrips Shull. Hilgardia 35, 329-362.

Ball, S.L., Hebert, P.D., Burian, S.K., Webb, J.M., 2005. Biological identifications of

mayflies (Ephemeroptera) using DNA barcodes. J. NA Benthol. Soc. 508-524.

Bandla, M.D., Campbell, L.R., Ullman, D.E., Sherwood, J.L., 1998. Interaction of

tomato spotted wilt tospovirus (TSWV) glycoproteins with a thrips midgut

protein, a potential cellular receptor for TSWV. Phytopathology 88, 98-104.

Banerjee, S.K., Maulik, M., Manchanda, S.C., Dinda, A.K., Gupta, S.K., Maulik,

S.K., 2002. Dose-dependent induction of endogenous antioxidants in rat heart

by chronic administration of garlic. Life Sci. 70, 1509-1518.

Ben Moussa, A., Marrakchi, M., Makni, M., 2005. Characterisation of Tospovirus in

vegetable crops in Tunisia. Infec. Gen. Evol. 5, 312-322.

Bertin, S., Picciau, L., Ács, Z., Alma, A., Bosco, D., 2010. Molecular identification of

the Hyalesthes species (Hemiptera: Cixiidae) occurring in vineyard

agroecosystems. Ann. Appl. Biol. 157, 435-445.


124

Best, R.J., 1968. Tomato spotted wilt virus. Adv. Vir. Res. 13, 65–145.

Bhatti, J.S., Ananthakrishan, T.N., 1975. The genus Merothrips in India

(Thysanoptera: Merothripidae). Ori. Ins. 9, 31-43.

Bhatti, J.S., 1980. Species of the genus Thrips from India (Thysanoptera). Syst.

Entomol. 5, 109-166.

Bhatti, J.S., 1982. Revision of the Indian species of Stenchaetothrips Bagnall

(Thysanoptera: Thripidae). Ori. Ins. 16, 385-417.

Bhatti, J.S., 1988. The orders Terebrantia and Tubulifera of the super order

Thysanoptera (Insecta). A Critical Appraisal, Zoology. J. Pure Appl. Zool. 1,

167-240.

Bhatti, J.S., 1989. The classification of Thysanoptera into families. Zoology 2, 1-23.

Bhatti, J.S., 1992. The Order Tubulifera (Insecta): Its characters and classification into

families. Zoology 3, 127-162.

Bhatti, J.S., 1998. New structural features in the order Tubulifera (Insecta). 1.

Amalgamation of labromaxillary complex with cranium and other cephalic

structures Zoology. J. Pure Appl. Zool. 5, 147-176.

Bhatti, J.S., 2006. The classification of terebrantia (insect) into families. Ori. Ins. 40,

339-375.

Bhatti, J.S., Mound, L.A., 1980. The genera of grass and cereal-feeding Thysanoptera

related to the genus thrips (Thysanoptera: Thripidae). Bull. Entomol. 21, 1-22.

Bickford, D., Lohman, D.J., Sodhi, N.S., Ng, P.K., Meier, R., Winker, K., Ingram,

K.K., Das, I., 2007. Cryptic species as a window on diversity and

conservation. Trends Ecol. Evol. 22, 148-155.


125

Birthia, R., Subramanian, S., Pappu, H.R., Sseruwagi, P., Muthomi, J.W., Narla,

R.D., 2011. First report of Iris yellow spot virus infecting onion in Kenya and

Uganda. Plant Dis. 95, 1195.

Block, E., 1985. The chemistry of garlic and onions. Sci. America. 252, 94-99.

Block, E., Calvey, E.M., Gillies, J.Z., Uden, P., 1997. Peeling the onion. In: Johns, T.,

Romeo, J.T., (Eds) Functionality of food phytochemicals. Plenum, New York

1-30.

Bosco, L., Tavella, L., 2010. Population dynamics and integrated pest management of

Thrips tabaci on leek under field conditions in northwest Italy. Entomol. Exp.

Appl., 135, 276-287.

Bossuyt, F., Meegaskumbura, M., Beenaerts, N., Gower, D.J., Pethiyagoda,

R., Roelants, K., Mannaert, A., Wilkinson, M., Bahir, M.M., Manamendra-

Arachchi, K., Ng, P.K., Schneider, C.J., Oommen, O.V., Milinkovitch, M.C.,

2004. Local endemism within the Western Ghats-Sri Lanka biodiversity

hotspot. Science 306, 479-481.

Bradley, S.J., Mayer, D.F., 1994. Evaluation of monitoring methods for western

flower thrips, Frankliniella occidentalis (Thysanoptera: Thripidae), during the

blossom period of'Granny Smith'apples. J. Entomol. Soc. B.C. 91, 63-68.

Brodsgaard, H.F., 1994. Insecticide resistance in European and African strains of

western flower thrips (Thysanoptera: Thripidae) tested in a new residue-on-

glass test. J. Econ. Entomol. 87, 1141-1146.

Brittlebank, C.C., 1919. Tomato diseases. J. Agric. 17, 231-235.

Brunner, P.C., Fleming, C., Frey, J.E., 2002. A molecular identification key for

economically important thrips species (Thysanoptera: Thripidae) using direct

sequencing and a PCR‐RFLP‐based approach. Agric. Forest Entomol. 4, 127-

136.

http://www.ncbi.nlm.nih.gov/pubmed?term=Gower%20DJ%5BAuthor%5D&cauthor=true&cauthor_uid=15486298

http://www.ncbi.nlm.nih.gov/pubmed?term=Pethiyagoda%20R%5BAuthor%5D&cauthor=true&cauthor_uid=15486298

http://www.ncbi.nlm.nih.gov/pubmed?term=Pethiyagoda%20R%5BAuthor%5D&cauthor=true&cauthor_uid=15486298

http://www.ncbi.nlm.nih.gov/pubmed?term=Roelants%20K%5BAuthor%5D&cauthor=true&cauthor_uid=15486298

http://www.ncbi.nlm.nih.gov/pubmed?term=Mannaert%20A%5BAuthor%5D&cauthor=true&cauthor_uid=15486298

http://www.ncbi.nlm.nih.gov/pubmed?term=Wilkinson%20M%5BAuthor%5D&cauthor=true&cauthor_uid=15486298

http://www.ncbi.nlm.nih.gov/pubmed?term=Bahir%20MM%5BAuthor%5D&cauthor=true&cauthor_uid=15486298

http://www.ncbi.nlm.nih.gov/pubmed?term=Manamendra-Arachchi%20K%5BAuthor%5D&cauthor=true&cauthor_uid=15486298

http://www.ncbi.nlm.nih.gov/pubmed?term=Manamendra-Arachchi%20K%5BAuthor%5D&cauthor=true&cauthor_uid=15486298

http://www.ncbi.nlm.nih.gov/pubmed?term=Ng%20PK%5BAuthor%5D&cauthor=true&cauthor_uid=15486298

http://www.ncbi.nlm.nih.gov/pubmed?term=Schneider%20CJ%5BAuthor%5D&cauthor=true&cauthor_uid=15486298

http://www.ncbi.nlm.nih.gov/pubmed?term=Oommen%20OV%5BAuthor%5D&cauthor=true&cauthor_uid=15486298

http://www.ncbi.nlm.nih.gov/pubmed?term=Milinkovitch%20MC%5BAuthor%5D&cauthor=true&cauthor_uid=15486298


126

Brunner, P.C., Frey, J.E., 2004. Isolation and characterization of six polymorphic

microsatellite loci in the western flower thrips Frankliniella occidentalis

(Insecta, Thysanoptera). Mol. Ecol. Not. 4, 599-601.

Brunner, P.C., Chatzivassiliou, E.K., Katis, N.I., Frey, J.E., 2004. Host-associated

genetic differentiation in Thrips tabaci (Insecta; Thysanoptera), as determined

from mtDNA sequence data. Heredity 93, 364-370.

Buckman, R.S., Mound, L.A., Whiting, M.F., 2013. Phylogeny of thrips (Insecta:

Thysanoptera) based on five molecular loci. Syst. Entomol. 38, 123-133.

Bulajic, A., Jovic, J., Krnjajic, S., Petrov, M., Kjekic, I., Krstic, B., 2008. First report

of Iris yellow spot virus on onion (Allium cepa) in Serbia. Plant Dis. 92, 1247.

Burns, J.M., Janzen, D.H., Hajibabaei, M., Hallwachs, W., Hebert, P.D., 2007. DNA

barcodes of closely related (but morphologically and ecologically distinct)

species of skipper butterflies (Hesperiidae) can differ by only one to three

nucleotides. J. Lepid. Soc. 61, 138-153.

Carr, C.M., Hardy, S.M., Brown, T., Sheldon, T., Macdonald, T., Hebert, P.D.N.,

2011. A Tri-oceanic perspective: DNA barcoding reveals geographic structure

and cryptic diversity in Canadian polychaetes. PLoS ONE 6: e22232.

Carletto, J., Blin, A., Vanlerberghe-Masutti, F., 2009. DNA‐based discrimination

between the sibling species Aphis gossypii Glover and Aphis frangulae

Kaltenbach. Syst. Entomol. 34, 307-314.

Chatzivassiliou, E.K., Peters, D., Katis, N.I., 2002. The effciency by which Thrips

tabaci populations transmit Tomato spotted wilt virus depends on their host

preference and reproductive strategy. Phytopathology 92, 603-609.

Chatzivassiliou, E.K., Giavachtsia, V., Mehraban, A.H., Hoedjes, K., Peters, D., 2009.

Identification and incidence of Iris yellow spot virus, a new pathogen in onion

and leek in Greece. Plant Dis. 93, 761.


127

Childers, C.C., Achor, D.S., 1991. Structure of the mouthparts of Frankliniella

bispinosa Morgan (Thysanoptera: Thripidae). Ann. Entomol. Soc. Am. 84,

272-282

Cho, J.J., Mau, R.F.L., Mitchell, W.C., Gonsalves, D., Yudin, L.S., 1987. Host list of

plants susceptible to tomato spotted wilt virus (TSWV). Univ. Hawaii, Coll

Tropical Agri. Res Ext. Ser. pp. 78.

Chu, F.H., Chao, C.H., Chung, M.H., Chen, C.C., Yeh, S.D., 2001. Completion of the

genome sequence of Watermelon silver mottle virus and utilization of

degenerate primers for detecting tospoviruses in five serogroups.

Phytopathology 91, 361-368.

Chowda-Reddy, R.V., Kirankumar, M., Seal, S.E., Muniyappa, V., Valand, G.B.,

Govindappa, M.R., Colvin, J., 2012. Bemisia tabaci phylogenetic groups in

India and the relative transmission efficacy of tomato leaf curl Bangalore virus

by an indigenous and an exotic population. J Integr Agric 11, 235-248.

Ciuffo, M., Finetti-Sialer, M.M., Gallitelli, D., Turina, M., 2005. First report in Italy

of a resistance-breaking strain of Tomato spotted wilt virus infecting tomato

cultivars carrying the Sw5 resistance gene. Plant pathol. 54, 564-564.

Colnago, P., Achigar, R., Gonzalez, P.H., Peluffo, S., Gonzalez, I.H., Pianzzola, M.J.,

Galvan, G.A., 2010. First report of Iris yellow spot viruson onion in

Uruguay. Plant Dis. 94, 786.

Córdoba-Sellés, C., Martínez-Priego, L., Muńoz-Gómez, R., Jordá-Gutiérrez, C.,

2005. Iris yellow spot virus: a new onion disease in Spain. Plant Dis. 89, 1243.

Cortês, I., Livieratos, I.C., Derks, A., Peters, D., Kormelink, R., 1998. Molecular and

serological characterization of Iris yellow spot virus, a new and distinct

tospovirus species. Phytopathology 88, 1276-1282.

Cortez, I., Aires, A., Pereira, A.M., Goldbach, R., Peters, D., Kormelink, R., 2002.

Genetic organisation of Iris yellow spot virus M RNA: indications for


128

functional homology between the G (C) glycoproteinsof tospoviruses and

animal-infecting bunyaviruses. Arch. Virol. 147, 2313-2325.

Cosmi, T., Marchesini, E., Martini, G., 2003. Presence and spread of tospovirus and

thrip vectors in Veneto. InformatoreAgrario 59, 69-72.

Costa, F.O., deWaard, J.R., Boutillier, J., Ratnasingham, S., Dooh, R.T., Hajibabaei,

M., Hebert, P.D.N., 2007. Biological identification through DNA barcodes:

the case of Crustacea. Can. J. Fish. Aquat. Sci. 64, 272-295.

Cott, H.E., 1956. Systematics of the suborder Tubulifera (Thysanoptera) in California.

Pub. Entomol. Uni. Cal. 13, 1-216.

Coutts, B.A., McMichael, L.A., Tesoriero, L., Rodoni, B.C., Wilson, C.R., Wilson,

A.J., Perseley, D.M., Jones, R.A.C., 2003. Iris yellow spot virus found

infecting onions in three Australian states. Aus. Plant Path. 32, 555-557.

Cramer, C.S., Bag, S., Schwartz, H.F., Pappu, H.R., 2011. Susceptibility of onion

relative (Allium spp.) to Iris yellow spot virus. Plant Dis. 95, 1319.

Crespi, B.J., 1990. Subsociality and female reproductive success in a mycophagous

thrips: an observational and experimental analysis. J. Insect Behav. 3, 61-74.

Crespi, B.J., Carmean, D., Vawter, L., Von Dohlen, C., 1996. Molecular

phylogenetics of Thysanoptera. Syst. Entomol. 21, 79-87.

Crespi, B.J., Carmean, D., Chapman, T., 1997. The ecology and evolution of galling

thrips and their allies. Annu. Rev. Entomol. 42, 51-71.

Culbreath, A.K., Todd, J.W., Brown, S.L., 2003. Epidemiology and management of

tomato spotted wilt in peanut. Ann. Rev. Phytopathol. 41, 53-75.

Dasmahapatra, K.K., Mallet, J., 2006. DNA barcodes: recent successes and future

prospects. Heredity 97, 254-255.


129

Daughtrey, M.L., Jones, R.K., Moyer, J.W., Daub, M.E., Baker, J.R., 1997.

Tospoviruses strike the greenhouse industry: INSV has become a major

pathogen on flower crops. Plant Dis. 81, 1220-1230.

Davies, H., King, N., Smith, R., 2004. Taxonomy: targeting invasives. BioNET

International. Available online at http://www.bionet-intl.

org/opencms/export/sites/de-fault/caseStudies/pdf/TTI_final. pdf (accessed 24

April 2012).

Davino, S., Panno, S., Rangel, E.A., Davino, M., Bellardi, M.G., Rubio, L., 2012.

Population genetics of Cucumber mosaic virus infecting medicinal, aromatic

and ornamental plants from northern Italy. Arch. Virol. 157, 739-739.

Dayrat, B., 2005. Towards integrative taxonomy. Biol. J. Linn. Soc. 85, 407-415.

Delfosse, P., Bashir, M., Malik, S.N., Reddy, A.S., 1995. Survey of groundnut virus

diseases in Pakistan. International Arachis Newsletter, 15, 51-52.

Deng, J., Yu, F., Zhang, T.X., Hu, H.Y., Zhu, C.D., Wu, S.A., Zhang, Y.Z., 2012.

DNA barcoding of six Ceroplastes species (Hemiptera: Coccoidea: Coccidae)

from China. Mol. Ecol. Res.12, 791-796.

Derks, A.F.L.M., Lemmers, M.E.C., 1996. Detection of tospoviruses in bulbous crops

and transmissibility by vegetative propagation. Acta Horticulture 432, 132-

137.

de Avila, A.C., Gama, M.I.C.S., Kitajima, E.W., Pereira, W., 1981. Um virus do

grupo viracabeca do tomateiro isolado de cebola (Allium cepa L.)

Fitopatologia Brasileira. 6, 525.

de Avila, A.C., de Haan, P., Kormelink, R., Resende, R.O., Goldbach, R.W., Peters,

D., 1993. Classification of tospoviruses based on phylogeny of nucleoprotein

gene sequences. J. Gen. Virol. 74, 153-159.

de Barro, P.J., 2012. The Bemisia tabaci species complex: questions to guide future

research. J Integr Agric 11, 187-196.


130

de Barro, P.J., Ahmed, M.Z., 2012. Genetic networking of the Bemisia tabaci cryptic

species complex reveals pattern of biological invasions. PLoS ONE 6: e25579.

de Haan, P., Kormelink, R., Resende, R.O., van Poelwijk, F., Peters, D., Goldbach,

R., 1991. Tomato spotted wilt virus L RNA encodes aputative RNA

polymerase. J. Gen. Virol. 72, 2207-2216.

Dickey, A.M., Osborne, L.S., Vivek Kumar, Shatters, R.G., McKenzie, C.L., 2012.

Haplotype analysis of global chili thrips (Scirtothrips dorsalis) populations

using the metazoan barcode. In Entomology 2012, Annual meeting Entomol.

Soc. Am. Knoxville, TN.

Diffie, S., Edwards, G.B., Mound, L.A., 2008. Thysanoptera of Southeastern U.S.A:

A checklist for Florida and Georgia. Zootaxa 1787, 45-62.

Doi, M., Zen, S., Okuda, M., Nakamura, H., Kato, K., Hanada, K. 2003. Leaf necrosis

disease of lisianthus (Eustoma grandiflorum) caused by Iris yellow spot virus.

JPN. J. Phytopath. 69, 181-188.

du Toit, L.J., Burger, J.T., McLeod, A., Englebrecht, M., Viljoen, A., 2007. Iris

yellow spot virus in onion seed crops in South Africa. Plant Dis. 91, 1203.

Dugdale, J.S., Gleeson, D., Clunie, L.H. Holder, P.W., 2002. A diagnostic guide to

Tortricidae encountered in field surveys and quarantine inspections in New

Zealand. ISBN 0-478-07953-2: MAF NPPRL.

Edelson, J.V., Cartwright, B., Royer, T.A., 1986. Distribution and impact of Thrips

tabaci (Thysanoptera: Thripidae) on onion. J. Econ. Entomol. 79, 502-505.

Ekrem, T., Willassen, E., Stur, E., 2007. A comprehensive DNA sequence library is

essential for identification with DNA barcodes. Mol. Phylogen. Evol. 43, 530-

542.

Ellington, C.P., 1980. Wing mechanics and take-off preparation of Thrips

(Thysanoptera). J. Exp. Biol. 85, 129-136.


131

Elliott, C., Poos, F.W., 1940. Seasonal development, insect vectors, and host range of

bacterial wilt of sweet corn. J. Agric. Res. 60, 645-686.

Elliott, R.M., 1990. Molecular biology of the Bunyaviridae. J. Gen. Virol. 71, 501-

522.

Elliott, R.M., 1996. The Bunyaviridae: concluding remarks and future prospects. In:

Elliott, R.M. (Ed.), The Bunyaviridae. Plenum Press, New York, pp. 295-332.

Elmeer, K., Almalki, A., Mohran, K.A., AL-Qahtani, K.N., Almarri, M., 2012. DNA

barcoding of Oryx leucoryx using the mitochondrial cytochrome C oxidase

gene. Gen. Mol. Res. 11, 539-547.

EPPO/CABI, 1996. Scirtothrips citri. Scirtothrips dorsalis. In: Quarantine pests for

Europe. 2nd edition (Ed. by Smith, I.M.; McNamara, D.G.; Scott, P.R.;

Holderness, M.). CAB International, Wallingford, UK.

Evans, C.K., Bag, S., Frank, E., Reeve, J.R., Drost, D., Pappu, H.R., 2009a. Natural

infection of Iris yellow spot virus in twoscale saltbush (Atriplex micrantha)

growing in Utah. Plant Dis. 93, 430.

Evans, C.K., Bag, S., Frank, E., Reeve, J.R., Ransom, C., Drost, D., Pappu, H.R.,

2009b. Green foxtail (Setaria viridis), a naturally infected grass host of Iris

yellow spot virus in Utah. Plant Dis. 93, 670.

Excoffier, L., Lischer, H.E.L., 2010. Arlequin suite ver 3.5: A new series of programs

to perform population genetics analyses under Linux and Windows. Mol.

Ecol. Res. 10, 5642567.

Fang, J., Kritzman, A., Yonash, N., Gera, A., Pollak, N., Lavi, U., 2005. Genetic

variation of thrips populations assessed by amplified fragment length

polymorphism (Thysanoptera: Thripidae). Ann. Entomol. Soc. Am. 98, 351-

358.

Farrar, J.J., Davis, R.M., 1991. Relationships among ear morphology, western flower

thrips, and Fusarium ear rot of corn. Phytopathology 81, 661-666.


132

Fauquet, C.M., Mayo, M.A., 2001. The 7th ICTV report. Arch. Virol. 146, 189-194.

Fauquet, C.M., Mayo, M.A., Maniloff, J., Desselberger, U., Ball, L.A., 2005. Virus

taxonomy. VIIIth Report of ICTV. Academic Press, New York. pp.1259.

Fansiri, T., Fontaine, A., Diancourt, L., Caro, V., Thaisomboonsuk, B., Richardson,

J.H., Jarman, R.G., Ponlawat, A., Lambrechts, L., 2013. Genetic mapping of

specific interactions between Aedes aegypti mosquitoes and dengue viruses.

PLoS Genet 9, e1003621.

Fennah, R.G., 1965. The influence of environmental stress on the cacao tree in

predetermining the feeding sites of cacao thrips, Selenothrips rubrocinctus

(Giard), on leaves and pods. Bull. Entomol. Res. 56, 333-349.

Foottit, R.G., Maw, H.E.L., Von Dohlen, C.D., Hebert, P.D.N., 2008. Species

identification of aphids (Insecta: Hemiptera: Aphididae) through DNA

barcodes. Mol. Ecol. Res. 8, 1189-1201.

Fournier, F., Boivin, G., Stewart, R.K., 1995. Effect of Thrips tabaci (Thysanoptera:

Thripidae) on yellow onion yields and economic thresholds for its

management. J. Eco. Entomol. 88, 1401-1407.

Francki, R.I.B., Hatta, T., 1981. Tomato spotted wilt virus. In: Kurstak, E. (Ed.),

Handbook of plant virus infections and comparative diagnosis. Elsevier North-

Holland Biomedical Press, Amsterdam, pp. 492-522.

Frey, J.E., Frey, B., 2004. Origin of intra‐individual variation in PCR‐amplified

mitochondrial cytochrome oxidase I of Thrips tabaci (Thysanoptera:

Thripidae): mitochondrial heteroplasmy or nuclear integration? Hereditas 140,

92-98.

Frohlich, D.R., Torres-Jerez, I.I., Bedford, I.D., Markham, P.G., Brown, J.K., 1999. A

phylogeography analysis of the Bemisia tabaci species complex based on

mitochondrial DNA markers. Mol. Ecol. 8, 1683-1691.


133

Fu, Y., Li, W.H., 1993. Statistical tests of neutrality of mutations. Genetics 133, 693-

709.

Fu, Y., 1997. Statistical tests of neutrality of mutations against population growth,

hitchhiking and background selection. Genetics 147, 915-925.

Gao, Y., Lei, Z., Reitz, S.R., 2012. Western flower thrips resistance to insecticides:

detection, mechanisms and management strategies. Pest. Manag. Sci. 68,

1111-1121.

Gariepy, T.D., Kuhlmann, U., Gillott, C., Erlandson, M., 2007. Parasitoids, predators

and PCR: the use of diagnostic molecular markers in biological control of

Arthropods. J. Appl. Entomol. 131, 225-240.

Gawande, S.J., Khar, A., Lawande, K.E., 2010. First report of Iris yellow spot

virus on garlic in India. Plant Dis. 94, 1066.

Gent, D.H., Schwartz, H.F., Khosla, R., 2004. Distribution and incidence of Iris

yellow spot virus in Colorado and its relation to onion plant population and

yield. Plant Dis. 88, 446-452.

Gent, D.H., du Toit, L.J., Fichtner, S.F., Krishna Mohan, S., Pappu, H.R., Schwartz,

H.F., 2006. Iris yellow spotvirus: an emerging threat to onion bulb and seed

production. Plant Dis. 90, 1468-1480.

Gent, D.H., Martin, R.R., Ocamb, C.M., 2007. First report of Iris yellow spot virus on

onion and leek in western Oregon. Plant Dis. 91, 468.

Gera, A., Cohen, J., Salomon, R., Raccah, B., 1998. Iris yellow spot tospovirus

detected in onion in Israel. Plant Dis. 82, 127.

Gera, A., Kritzman, A., Cohen, J., Raccah, B., Antignus, Y., 2000. Tospoviruses

infecting vegetable crops in Israel. EPPO Bull. 30, 289-292.


134

Gerlach, S., Sengonca, C., 1985. Comparative studies on the effectiveness of the

predatory mite, Phytoselulus persimilis Athias-Henriot, and the predatory

thrips, Scolothrips longicornis Priesner. J. Plant Dis. Prot. 92, 138-146.

Gerlach, S., Sengonca, C., 1986. Feeding activity and effectiveness of the predatory

thrips, Scolothrips longicornis Priesner (Thysanoptera, Thripidae). J. Appl.

Entomol. 101, 444-452.

German, T.L., Ullman, D.E., Moyer, J.W., 1992. Tospoviruses: diagnosis, molecular

biology, phylogeny, and vector relationships. Ann. Rev. Phytopathol. 30, 315-

348.

Ghanekar, A.M., Reddy, D.V.R., Iizuka, N., Amin, P.W., Gibbons, R.W., 1979. Bud

necrosis of groundnut (Arachis hypogaea) in India caused by Tomato spotted

wilt virus. Ann. Appl. Biol. 93, 173-179.

Ghotbi, T., Shahraeen, N., Winter, S., 2005. Occurrence of tospoviruses in ornamental

and weed species in Markazi and Tehran provinces in Iran. Plant Dis. 89, 425-

429.

Gilstrap, F.E., 1995. Six-spotted thrips: a gift from nature that controls spider mites.

In: Thrips Biology and Management. pp. 305-316.

Glover, R.H., Collins, D.W., Walsh, K., Boonhum, N., 2010. Assessment of loci for

DNA barcoding in the genus Thrips (Thysanoptera: Thripidae). Mol. Ecol.

Res. 10, 51-59.

Goldbach, R., Peters, D., 1994. Possible causes of the emergence of tospovirus

diseases. In: Seminars in Virology, Academic Press. 5, 113-120.

Goldbach, R., Peters, D., 1996. Molecular and biological aspects of tospoviruses. In:

ElliottRM (Ed) the Bunyaviridae. Plenum Press, New York, pp. 129-157.

Golnaraghi, A.R., Shahraeen, N., Pourrahim, R., Ghorbani, S., Farzadfar, S., 2001.

First report of Tomato spotted wilt virus on soybean in Iran. Plant Dis. 85,

1290-1290.


135

Gonzalez, D., Patterson, B.R., Leigh, T.F., Wilson, L.T., 1982. Mites: a primary food

source for two predators in San Joaquin Valley cotton. Calif. Agric. 36, 18.

Guralnick, R., Hill, A., 2009. Biodiversity informatics: automated approaches for

documenting global biodiversity patterns and processes. Bioinformatics 25,

421-428.

Gorinstein, S., Drzewiecki, J., Leontowicz, H., Leontowicz, M., Najman, K.,

Jastrzebski, Z., 2005. Comparison of the bioactive compounds and antioxidant

potentials of fresh and cooked Polish, Ukrainian, and Israeli garlic. J. Agric.

Food Chem. 53, 2726-2732.

Hafez, E.E., Abdelkhalek, A.A., El-Morsi, A.A., El-Sbahaby, O.A., 2011. First report

of Iris yellow spot virus infection of garlic and Egyptian leek in Egypt. Plant

Dis. 96,594.

Hajibabaei, M., Janzen, D.H., Burns, J.M., Hallwachs, W., Hebert, P.D.N., 2006.

DNA barcodes distinguish species of tropical Lepidoptera. Proceedings of the

National Academy of Sciences of the United States of America, 103, 968–971.

Haliday, A.H., 1836. An epitome of the British genera, in the Order Thysanoptera,

with indications of a few of the species. Entomol. Magaz. 3, 441.

Hall, J.M., Mohan, K., Knott, E.A., Moyer, J.W., 1993. Tospoviruses associated with

scape blight of onion (Allium cepa) seed crops in Idaho. Plant Dis. 77, 952

Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and

analysis program for Windows 95/98/NT Nucleic Acids Symposium Series,

41, 95-98.

Hallwass, M., Leastro, M.O., Lima, M.F., Inoue-Nagata, A.K., Resende, R.O., 2012.

Sequence determination and analysis of the NSs genes of two

tospoviruses. Arch. Virol. 157, 591-596.


136

Hardy, V.G., Teakle, D.S., 1992. Transmission of sowbane mosaic virus by Thrips

tabaci in the presence and absence of virus-carrying pollen. Ann. Appl. Biol.

121, 315-320.

Hausmann, A., Godfray, H.C., Huemer, P., Mutanen, M., Rougerie, R., van

Nieukerken, E.J., Ratnasingham, S., Hebert, P.D., 2013. Genetic patterns in

European geometrid moths revealed by the Barcode Index Number (BIN)

system. PLoS One. 17, e84518.

Hazara, A.H., Shakeel, M., Khan, J., Iqbal, M., Khan, S., 1999a. Effect of non-

chemical methods and botanical insecticides on onion thrips, Thrips tabaci

Lind, (Thysanoptera: Thripidae) in onion crop in Balochistan. Sarhad J. Agric.

15, 619-624.

Hazara, A.H., Khan, J., Shakeel, M., 1999b. Integrated pest management on onion in

Pakistan. Newsletter, SAIC, Dhaka, Bangladesh. 9, 4.

Hebert, P.D., Cywinska, A., Ball, S.L., 2003a. Biological identifications through

DNA barcodes. P. Roy. Soc. Lond. B: Biol. Sci. 270, 313-321.

Hebert, P.D., Ratnasingham, S., de Waard, J.R., 2003b. Barcoding animal life:

cytochrome c oxidase subunit 1 divergences among closely related species. P.

Roy. Soc. Lond. B: Biol. Sci. 270, 96-99.

Hebert, P.D., Penton, E.H., Burns, J.M., Janzen, D.H., Hallwachs, W., 2004. Ten

species in one: DNA barcoding reveals cryptic species in the neo-tropical

skipper butterfly Astraptes fulgerator. P. Natl. Acad. Sci. Am. 101, 14812-

14817.

Heming, B.S., 1975. Antennal structure and metamorphosis in Frankliniella fusca

Hinds (Thripidae) and Haplothrips verbasci Osborn (Phlaeothripidae)

(Thysanoptera). Quaest. Entomol. 11, 25-68.

http://www.ncbi.nlm.nih.gov/pubmed/24358363




137

Heming, B.S., 1978. Structure and function of the mouthparts in larvae of Haplothrips

verbasci Osborn (Thysanoptera, Tubulifera, Phlaeothripidae). J. Morphol. 156,

1-38.

Heming, B.S., 1993. Structure, function, ontogeny, and evolution of feeding in thrips

(Thysanoptera). Funct. Morphol. Insect Feeding, 3, 41.

Heming, B.S., 1995. History of the germ line in male and female thrips. In: Parker,

B.L, Skinner, M. and Lewis, T. (Eds) Thrips biology and management.

Plenum, New York, pp. 505-535.

Hoepting, C.A., Allen, J.K., Vanderkooi, K.D., Hovius, M.Y., Fuchs, M.F., Pappu,

H.R., McDonald, M.R., 2008. First report of Iris yellow spot virus on onion in

Canada. Plant Dis. 92, 318.

Hoddle, M.S., Mound, L.A., 2003. The genus Scirtothrips in Australia (Insecta,

Thysanoptera, Thripidae). Zootaxa 268, 1-40.

Hoddle, M.S., Oevering, P., Phillips, P.A., Faber, B.A., 2004. Evaluation of

augmentative release of Franklinothrips orizabensis for control of Scirtothrips

persea in California avocado orchards. Biol. Control 30, 456- 465.

Hoddle, M.S., Heraty, J.M., Rugman-Jones, P.F., Mound, L.A., Stouthamer, R., 2008.

Relationships among species of Scirtothrips (Thysanoptera: Thripidae,

Thripinae) using molecular and morphological data. Ann. Entomol. Soc.

Am. 101, 491-500.

Hoddle, M.S., Mound, L.A., Paris, D., 2008. Thrips of California. CBIT Publishing,

Queensland (CD-ROM).

Horie, T., Awazu, S., Itakura, Y., Fuwa, T., 1992. Identified diallylpolysulfides from

an aged garlic extract which protects the membranes from lipid peroxidation.

Planta Med. 58, 468-469.


138

Huchette, O., Bellamy, C., Filomenko, R., Pouleau, B., Seddas, S., Pappu, H.R.,

2008. Iris yellow spot virus on shallot and onion in France. Plant Health

progress pp. 0610-01.

Hudson, R.R., 2000. A new statistic for detecting genetic differentiation. Genetics

155, 2011-2014.

Hudson, R.R., Boos, D.D., Kaplan, N.L., 1992a. A statistical test for detecting

geographic subdivision. Mol. Biol. 9, 138-151.

Hudson, R.R., Slatkin, M., Maddison, W.P., 1992b. Estimations of levels of gene

flow from DNA sequence data. Genetics 132, 583-589.

Hunter, W.B., Ullman, D.E., 1989. Analysis of mouthpart movements during feeding

of Frankliniella occidentalis (pergande) and F. schultzei (trybom)

(Thysanoptera: Thripidae). Int. J. Insect morphol. Embryo. 18, 161-171.

Hunter, W.B., Ullman, D.E., 1992. Anatomy and ultrastructure of the piercing-

sucking mouthparts and paraglossal sensilla of Frankliniella occidentalis

(Pergande) (Thysanoptera: Thripidae). Int. J. Insect morphol. Embryo. 21, 17-

35.

Iftikhar, R., Bag, S., Ashfaq, M., Pappu, H.R., 2013. First Report of Iris yellow spot

virus Infecting Onion in Pakistan. Plant Dis. 97, 1517-1517.

Jacobson, A.L., Booth, W., Vargo, E.L., Kennedy, G.G., 2013. Thrips tabaci

Population Genetic Structure and Polyploidy in Relation to Competency as a

Vector of Tomato Spotted Wilt Virus. PloS one 8, e54484.

Jacobson, A.L., Kennedy, G.G., 2013. Specific insect-virus interactions are

responsible for variation in competency of different Thrips tabaci isolines to

transmit different Tomato spotted wilt virus isolates. PloS one 8, e54567.

Janzen, D.H., Hallwachs, W., Blandin, P. JOHN M. BURNS3, Cadiou, J.M., Chacon,

I., Dapkey, T., Deans, A.R., Epstein, M.E., Espinoza, B., Franclemont, J.G.,

Haber, W.A., Hajibabaei, M., Hall, J.P.W., Hebert, P.D.N., Gauld, I.D.,


139

Harvey, D.J., Hausmann, A., Kitching, I.J., Lafontaine, D., Landry, J.F.,

Lemaire, C., Miller, J.Y., Miller, J.S., Miller, L., Miller, S.E., Montero, J.,

Munroe, E., Green, S.R., Ratnasingham, S., Rawlins, J.E., Robbins, R.K.,

Rodriguez, J.J., Rougerie, R., Sharkey, M.J., Smith, M.A., Solis, M.A.,

Sullivan, J.B., Thiaucourt, P., Wahl, D.B., Weller, S.J., Whitfield, J.B.,

Willmott, K.R., Wood, D.M., Woodley, N.E., Wilson, J.J., 2009. Integration

of DNA barcoding into an ongoing inventory of complex tropical

biodiversity. Mol. Ecol. Res. 9, 1-26.

Janzen, D.H., Hajibabaei, M., Burns, J.M., Hallwachs, W., Remigio, E., Hebert,

P.D.N., 2005. Wedding biodiversity inventory of a large and complex

Lepidoptera fauna with DNA barcoding. Philosophical Transactions of the

Royal Society B: Biol. Sci. 360, 1835-1845.

Jarman, S.N., Elliott, N.G., 2000. DNA evidence for morphological and cryptic

Cenozoic speciations in the Anaspididae, 'living fossils' from the Triassic. J.

Evol. Biol. 13, 624-633.

Jenser, G., Gaborjanyi, R., Szenasi, A., Almasi, A., Grasselli, M., 2003. Significance

of hibernated Thrips tabaci Lindeman (Thysan., Thripidae) adults in the

epidemic of tomato spotted wilt virus. J. Appl. Entomol. 127, 7-11.

Johansen, R.M., Mojica-Guzman, A., 1999. The genus Scirtothrips Shull, 1909

(Thysanoptera: Thripidae, Sericothripini), in Mexico. Folia entomol. Mex.

104, 23-108.

Jones, D.R., 2005. Plant viruses transmitted by thrips. Eur. J. Plant Pathol. 113, 119-

157

Kadirval, P., Srinivasan, R., Hsu, Y.C., Su, F.C., Pena, R.D.L., 2013. Application of

Cytochrome Oxidase I Sequences for Phylogenetic Analysis and Identification

of Thrips Species Occurring on Vegetable Crops. J. Econ. Entomol. 106, 408-

418.

http://rstb.royalsocietypublishing.org/search?author1=Winnie+Hallwachs&sortspec=date&submit=Submit


140

Kamburov, S.S., 1991. Damage to fruit and the impact on crop-set from late

infestations of citrus thrips (Scirtothrips aurantii Faure). Citrus J. 1, 33-34.

Karimi, J., Hassani-Kakhki, M., Awal, M.M., 2010. Identifying thrips (Insecta:

Thysanoptera) using DNA Barcodes. J. Cell Mol. Res. 2, 35-41.

Kimura, M., 1980. A simple method for estimating evolutionary rates of base

substitutions through comparative studies of nucleotide sequences. J. Mol.

Evol. 16, 111-120.

Kirk, W., 1984. Pollen‐feeding in thrips (Insecta: Thysanoptera). J. Zool. 204, 107-

117.

Kirk, W.D., 1985. Pollen‐feeding and the host specificity and fecundity of flower

thrips (Thysanoptera). Ecol. Entomol. 10, 281-289.

Kirk, W., 1995. Feeding behavior and nutritional requirements. In: Parker, B.L.,

Skinner, M. and Lewis, T. (eds) Thrips Biology and Management. Plenum

Press, New York, pp. 21-29.

Knowlton, N., 1993. Sibling species in the sea. Ann. Rev. Ecol. Syst. 24, 189-216.

Kox, L.F.F., Van Den Beld, H.E., Zijlstra, C., Vierbergen, G., 2005. Real‐time PCR

assay for the identification of Thrips palmi. EPPO Bull. 35, 141-148.

Krauthausen, H.J., Gabriele, M.E.L., Muller, J., Radtke, P.C., Jehle J.A., 2012.

Identification and incidence of Iris yellow spot virus in Allium field crops in

Southwest Germany. Eur. J. Plant Path. 134, 345-356.

Kritzman, A., Beckelman, H., Alexandrov, S., Cohen, J., Lampel, M., Zeidan, M.,

Raccah, B., Gera, A., 2000. Lisianthus leaf necrosis: A new disease of

lisianthus caused by Iris yellow spot virus. Plant Dis. 84, 1185-1189.

Kumar, N.K., Ullman, D.E., Cho, J.J., 1995. Frankliniella occidentalis

(Thysanoptera: Thripidae) landing and resistance to tomato spotted wilt

tospovirus among Lycopersicon accessions with additional comments on


141

Thrips tabaci (Thysanoptera: Thripidae) and Trialeurodes vaporariorum

(Homoptera: Aleyrodidae). Environ. Entomol. 24, 513-520.

Kumar, N.K.K., Rawal, R.D., 1999. Onion thrips, Thrips tabaci, a vector of onion

tospovirus. Insect Environ. 5, 52.

Kunkalikar, S.R., Poojari, S., Arun, B.M., Rajagopalan, P.A., Chen, T.C., Yeh, S.D.,

Naidu, R.A., Zehr, U.B., Ravi, K.S., 2011. Importance and genetic diversity of

vegetable-infecting tospoviruses in India. Phytopathology 101, 367-376.

Landry, J.F., Hebert, P.D.N., 2013. Plutella australiana (Lepidoptera, Plutellidae), an

overlooked diamondback moth revealed by DNA barcodes. Zookeys 29, 43-

63.

Latham, L.J., Jones, R.A.C., 1997. Occurrence of tomato spotted wilt Tospovirus in

native flora, weeds, and horticultural crops. Aust. J. Agric. Res. 48, 359-369.

Lee, W., Kim, H., Lim, J., Choi, H.R., Kim, Y., Kim, Y.S., Ji, J.Y., Foottit, R.G., Lee,

S., 2011. Barcoding aphids (Hemiptera: Aphididae) of the Korean Peninsula:

updating the global data set. Mol. Ecol. Res. 11, 32-37.

Legg, J.P., French, R., Rogan, D., Okao-Okuja, G., Brown, J.K., 2002. A distinct

Bemisia tabaci (Gennadius) (Hemiptera: Sternorrhyncha: Aleyrodidae)

genotype cluster is associated with the epidemic of severe cassava mosaic

virus disease in Uganda. Mol. Ecol. 11, 1219-1229.

Lewis, T., 1965. The species, aerial density and sexual maturity of Thysanoptera

caught in mass flights. Ann. Appl. Biol. 55, 219- 225.

Lewis, T., 1973. Thrips, their biology, ecology and economic importance. Academic

press, New York, pp. 349.

Lewis, T., 1997. Thrips as crop pests. CAB International, New York, USA. pp. 203.

Librado, P., Rozas, J., 2009. DnaSP v5: a software for comprehensive analysis of

DNA polymorphism data. Bioinformatics 25, 1451-1452.




142

Lin, Y.H., Chen, T.C., Hsu, H.T., Liu, F.L., Chu, F.H., Chen, C.C., Lin, Y.Z., Yeh, S.

D., 2005. Serological comparison and molecular characterization for

verification of Calla lily chlorotic spot virus as a new tospovirus species

belonging to Watermelon silver mottle virus serogroup. Phytopathology 95,

1482-1488.

Linford, M.B., 1931. Further studies of the transmission of the pineapple yellow spot

virus by Thrips tabaci. Phytopathology 21, i5.

Lobin, K., Saison, A., Hostachy, B., Benimadhu, S.P., Pappu, H.R., 2010. First report

of Iris yellow spot virus in onion in Mauritius. Plant Dis. 94, 645

Löbl, I., Leschen, R.A., 2005. Demography of coleopterists and their thoughts on

DNA barcoding and the Phylocode, with commentary. Coleopt. Bull. 59, 284-

292.

Lone, Bhagat, 1984.Thrips of Kashmir valley, India new records and host range

Geobios new Reports 3, 101 - 103.

Lone, Bhagat, 1986. Dendrothrips saltator Uzel, a new record from India

(Thysanoptera : Thripidae). Zoology 1, 93-95.

Ly, T.N., Hazama, C., Shimoyamada, M., Ando, H., Kato, K., Yamauchi, R., 2005.

Antioxidative compounds from the outer scales of onion. J. Agri. Food Chem.

53, 8183-8189.

Mackie, W.W., Smith, F.L., 1935. Evidence of field hybridization in beans. J. Am.

Soc. Agron. 27, 903-909.

MacIntyre Allen, J.K., Scott-Dupree, C.D., Tolman, J.H., Harris, C.R., 2005.

Resistance of Thrips tabaci to pyrethroid and organophosphorus insecticides

in Ontario, Canada. Pest Manag. Sci. 61, 809-815.

Mainali, B.P., Shrestha, S., Lim, U.T., Kim, Y., 2008. Molecular markers of two

sympatric species of the genus Frankliniella (Thysanoptera: Thripidae). J.

Asia-Pac. Entomol. 11, 45-48.


143

Mandal, B., Pappu, H.R., Csinos, A.S., Culbreath, A.K., 2006. Response of peanut,

pepper, tobacco, and tomato cultivars to two biologically distinct isolates of

Tomato spotted wilt virus. Plant Dis. 90, 1150-1155.

Mandal, B., Jain, R.K., Krishnareddy, M., Krishna Kumar, N.K., Ravi, K.S., Pappu,

H.R., 2012. Emerging problems of Tospoviruses (Bunyaviridae) and their

management in the Indian Subcontinent. Plant Dis. 96, 468-479.

Margaria, P., Ciuffo, M., Turina, M., 2004. Resistance breaking strain of Tomato

spotted wilt virus (Tospovirus; Bunyaviridae) on resistant pepper cultivars in

Almería, Spain. Plant Pathol. 53, 795-795.

Martin, D.P., Lemey, P., Lott, M., Moulton, V., Posada, D., Lefeuvre, P., 2010.

RDP3: a flexible and fast computer program for analyzing recombination.

Bioinformatics 26, 2462-2463.

Massumi, H., Samei, A., Pour, A. H., Shaabanian, M., Rahimian, H., 2007.

Occurrence, distribution, and relative incidence of seven viruses infecting

greenhouse-grown cucurbits in Iran. Plant Dis. 91, 159-163.

Massumi, H., Shaabanian, M., Pour, A.H., Heydarnejad, J., Rahimian, H., 2009.

Incidence of viruses infecting tomato and their natural hosts in the southeast

and central regions of Iran. Plant Dis. 93, 67-72.

Masumoto, M., Okajima, S., 2005. Trichromothrips Priesner (Thysanoptera,

Thripidae) of Japan and Taiwan, with descriptions of four new species and a

review of the Trichromothrips group of genera. Zootaxa 1082, 1-27.

Masumoto, M., Okajima, S., 2006. A revision of and key to the world species of

Mycterothrips Trybom (Thysanoptera, Thripidae). Zootaxa 1261, 1-90.

Masumoto, M., 2010. Key to genera of the subfamily Thripinae (Thysanoptera:

Thripidae) associated with Japanese plant quarantine. Res. Bull. Plant Protec.

Japan 46, 25-59.


144

Mavric, I., Ravnikar, M., 2000. Iris yellow spot tospovirus in Slovenia. in: Proc.

5th

Congress of the Eur. Found. Plant Pathol., Taormina, It. pp 223-225.

Meier, R., Shiyang, K., Vaidya, G., Ng, P.K., 2006. DNA barcoding and taxonomy in

Diptera: a tale of high intraspecific variability and low identification

success. Syst. Boil. 55, 715-728.

Meier, R., Zhang, G., Ali, F., 2008. The use of mean instead of smallest interspecific

distances exaggerates the size of the “barcoding gap” and leads to

misidentification. Syst. Biol. 57, 809-813.

Meyer, C.P., Paulay, G., 2005. DNA barcoding: error rates based on comprehensive

sampling. PLoS boil. 3, e422.

Mikkelsen, N.T., Schander, C., Willassen, E., 2007. Local scale DNA barcoding of

bivalves (Mollusca): a case study. Zoologica Scripta 36, 455-463.

Mitchell, F.L., Lowry, V.K., Kresta, K.K., Smith J.W., 1995. Histological study of

tobacco thrips feeding on peanut foliage. In: Parker, B.L., Skinner, M., Lewis,

T. (Eds) Thrips Biology and Management. Plenum Press, New York, pp. 175-

178.

Mirab-balou, M., Minaei, K., Chen, X.X., 2013. An illustrated key to the genera of

Thripinae (Thysanoptera, Thripidae) from Iran. ZooKeys 317, 27.

Mollema, C., Steenhuis, G., Inggamer, H., 1995. Genotypic effects of cucumber

responses to infestation by western flower thrips. In: Parker, B.L., Skinner,

M., Lewis, T. (Eds) Thrips Biology and Management. Plenum Press, New

York, pp. 397-401.

Moritz, G., 1982. Zur Morphologie und Anatomie des Fransenflügers Aeolothrips

intermedius Bagnall 1934 (Aeolothripidae, Thysanoptera, Insecta). 1.

Mitteilung: Der Kopf. Zoologische Jahrbücher Abteilung für Anatomie und

Ontogenie der Tiere 107, 557e608.


145

Moritz, G., 1989. The ontogenesis of Thysanoptera (Insecta) with special reference to

the Panchaetothripine Hercinothrips femoralis (OM REUTER, 1891)

(Thysanoptera, Thripidae, Panchaetothripinae). Zoologische Jahrbücher

Anatomie 118, 393-429.

Moritz, C.D., Paulsen, M., Mound, L.A., Burgermeister, W., 2000. Modern methods

in thrips identification and information (Insecta: Thysanoptera). Eppo Bull. 30,

591-593.

Moritz, G., Morris, D.C., Mound, L.A., 2001. Thrips ID – Pest Thrips of the World.

CD-Rom Published for ACIAR by CSIRO Publishing, Melbourne.

Moritz, G., Mound, L.A., Morris, D.C., Goldarazena, A., 2004. Pest thrips of the

world. An identification and information system using molecular and

microscopical methods. CD-ROM published by Centre for Pest Information

Technology and Transfer, The University of Queensland, Brisbane, Australia.

Morris, D.C., Mound, L.A., 2004. Molecular relationships between populations of

South African citrus thrips (Scirtothrips aurantii Faure) in South Africa and

Queensland, Australia. Aus. J. Entomol. 43, 353-358.

Mound, L.A., 1971. The feeding apparatus of thrips. Bull. Entomol. Res. 60, 547-548.

Mound, L.A., 1972. Species complexes and the generic classification of leaf-litter

thrips of the tribe Urothripini (Phlaeothripidae). Aust. J. Zool. 20, 83-103.

Mound, L.A., 1973. Thrips and whitefly. In :Gibbs , A.J (ed.) , viruses and

invertebrates. North Holland publ. Co. pp 230-242.

Mound, L.A., ONeill, K., 1974. Taxonomy of the Merothripidae, with ecological and

phylogenetic considerations (Thysanoptera). J. Nat. Hist. 8, 481-509.

Mound, L.A., 1976a. Thysanoptera of the genus Dichromothrips on old world

Orchidaceae. Biol. J. Linn. Soc. Lond. 8, 245-265.


146

Mound, L.A., 1976b. The identity of the green house thrips Heliothrips

haemorroidalis (Bouche`) (Thysanoptera) and the taxonomic significance of

spanadric males. Bull. Entomol. Res. 66, 179-180.

Mound, L.A., Heming, B.S., Palmer, J.M., 1980. Phylogenetic relationships between

the families of recent Thysanoptera (Insecta). Zool. J. Linn. Soc. 69, 111-141.

Mound, L.A., Palmer, J.M., 1981. Identfication, distribution, and host-plants of the

pest species of Scirtothrips (Thysanoptera: Thripidae). Bull. Entomol. Res. 71,

467–479.

Mound, L.A., Palmer, J.M., 1983. The generic and tribal classification of Spore-

feeding Thysanoptera (Phlaeothripidae: Idolothripinae). Bull. Br. Mus. (Nat.

Hist.) Entomol. 46, 1-174.

Mound, L.A., 1992. Patterns of sexuality in Thysanoptera. In: Cameron, E.A., Teulon,

D.A., McCormick, L.H., Kolb, T.E., (Eds) The 1991 Conference on Thrips

(Thysanoptera): Insect and Disease Considerations in Sugar Maple

Management. GTR, NE 161, US Department of Agriculture, Radnor, pp. 2-14.

Mound, L.A., 1994. Thrips and gall induction: a search for patterns. In: Williams,

M.A.J. (ed.) Plant Galls. Systematics association special volume, Clarendon

Press, Oxford, 49, pp. 131-149.

Mound, L.A., Teulon, D.A., 1995. Thysanoptera as phytophagous opportunists. In:

Parker, B.L., Skinner, M., Lewis, T., (Eds) Thrips biology and management.

Plenum, New York, pp. 3-20.

Mound, L.A., 1996. The Thysanoptera vector species of tospoviruses. Acta Horticult.

431, 298-309.

Mound, L.A., Marullo, R., 1996. The Thrips of central and South America: An

Introduction. Mem. Entomol. Int. 6, 1-487.

Mound, L.A., Marullo, R., 1998. Biology and identification of Aeolothripidae

(Thysanoptera) in Australia. Invertebr. Syst. 12, 929-950.


147

Mound, L.A., Kibby, G., 1998. Thysanoptera: An Identification Guide. 2nd Ed.

CABI, Oxford and New York, pp. 70.

Mound, L.A., Zur Strassen, R., 2001. The genus Scirtothrips (Thysanoptera:

Thripidae) in Mexico: a critique of the review by Johansen & Mojica-Guzmán

(1998). Folia Entomol. Mex, 40(1), 133-142.

Mound, L.A., 2002. So many thrips—so few tospoviruses? In Mound, L.A., Marullo,

R., (eds.), Thrips and Tospoviruses: Proceedings of the 7th International

Symposium on Thysanoptera. CSIRO Entomology, Reggio Calabria, Italy. pp.

15-18.

Mound, L.A., 2005. Thysanoptera: diversity and interactions. Ann. Rev. Entomol. 50,

247-269.

Mound, L.A., Masumoto, M., 2005. The genus Thrips (Thysanoptera, Thripidae) in

Australia, New Caledonia and New Zealand. Zootaxa 1020, 1-64.

Mound, L.A., Morris, D.C., 2007. The insect order Thysanoptera: classification

versus systematic. In Zhang, Z.Q., Shear, W.A., (Eds), Linnaeus Tercentenary:

Progress in invertebrate Taxonomy. Zootaxa 1668, 1-766.

Mound, L.A., Minaei, K., 2007. Australian thrips of the Haplothrips lineage (Insecta:

Thysanoptera). J. Nat. Hist. 41, 2919-2978.

Mound, L.A., Ng, Y.F., 2009. An illustrated key to the genera of Thripinae

(Thysanoptera) from South East Asia. Zootaxa 2265, 27-47.

Mound, L.A., Wheeler, G.S., Williams, D.A., 2010. Resolving cryptic species with

morphology and DNA; thrips as a potential biocontrol agent of Brazilian

peppertree, with a new species and overview of Pseudophilothrips

(Thysanoptera). Zootaxa 2432, 59-68.

Mound, L.A., 2011. Species recognition in the genus Scolothrips (Thysanoptera,

Thripidae), predators of leaf-feeding mites. Zootaxa 2797, 45-53.


148

Mound, L.A., 2014. Thysanoptera (Thrips) of the world- a checklist. Available from:

http:// www.ento.csiro.au/thysanoptera/worldthrips.html Captured on 20

March 2014.

Moyer, J.W., 1999. Tospoviruses (Bunyaviridae). In Encyclopedia of Virology: Eds

Webster, R. G., Granoff, A. New York: Academic Press. pp. 1803-1807.

Moyer, J.W., 2000. Tospoviruses. In: Hull, R. (Ed.), Encyclopedia of Microbiology.

Academic Press, 4, 592–597.

Mullis, S.W., Gitaitis, R.D., Nischwitz, C., Csinos, A.S., Rafael Mallaupoma, Z.C.,

Inguil Rojas, E.H., 2006. First report of onion (Allium cepa) naturally infected

with Iris yellow spot virus in Peru. Plant Dis. 90, 377.

Mumford, R.A, Barker, I., Wood, K.R., 1994. The detection of tomato spotted wilt

virus using the polymerase chain reaction. J. Virol. Meth. 46, 303-311.

Mumford, R.A., Barker, I., Wood, K.R., 1996. The Biology of the Tospoviruses. Ann.

Appl. Biol., 128, 159-183.

Murai, T., Toda, S., 2001. Variation of Thrips tabaci in colour and size. In: Thrips and

Tospoviruses: in Proceedings of the 7th International Symposium on

Thysanoptera. 1–8 July 2001, Reggio Calabria, Italy. pp. 377-378.

Muraleedharan, 1982. Studies on Thysanoptera of N-E. India. 4 Tubulifera from

Manipur. Rec. Zool. Sur. India.79, 373-384.

Mustafa, T.M., 1986. Spatial distribution of onion Thrips and cabbage aphid on and

response to some crucifcrous crop plant. J. Plant Dis. Protect. 93, 271-277.

Mutanan, M., Hausmann, A., Hebert, P.D., Landry, J.F., de Waard, J.R., Huemer, P.,

2013. Allopatry as a gordian knot for taxonomists: patterns of DNA barcode

divergence in arctic-alpine lepidoptera. PLoS One 7, e47214.

http://www.ento.csiro.au/thysanoptera/worldthrips.html




149

Nagata, T., Almeida, A.C.L., Resende, R.D.O., DeÁvila, A.C., 2004. The competence

of four thrips species to transmit and replicate four tospoviruses. Plant pathol.

53, 136-140.

Nakahara, S., 1991. Systematic of Thysanoptera Pear-Thrip and other economic

species U.S Department of Agriculture , Forest service , North eastern Forest

experiment station. Technical Bull. pp. 41-59.

Nakahara, S., 1994. The genus Thrips Linnaeus (Thysanoptera: Thripidae) of the New

World. United States Department of Agriculture. Technical Bull. 1822, 1-183.

Naro‐Maciel, F., Reid, B., Fitzsimmons, N.N., Le, M., Desalle, R., Amato, G., 2010.

DNA barcodes for globally threatened marine turtles: a registry approach to

documenting biodiversity. Mol. Ecol. Res. 10, 252-263.

Nichol, S.T., Beaty, B.J., Elliott, R.M., Goldbach, R., Plyusnin, A., Schmaljohn, C.S.,

Tesh, R.B., 2005. Bunyaviridae. In: Fauquet, C.M., Mayo, M.A., Maniloff, J.,

Desselberger, U., Ball, L.A. (Eds) Virustaxonomy: VIIIth report of the ICTV.

Elsevier/Academic Press, San Diego, pp. 695–716.

Nieukerken, E.V., Doorenweerd, C., Stokvis, F.R., Groenenberg, D.S.J., 2012. DNA

barcoding of the leaf-mining moth subgenus Ectoedemia s. str. (Lepidoptera:

Nepticulidae) with COI and EF1-α: two are better than one in recognising

cryptic species. Contrib. Zool. 81, 1-24.

Nischwitz, C., Pappu, H.R., Mullis, S.W., Sparks, A.N., Langston, D.R., Csinos, A.S.,

Gitaitis, R.D., 2007. Phylogenetic analysis of Iris yellow spot virus isolates

from onion (Allium cepa) in Georgia and Peru. J. Phyt. 155, 531-535.

Nuutila, A.M., Puupponen-Pimiä, R., Aarni, M., Oksman-Caldentey, K.M., 2003.

Comparison of antioxidant activity of onion and garlic extracts by inhibition

of lipid peroxidation and radical scavenging activity. Food Chem. 81, 485-

493.


150

Ohnishi, J., Katsuzaki, H., Tsuda, S., Sakurai, T., Akutsu, K., Murai, T., 2006.

Frankliniella cephalica, a new vector for Tomato spotted wilt virus. Plant Dis.

90, 685-685.

Okuda, M., Hanada, K., 2001. RT-PCR for detecting five distinct Tospovirus species

using degenerate primers and dsRNA template. J. Virol. Meth. 96, 149-156.

OEPP/EPPO, 1989. Data sheets on quarantine organisms No. 175, Thrips palmi.

Bulletin OEPP/EPPO Bulletin 19, 717-720.

Paliwal, Y.C., 1974. Some properties and thrip transmission of tomato spotted wilt

virus in Canada. Can. J. Bot. 52, 1177-1182.

Paliwal, Y.C., 1976. Some characteristics of the thrips vector relationship of tomato

spotted wilt virus in Canada. Can. J. Bot. 54, 402-05.

Palmer, J.M., Mound, L.A., 1978. Nine genera of fugus-feeding Phlaeothripidae

(Thysanoptera) from the oriental Region. Bull. Br. Mus. (Nat. Hist.) Entomol.

37, 153-215.

Palmer, J.M., 1987. Megalurothrips in the flowers of tropical legumes: a

morphometric study. In: Holman, J., Pelikan, J., Dixon, A.F.G., Weismann, L.,

(Eds). Population structure, genetics and taxonomy of aphids and

Thysanoptera. The Hague (SPB Academic Publishing), pp. 480-495.

Palmer, J., Mound, L.A., Heaume, G.J., 1989. IIE Guides to insects of importance to

man. In: Betts, C.R. (ed.), Thysanoptera. CAB International, Wallingford, UK.

pp. 73.

Palmer, J.M., Reddy, D.V.R., Whiteman, J.A., Rao, G.V.R., 1990. New information

on the thrips vectors of tomato spotted wilt virus in groundnut crops in India.

Int. Arachis news letter, 7, 24-25.

Palmer, J.M., Mound, L.A., 1990. Thysanoptera. In: Rosen, D., (ed.) The Armored

Scale Insects, Their Biology, Natural Enemies and Control, B. Elsevier

Science Publishers, Amsterdam, pp. 67-76.


151

Palmer, J.M., 1992. Thrips (Thysanoptera) from Pakistan to the Pacific: A review.

Bull. Br. Mus. (Nat. Hist.) Entomol. Series 61.

Pappu, H.R., 1997. Managing tospoviruses through biotechnology: progress and

prospects. Biotechnology and Development Monitor, 32, 1417.

Pappu, H.R., du Toit, L.J., Schwartz, H.F., Mohan, K., 2006. Sequence diversity of

the nucleoprotein gene of Iris yellow spot virus (genus Tospovirus, family

Bunyaviridae) isolates from the western region of the United States. Arch.

Virol. 151, 1015-1023.

Pappu, H.R., 2008. Tomato spotted wilt virus (Bunyaviridae), In Mahy, B.W.J., van

Regenmortel, M.H.V., (Eds.). Encyclopedia of Virology. Elsevier Ltd, Oxford,

UK. pp. 133-138.

Pappu, H.R., Rosales, I.M., Druffel, K.L., 2008. Serological and molecular assays for

rapid and sensitive detection of Iris yellow spot virus infection of bulb and

seed onion crops. Plant Dis. 92, 588-594.

Pappu, H.R., Jones, R.A., Jain, R.K., 2009. Global status of tospovirus epidemics in

diverse cropping systems: successes achieved and challenges ahead. Virus

Res. 141, 219-236.

Pappu, H. R., Rauf, A., 2013. First report of Iris yellow spot virus infecting green

onion in Indonesia. Plant Dis. 97, 1665.

Pappu, H.R., Bag, S., 2014. Iris yellow spot virus: A distinct species in the

genus Tospovirus, family Bunyaviridae. International Committee for

Taxonomy of Viruses. In press

Park, D.S., Suh, S.J., Hebert, P.D.N., Oh, H.W., Hong, K.J., 2011. DNA barcodes for

two scale insect families, mealybugs (Hemiptera: Pseudococcidae) and

armored scales (Hemiptera: Diaspididae). Bull. Entomol. Res. 101, 429-434.


152

Parrella, M.P., Horsburgh, R.L., 1983. Functional responses of the black hunter thrips,

Leptothrips mali (Thysanoptera: Phlaeothripidae), to densities of Panonychus

ulmi (Acari: Tetranychidae). Environ. Entomol. 12, 429-433.

Pearce, M.J., 2005. Georgia Plant Disease Loss Estimates. University Georgia

Cooperative Extension Service, pp. 24.

Persley, D.M., Thomas, J.E., Sharman, M., 2006. Tospoviruses—an Australian

perspective. Aust. Plant Pathol. 35, 161-180.

Persley, D., Wilson, C., Thomas, J., Sharman, M., Tree, D., 2010. IXth International

symposium on thysanoptera and tospoviruses, 31 August-4 September, 2009.

J. Insect Sci. 10, 166.

Peters, D., De Avila, A.C., Kitajima, E.W., Resende, R.D.O., Haan, P.D., Goldbach,

R.W., 1991. An overview of tomato spotted wilt virus. ARS-US Department

of Agriculture. In: Virus Thrips-Plant Interactions of TSWV, Proceedings of

the USDA Workshop, Beltsville, USA, pp. 1-14.

Pickett, C.H., Wilson, L.T., Gonzalez, D., 1988. Population Dynamics and Within-

Plant Distribution of the Western Flower Thrips (Thysanoptera: Thripidae) an

Early-Season Predator of Spider Mites Infesting Cotton. Environ. Entomol.

17, 551-559.

Pitkin, B.R., 1972. A revision of the flower living genus odontothrips Amyot and

Serville (Thysanoptera: phlaeothripidae). Bull. Br. Mus. (Nat. Hist.) Entomol.

26, 371-402.

Plenk, A., Grausgruber-Groger, S., 2011. First report of Iris yellow spot virus in

onions (Allium cepa) in Austria. New Disease Reports 23, 13.

Porco, D., Rougerie, R., Deharveng, L., Hebert, P.D., 2010. Coupling non-destructive

DNA extraction and voucher retrieval for small soft-bodied arthropods in a

high throughput context: the example of Collembola. Mol. Ecol. Res. 10, 942-

945.


153

Pozzer, L., Bezerra, I.C., Kormelink, R., Prins, M., Peters, D., Resende, R.O., de

Avila, A.C., 1999. Characterization of a tospovirus isolate of Iris yellow spot

virus associated with a disease in onion fields in Brazil. Plant Dis. 83, 345-

350.

Pramual, P., Kuvangkadilok, C., 2012. Integrated cytogenetic, ecological, and DNA

barcode study reveals cryptic diversity in Simulium (Gomphostilbia)

angulistylum (Diptera: Simuliidae). Genome 55, 447-458.

Prasad, K., Axdal, V.A., Yu, M., Raney, B.L., 1995. Antioxidant activity of allicin, an

active principle in garlic. Mol. Cell. Biochem. 148, 183-189.

Premachandra, W.T.S.D., Borgemeister, C., Maiss, E., Knierim, D., Poehling, H.M.,

2005. Ceratothripoides claratris, a new vector of a Capsicum chlorosis virus

isolate infecting tomato in Thailand. Phytopathology 95, 659-663.

Priesner, H., 1961. Das system der Tubulifera (Thysanoptera). Anzeiger

mathematisch-naturwissenschafitliche kiasse, Osterreichische Akademie der

winsenschaften, 13, 283-296.

Priesner, H., 1964. A monograph of the Thysanoptera of the Egyptian deserts. Publ.

Inst. Des. Egyp. 13, 1-549.

Priesner, H., 1968. On the genera allied to Liothrips of the Oriental fauna.ii (Insecta-

thysanoptera). Treubia 27, 175-285.

Puillandre, N., Lambert, A., Brouillet, S., Achaz, G., 2012. ABGD, Automatic

Barcode Gap Discovery for primary species delimitation. Mol. Ecol. 21, 1864-

1877.

Qiu, W.P., Geske, S.M., Hickey, C. M., Moyer, J.W., 1998. Tomato Spotted Wilt

Tospovirus Genome Reassortment and Genome Segment-Specific

Adaptation. Virology 244, 186-194.

Quilang, J.P., Santos, B.S., Ong, P.S., Basiao, Z.U., Fontanilla, I.K.C., Cao, E.P.,

2011. DNA barcoding of the Philippine endemic freshwater sardine Sardinella


154

tawilis (Clupeiformes: Clupeidae) and its marine relatives. Philip. Agricu.

Scient. 94.

Rangel, E., Alfaro-Fernandez, A., Font-San-Ambrosio, M., Luis-Arteaga, M., Rubio,

L., 2011. Genetic variability and evolutionary analyses of the coat protein

gene of Tomato mosaic virus. Virus Genes 43, 435-438.

Rangarao, G.V., VijayaLakshmi, K., 1993, Thrips and bud necrosis disease in

groundnut. In Collaborative research in India on breeding groundnuts for

resistance to bud necrosis disease: proceedings of the meeting, ICRlSAT

Center, Patancheru Andhra Pradesh, India, 28 Sep 1992. pp 12-20.

Ratnasingham, S., Hebert, P.D.N., 2007. BOLD: the Barcode of Life Data System

(www.barcodinglife.org). Mol. Ecol. Notes 7, 355-364.

Ratnasingham, S., Hebert, P.D.N., 2013. A DNA-based registry for all animal species:

The Barcode Index Number (BIN) System. PLoS One 8, e66213.

Ravi, K.S., Kitkaru, A.S., Winter, S., 2006. Iris yellow spot virus in onions: a new

tospovirus record from India. Plant Path. 55, 288.

Reitz, S.R., 2009. Biology and ecology of the western flower thrips (Thysanoptera:

Thripidae): The making of a pest. Fla. Entomol. 92, 7-13.

Riley, D.G., Joseph, S.V., Srinivasan, R., Diffie, S., 2011. Thrips vectors of

tospoviruses. J. Int. Pest Manag. 2, 1-10.

Robène-Soustrade, I., Hostachy, B., Roux-Cuvelier, M., Minatchy, J., Hédont, M.,

Pallas, R., Couteau, A., Cassam, N., Wuster, G., 2006. First report of Iris

yellow spot virus in onion bulb- and seed-production fields in Réunion Island.

Plant Pathol. 55, 288.

Roggero, P., Masenga, V., Tavella, L., 2002. Field isolates of Tomato spotted wilt

virus overcoming resistance in pepper and their spread to other hosts in

Italy. Plant Dis. 86, 950-954.


155

Rosales, M., Pappu, H.R., Mora, R., Aljaro, A., 2005. Iris yellow spot virus in onion

in Chile. Plant Dis. 89, 1245.

Rosen, D., 1986. The role of taxonomy in effective biological control programs.

Agric. Ecosyst. Environ. 15, 121-129.

Rueda, A., Badenes-Perez, F.R., Shelton, A.M., 2007. Developing economic

thresholds for onion thrips in Honduras. Crop Protec. 26, 1099-1107.

Rugman-Jones, P.F., Hoddle, M.S., Mound, L.A., Stouthamer, R., 2006. Molecular

identification key for pest species of Scirtothrips (Thysanoptera: Thripidae). J.

Econ. Entomol. 99, 1813-1819.

Rugman-Jones, P.F., Hoddle, M.S., Stouthamer, R., 2010. Nuclear-mitochondrial

barcoding exposes the global pest Western flower thrips (Thysanoptera:

Thripidae) as two sympatric cryptic species in its native California. J. Econ.

Entomol. 103, 877-886.

Saeed, M., Yousuf, M., 1994. Checklist of Thysanoptera of the Punjab (Pakistan).

Pak. Entomol. J. 16, 59-61.

Saeed, M., Yousuf, M., Zafar, M.H., 1994. Genus Scirtothrips Shull (Thripidae:

Thysanoptera) with description of a new species from Punjab, Pakistan. Pak.

Entomol. J. 16, 33-36.

Sakimura, K., 1947. Thrips in relation to gall-forming and plant transmission – A

review; P. Hawaii. Entomol. Soc. 13, 59-96.

Sakimura, K., 1961. Field observations on the thrips species of tomato spotted wilt

virus in the San Paolo area. Calif. Plant Dis. Rep. 45, 772-776.

Sakimura, K., 1963. Frankliniella fusca, an additional vector for the Tomato spotted

wilt virus, with notes on thrips tabaci, another vector. Phytopathology 53, 412.

Sakimura, K., 1967a. A preliminary note on a review of the genus Chaetisothrips

Priesner (Thysanoptera: Thripidae). Fla. Entomol. 50, 165-168


156

Sakimura, K., 1967b. A preliminary review of the genus Isoneurothrips and the

subgenus Thrips (Isothrips). Pac. Insects 9, 429-436.

Sakimura, K., 1967c. Preliminary note on a review of subgenus Taeniothrips

(Isochaetothrips). Pac. Insects 9, 721-726.

Sambrook, J., Russell, D.W., 2006. Purification of nucleic acids by extraction with

phenol: chloroform. Cold Spring Harbor Protocols 2006, pdb. prot4455.

Sampangi, R.K., Mohan, S.K., Pappu, H.R., 2007. Identification of new alternative

weed hosts for Iris yellow spot virus in the Pacific Northwest. Plant Dis. 91,

1683.

Sanger, F., Nicklen, S., Coulson, A.R., 1977. DNA sequencing with chain-terminating

inhibitors. P. Natl. Acad. Sci. USA. 74, 5463-5467.

Savolainen, V., Cowan, R.S., Vogler, A.P., Roderick, G.K., Lane, R., 2005. Towards

writing the encyclopaedia of life: an introduction to DNA

barcoding. Philosophical Transactions of the Royal Society B: Biol. Sci. 360,

1805-1811.

Scheffer, S.J., Lewis, M.L., Joshi, R.C., 2006. DNA barcoding applied to invasive

leafminers (Diptera: Agromyzidae) in the Philippines. Ann. Entomol. Soc.

Am. 99, 204-210.

Schiffer, M., Carew, M.E., Hoffmann, A.A., 2004. Molecular, morphological and

behavioural data reveal the presence of a cryptic species in the widely studied

Drosophila serrata species complex. J. Evol. Biol. 17, 430-442.

Schwartz, H.F., Mohan., S.K., 2007. Compendium of onion and garlic diseases and

pests. Am. Phytopathol. Soc., St. Paul, MN. Ed. 2. pp. 127.

Schwartz, H.F., Otto., K., Pappu, H.R., 2007. First report of Iris yellow spot virus in

commercial leek (Allium porrum) in the United States. Plant Dis. 91, 113.


157

Selhorst, T., Söndgerath, D., Weigand, S., 1991. A model describing the predator-

prey interaction between Scolothrips longicornis and Tetranychus

cinnabarinus based upon the Leslie theory. Ecol. Model. 59, 123-138.

Sen, S., Pramanik, N.K., Sen Gupta, C.K., 1988. Thysanoptera fauna of north-eastern

India. Zool. Survey India, Pub. In: Records of the zoological surveys of India.

ASIN: B0006ERT0O

Sengonca, C., Gerlach, S., 1984. Einfluss der Blattoberfläche auf die Wirksamkeit

des Räuberischen Thrips, Scolothrips longicornis (Thysanoptera: Thripidae).

Entomophaga 29, 55-61.

Sether, D.M., Borth, W.B., Shimabuku, R.S., Pappu, H.R., Melzer, M.J., Hu, J.S.,

2010. First report of Iris yellow spot virus in onion in Hawaii. Plant Dis. 94,

1508.

Sherwood, J.L., German, T.L., Moyer, J.W., Ullman, D.E., Whitfield, A.E., 2000.

Tomato spotted wilt virus. In: Maloy, O.C., Murray, T.D., (Eds) Encyclopedia

of plant pathology, John Wiley & Sons, NewYork, NY.

Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H., Flook, P., 1994. Evolution,

weighting, and phylogenetic utility of mitochondrial gene sequences and a

compilation of conserved polymerase chain reaction primers. Ann. Entomol.

Soc. Am. 87, 651-701.

Sin, S.H., McNulty, B.C., Kennedy, G.G., Moyer, J.W., 2005. Viral genetic

determinants for thrips transmission of Tomato spotted wilt virus. P. Nat.

Acad. Sci. USA. 102, 5168-5173.

Singh, S.J., 1947. Studies of the Indian Thysanoptera. Rec. Indian Mus. 40, 201.

Singh, S.J., Krishanareddy, M., 1996. Watermelon bud necrosis: A new tospovirus

disease. Acta Hort. 431, 68-77

Smith, K.M., 1931. Studies on potato virus diseases VIII. On a ringspot virus

affecting solanaceous plants. Ann. Appl. Biol. 18, 1-15.


158

Smith, M.A., Rodriguez, J.J., Whitfield, J.B., Deans, A.R., Janzen, D.H., Hallwachs,

W., Hebert, P.D.N., 2008. Extreme diversity of tropical parasitoid wasps

exposed by iterative integration of natural history, DNA barcoding,

morphology, and collections. P. Nat. Acad. Sci. USA. 105, 12359-12364.

Sourakov, A., Zakharov, E.V., 2011. “Darwin’s butterflies”? DNA barcoding and the

radiation of the endemic Caribbean butterfly genus Calisto (Lepidoptera,

Nymphalidae, Satyrinae). Comp. Cytogenet. 5, 191.

Srinivasan, R., Sundaraj, S., Pappu, H.R., Diffie, S., Riley, D.G., Gitaitis, R.D., 2012.

Transmission of Iris yellow spot virus by Frankliniella fusca and Thrips

tabaci (Thysanoptera: Thripidae). J. Econ. Entomol. 105, 40-47.

Stannard, L.J., 1957. The phylogeny and classification of the North American genera

of the suborder Tubulifera (Thysanoptera). Ill. Biol. Monogr. 25, 1-200.

Strassen, R.Z., 1960. Catalogue of known species of the South African Thysanoptera.

J. Entomol. Soc. South. Afr. 23, 144-176.

Strutzenberger, P., Brehm, G., Fiedler, K., 2011. DNA barcoding‐based species

delimitation increases species count of Eois (Geometridae) moths in a

well‐studied tropical mountain forest by up to 50%. Insect Sci. 18, 349-362.

Suh, H.J., Lee, J.M., Cho, J.S., Kim, Y.S., Chung, S.H., 1999. Radical scavenging

compounds in onion skin. F. Res. Int., 32, 659-664.

Sundaraj, S., Srinivasan, R., Culbreath, A.K., Riley, D.G., Pappu, H.R., 2014. Host

plant resistance against Tomato spotted wilt virus in peanut (Arachis

hypogaea) and its impact on susceptibility to the virus, virus population

genetics, and vector feeding behavior and Survival. Phytopathology 104, 202–

210.

Tajima, F., 1989. Statistical method for testing the neutral mutationhypothesis by

DNA polymorphism. Genetics 123, 585-595.


159

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011.

MEGA5: molecular evolutionary genetics analysis using maximum likelihood,

evolutionary distance, and maximum parsimony methods. Mol. Boil. Evol. 28,

2731-2739.

Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6:

Molecular Evolutionary Genetics Analysis version 6.0. Mol. Biol. Evol. 30,

2725-2729

Teacher, A.G.F., Griffiths, D.J., 2011. HapStar: automated haplotype network layout

and visualization. Mol. Ecol. Res. 11, 1512153.

Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the

sensitivity of progressive multiple sequence alignment through sequence

weighting, position-specific gap penalties and weight matrix choice. Nucl.

acids Res. 22, 4673-4680.

ThripsWiki, 2014. ThripsWiki - providing information on the World’s thrips.

Available from: http://thrips.info/wiki/ (Accessed 3March 2014).

Tillekaratne, K., Mound, L.A., Strassen, R.Z., Edirisinghe, J.P., 2007. List of thrips

(Thysanoptera) recorded from Sri Lanka. J. Nat. Sci. Found. Sla. 35, 197-205.

Tillekaratne, K., Edirisinghe, J.P., Gunatilleke, C.V.S., Karunaratne, W.A.I.P., 2011.

Survey of thrips in Sri Lanka: A checklist of thrips species, their distribution

and host plants. Ceylon J. Sci. (Biol. Sci.), 40, 89-108.

Timm, A.E., Stiller, M., Frey, J.E., 2008. A molecular identification key for

economically important thrips species (Thysanoptera: Thripidae) in southern

Africa. Afr. Entomol. 16, 68-75.

Toda, S., Komazaki, S., 2002. Identification of thrips species (Thysanoptera:

Thripidae) on Japanese fruit trees by polymerase chain reaction and restriction

fragment length polymorphism of the ribosomal ITS2 region. Bull. Entomol.

Res. 92, 359-363.


160

Tommasini, M., Maini, S., 1995. Frankliniella occidentalis and other thrips harmful

to vegetable and ornamental crops in Europe. Wageningen Agric. Uni. Papers

(95-1): iii+ 1-42.

Trichilo, P.J., Leigh, T.F., 1986. Predation on spider mite eggs by the western flower

thrips, Frankliniella occidentalis (Thysanoptera: Thripidae), an opportunist in

a cotton agroecosystem. Environ. Entomol. 15, 821-825.

Trkulja, V., Mihic Salapura, J., Kovacic, D., Stankovic, I., Bulajic, A., Vucurovic, A.,

Krstic, B., 2013. First report of Iris yellow spot virus infecting onion in Bosnia

and Herzegovina. Plant Dis. 97, 430.

Trochoulias, T., Wright, W.E., Loebel, M.R., 1984. Use of insecticides to reduce

corky scab injury in bananas. Trop. Agric. (Trinidad), 61, 193-195.

Trontelj, P., Fišer, C., 2009. Cryptic species diversity should not be trivialised. Syst.

Biodivers. 7, 1-3

Tsompana, M., Moyer, J.W., 2008. Tospoviruses. In Mahy, B.W.J., Van

Regenmortel, M.H.V., (Eds.), Encyclopedia of Virology. Elsevier Ltd, Oxford,

UK. pp. 157-162.

Tunc, I., 1998. Thrips infestations of field crops in Turkey. Proc. 6th Intl. Sym.

Thysanoptera, 27 April-1 May 1998, Antalya, Turkey, pp. 145-150.

Turina, M., Tavella, L., Ciuffo, M., 2012. Tospoviruses in the Mediterranean Area.

Adv. Virus Res. 84, 403-437.

Ullman, D.E., Cho, J.J., Mau, R.F., Hunter, W.B., Westcot, D.M., Custer, D.M., 1992.

Thrips-tomato spotted wilt virus interactions: morphological, behavioral and

cellular components influencing thrips transmission. In: Harris, K.F.,

(ed.) Adv. Dis. vector Res. 9, 195-240.

Ullman, D.E., German, T.L., Sherwood, J.L., Westcot, D.M., Cantone, F.A., 1993.

Tospovirus replication in insect vector cells: immunocytochemical evidence


161

that the non-structural protein encoded by the sRNA of Tomato spotted wilt

tospovirus is present in thrips vector cells. Phytopathology 83, 456-463.

Ullman, D.E., Westcot, D.M., Chenault, K.D., Sherwood, J.L., German, T.L., Bandla,

M.D., Cantone, F.A., Duer, H.L., 1995a. Compartmentalization, intracellular

transport and autophagy of tomato spotted wilt tospovirus proteins in infected

thrips cells. Phytopathology 85, 644-654.

Ullman, D.E., German, T.L., Sherwood, J.L., Westcot, D.M., 1995b. Thrips

transmission of Tospoviruses: future possibilities for management. In: Parker,

B.L., Skinner, M., Lewis, T., (Eds) Thrips Biology and Management. Plenum

Press, New York, pp. 135-151.

Ullman, D.E., 1996. Thrips and Tospoviruses: Advances and Future Directions. Acta

Horticulture 431, 310-324

Ullman, D.E., Sherwood, J.L., German, T.L., Lewis, T., 1997. Thrips as vectors of

plant pathogens. In: Thrips as crop pests. pp. 539-565.

Ullman, D.E., Meideros, R., Campbell, L.R., Whitfield, A.E., Sherwood, J.L.,

German, T.L., 2002. Thrips as vectors of tospoviruses. Adv. Bot. Res. 36,

113-140.

Umar, M., Akram, W., Choi, J.K., Lee, J.J., 2004. Description of Neolimothrips

binervis (Kobus) (Thysanoptera: Thripidae: Chirothripini) from Pakistan, with

a New Locality Record. Entomol. Res. 34, 55-58.

Vaglia, T., Haxaire, J., Kitching, I.J., Meusnier, I., Rougerie, R., 2008. Morphology

and DNA barcoding reveal three cryptic species within the Xylophanes

neoptolemus and loelia species-groups (Lepidoptera: Sphingidae).

Zootaxa 1923, 18-36.

Valentini, A., Pompanon, F., Taberlet, P., 2009. DNA barcoding for

ecologists. Trends Ecol. Evol. 24, 110-117.


162

Vanhaecke, D., de Leaniz, C.G., Gajardo, G., Young, K., Sanzana, J., Orellana, G.,

Fowler, D., Howes, P., Monzon-Arguello, C., Consuegra, S., 2012. DNA

barcoding and microsatellites help species delimitation and hybrid

identification in endangered galaxiid fishes. PloS One 7, e32939.

Veer, V., 1978. Thrips flavus (Schrank) as pollinating agent. Indian J. Forest. 1, 278.

Velasquez-Valle, R., Reveles-Hernandez, M., 2011. Iris yellow spot virus detection

in the onion cultivation of Zacatecas, Mexico. Revista Mexicana de Ciencias

Agricolas 2, 971-978.

Vidyavati, H.G., Manjunatha, H., Hemavathy, J., Srinivasan, K., 2010. Hypolipidemic

and antioxidant efficacy of dehydrated onion in experimental rats. J. Food Sci.

Tech. 47, 55-60.

Vitousek, P.M., D’Antonio, C.M., Loope, L.L., Westbrooks, R., 1996. Biological

invasions as global environmental change. Am. Sci. 84, 468-478.

Virgilio, M., Backeljau, T., Nevado, B., Meyer, M.D., 2010. Comparative

performances of DNA barcoding across insect orders. BMC Bioinformatics,

11, 206.

Walia, J.J., Willemsen, A., Elci, E., Caglayan, K., Falk, B.W., Rubio, L., 2014.

Genetic variation and possible mechanisms driving the evolution of worldwide

Fig mosaic virus Isolates. Phytopathology 104, 108-114.

Walsh, K., Boonham, N., Barker, I., Collins, D.W., 2005. Development of a

sequence-specific real-time PCR to the melon thrips Thrips palmi (Thysan.,

Thripidae). J. Appl. Entomol. 129, 272-279.

Ward, L.I., Perez-Egusquiza, Z., Fletcher, J.D., Ochoa Corona, F.M., Tang, J.Z.,

Liefting, L.W., Martin, E.J., Quinn, B.D., Pappu, H.R., Clover, G.R.G., 2008.

First Report of Iris yellow spot virus on Allium cepa in New Zealand. New

Dis. Rep. 58, 406.


163

Webb, S., Tsai, J., Mitchell, F., 1998. Bionomics of Frankliniella bispinosa and its

transmission of Tomato spotted wilt virus. In: Peters, D., Goldbach, R. (Eds.),

Recent Progress in Tospovirus and Thrips Research. Wageningen, pp. 67.

Webb, J.M., Jacobus, L.M., Funk, D.H., Zhou, X., Kondratieff, B., Geraci, C.J.,

DeWalt, R.E., Baird, D.J., Richard, B., Phillips, L., Hebert, P.D.N., 2012. A

DNA barcode library for North American Ephemeroptera: progress and

prospects. PloS One 7, e38063.

Westmore, G.C., Poke, F.S., Allen, G.R., Wilson, C.R., 2013. Genetic and host-

associated differentiation within Thrips tabaci Lindeman (Thysanoptera:

Thripidae) and its links to Tomato spotted wilt virus-vector

competence. Heredity 111, 210-215.

Whiteman, J.A., Rao, G.V.R., 1994, Groundnut Pests. In: Groundnut (Smart, J., eds)

London, UK: Chapman and Hall. pp 349-473.

Whitfield, A.E., Ullman, D.E., German, T.L., 2005. Tospovirus-thrips

interactions. Annu. Rev. Phytopathol., 43, 459-489.

Whitfield, A.E., Kumar, N.K.K., Rotenberg, D., Ullman, D.E., Wyman, E.A.,

Zietlow, C., Willis, D.K., German, T.L., 2008. A soluble form of the Tomato

spotted wilt virus (TSWV) glycoprotein GN (GN-S) inhibits transmission of

TSWV by Frankliniella occidentalis. Phytopathology 98, 45-50.

Wijkamp, I., Peters, D., 1993a. Determination of the median latent period of two

tospoviruses in Frankliniella occidentalis, using a novel leaf disk assay.

Phytopathology 83, 986-991.

Wijkamp, I., van Lent, J., Kormelink, R., Goldbach, R., Peters, D., 1993b.

Multiplication of tomato spotted wilt virus in its insect vector, Frankliniella

occidentalis. J. Gen. Virol. 74, 341-349.


164

Wijkamp, I., Almarza, N., Goldbach, R., Peters, D., 1995. Distinct levels of

specificity in thrips transmission of tospoviruses. Phytopathology 85, 1069-

1074.

Widana Gamage, S.M.K., Hassani-Mehraban, A., Peters, D., 2010. Identification of

Iris yellow spot virus on Leek (Allium porrum) in Sri Lanka. Plant Dis. 94,

1070.

Wilson, T.H., 1975. A monograph of the sub family panchaetothripinae

(Thysanoptera: Thripidae). J. Entomol. Soc. South. Afr. 23, 1-354.

Wilson, L.J., Bauer, L.R., Walter, G.H., 1996. ‘Phytophagous’ thrips are facultative

predators of two spotted spider mites (Acari: Tetranychidae) on cotton in

Australia. Bull. Entomol. Res. 86, 297-305.

Witt, J.D., Hebert, P.D.N., 2000. Cryptic species diversity and evolution in the

amphipod genus Hyalella within central glaciated North America: a molecular

phylogenetic approach. Can. J. Fish. Aquat. Sci. 57, 687-698.

Yamasaki, T., Li, L., Lau, B.H.S., 1994. Garlic compounds protect vascular

endothelial cells from hydrogen peroxide-induced oxidant injury. Phytother.

Res. 8, 408-412.

Young, M.R., Behan-Pelletier, V.M., Hebert, P.D.N., 2012. Revealing the

hyperdiverse mite fauna of subarctic Canada through DNA barcoding. PLoS

One 7, e48755.

Zahiri, R., Lafontaine, J.D., Schmidt, B.C., deWaard, J.R., Zakharov, E.V., Hebert,

P.D.N., 2014. A transcontinental challenge - A test of DNA barcode

performance for 1,541 species of Canadian Noctuoidea (Lepidoptera). PLoS

One 9, e92797.

Zawirska, I., 1976. Untersuchungen u¨ ber zwei biologische Typen von Thrips tabaci

Lind. Thysanoptera, Thripidae) in der VR Polen. Arch. Phytopathol.

Pflanzenschutz 12, 411-422.


165

Zen, S., Okuda, M., Ebihara, K., Uematsu, S., Hanada, K., Iwanami, T., Nakashima,

S., 2005. Genetic characterization of Iris yellow spot virus on onion (Allium

cepa) and pathogenicity of two IYSV strains on onion and leaf onion (A.

schoenoprasum). Jpn. J. Phytopathol. 71, 123-126

Zhang, J.B., Hanner, R., 2011. DNA barcoding is a useful tool for the identification of

marine fishes from Japan. Biochem. Syst. Ecol. 39, 31-42.

Zherikhin, V.V., 2002. Order Thripida. History of Insects (Ed. By A.P. Rasnitsyn and

D.L.J. Quicke), Kluwer Academic Publishers, Norwell, Massachusetts, pp.

133-143.

Zhou, X., Robinson, J.L., Geraci, C.J., Parker, C.R., Flint, Jr, O.S., Etnier, D.A.,

Ruiter, D., DeWalt, R.E., Jacobus, L.M., Hebert, P.D.N., 2011. Accelerated

construction of a regional DNA-barcode reference library: caddisflies

(Trichoptera) in the Great Smoky Mountains National Park. J. N. Am.

Benthol. Soc. 30, 131-162.

Zur Strassen, R., 2003. Die terebranten Thysanopteren Europas und des Mittelmeer-

Gebietes. Tierw. Deutschl. 74, 1‒277.

Appendices

166

APPENDICES

Appendix 1

Buffer Formulations

Coating Buffer (1X) Dissolve in distilled water to 1000 ml:

Sodium carbonate (anhydrous) 1.59 g

Sodium bicarbonate 2.93 g

Sodium azide 0.2 g

Adjust pH to 9.6. Store at 4° C.

Wash Buffer (1X-PBST) Dissolve in distilled water to 1000 ml:

Sodium chloride 8.0 g

Sodium phosphate, dibasic (anhydrous) 1.15 g

Potassium phosphate, monobasic (anhydrous) 0.2 g

Potassium chloride 0.2 g

Tween-20 0.5 g

Adjust pH to 7.4

Extract Buffer (EB 1X) Dissolve in 1000 ml of 1X PBST:

Sodium sulfite (anhydrous) 1.3 g

Polyvinylpyrrolidone (PVP) MW 24-40,000 20.0 g

Sodium azide 0.2 g

Powdered egg (chicken) albumin, Grade II 2.0 g

Tween-20 20.0 g

Adjust pH to 7.4. Store at 4°C.

Antibody dilution buffer (1X) Add to 1000 ml 1X PBST:

Bovine serum albumin (BSA) 2.0 g

Polyvinylpyrrolidone (PVP) MW 24-40,000 20.0 g

Sodium azide 0.2 g

Adjust pH to 7.4. Store at 4° C.

Substrate Buffer (1X) Dissolve in 800 ml distilled water:

Magnesium chloride hexahydrate 0.1 g

Sodium azide 0.2 g

Diethanolamine 97.0 ml

Appendices

167

Adjust pH to 9.8 with hydrochloric acid. Adjust final volume to

1000 ml with distilled water. Store at 4° C.

Appendix 2

RNA isolation from plant leaf

Plant tissue samples (100-300 mg) were ground in liquid nitrogen using pestle and

mortar and subsequently mixed in 450 µl buffer (445 µl RLT+ 5 µl βME). The

mixtures were transferred to eppendorf tubes and incubated at 56°C for 3 minutes for

lysis. The lysate was transferred into QIA spin shedder (Lilac column) and

centrifuged at 13000 rpm for 2 minutes. The supernatant of the flow through was

transferred to a new eppendorf tube and 0.5 volume of 100% ethanol was added to the

clear lysate in each tube and mixed immediately by pipetting or inverting the tubes 6-

8 times. Samples were then transferred to an RNeasy spin column (Pink column) in a

2 ml collection tube and centrifuged for 1 minute at 13000 rpm. The flow through was

discarded and 700 µl buffer RW1 was added to these RNeasy spin column and

centrifuged for 1 minute at 13000 rpm. Flow through was discarded and 500 µl buffer

RPE was added to the RNeasy spin column and centrifuged for 1 minute at 13000

rpm. Flow through was discarded again and 500 µl buffer RPE was added to the

RNeasy spin column and centrifuged for 2 minute at 13000 rpm. After discarding the

flow through, the RNeasy spin columns were placed into the new 1.5ml eppendorf

tubes and 30-50 µl RNeasy free water was added to the spin column membrane and

placed on ice for 2 minutes. The RNA was eluted for 1 minute at 13000 rpm.

RNA isolation from plant leaf

Plant leaf less than 0.5 gm was ground to fine powder in liquid N2 and added to

it 750 µL RNA extraction buffer and 750 μL phenol:water (3.75:1) and mixed

by vortexing

Centrifuge for 5 min at RT at 13000 rpm

Aqueous phase was collected into new eppendorf tube

Added to it 1/10 NaAc 3M+2 Volumes of 100% ethanol

Incubate O/N or 2 h at -20°C

Appendices

168

Centrifuge 30 min at 4°C

Wash the pellet with 70% ethanol

Aspirate liquid carefully

Air dry 10 min

Suspend in 50 µL DEPC treated SDW

Put on 37°C for 2-3 min to completely dissolve the pellet

Vortex briefly

Spin @12000rpm for 2min

Take supernatant (RNA) leaving behind debris if any.

RNA extraction buffer for plant RNA extraction

200mM Tris HCl pH 8

100mM LiCl

5mM EDTA pH8

1% SDS

2.5 mg/ml bentonite

Appendix 3

cDNA synthesis

RNA template 5 μL (1-1.5 μg)

Oligodt primer (or Gene specific reverse primer) 1 μL

DEPC treated SDW 6 μL

Mix by pipetting up and down and spin down for 3-5 sec.

Incubate at 70°C for 5 min

Chill on ice

1X 10X

Add 5X reaction buffer 4 μL 40 μL

Add Ribonuclease inhibitor 1 μL 10 μL

dNTP 2 μL 20 μL

Appendices

169

Mix, spin and incubate at 37°C for 5 min

Add Revert Aid reverse transcriptase enzyme 1 μL 10 μL

Incubate at 42°C for 60 min

Finally incubate at 70°C for 10 min

Chill on ice briefly.

Now this cDNA can be used as template for amplification of desired gene by PCR.

Appendix 4

Fermentas, 1 kb DNA ladder

50X Tris-acetate EDTA buffer (TAE)

For 1 liter 50X TAE add:

Tris base 242.0 g

0.5 M EDTA (pH 8.0) 100.0 ml

Glacial acetic acid 57.1 ml

Make up the final volume with distilled water to 1000 ml.

6X Gel loading buffer

Bromophenol blue 0.25% (w/v)

Xylene cyanol FF. 0.25% (w/v)

Glycerol 30.0% (v/v)

Appendices

170

Dissolve in distilled water.

Appendix 5

pGEM®-T Easy vector map

Appendix 6

LB (Luria-Bertini) liquid

Tryptone 1.0 %

Yeast extract 0.5 %

NaCl 0.5 %

Dissolve in dH2O. Adjust pH to 7.5 and autoclave.

Appendix 7

LB (Luria-Bertini) agar medium

Tryptone 1.0 %

Yeast extract 0.5 %

NaCl 0.5 %

Adjust pH 7.5 then add

Bacto agar 1.5 %

Appendices

171

Dissolve in dH2O and autoclave, then cool down to 40-45°C and add appropriate

antibiotic in desired concentration. Mix well and pour into the plates.

Appendix 8

X-Gal

Dissolve 200 mg X-Gal (5-bromo-4-chloro-3-3indolyl-B-D- alactopyranoside)

in 10 ml N, N-dimethylformamide (DMF). Store at -20°C and protect from light. Use

20 µL per plate.

IPTG

Dissolve 1.2 g IPTG (isopropyl- B-D- thiogalactopyranoside) in 50 ml of

deionized water. Filter-sterilize, aliquot and store at -20°C. Use 20 µL per plate.

Appendix 9

Preparation of heat shock competent cells of E. coli strain Top 10

50 ml LB media was inoculated with a single fresh grown colony of E. coli top

10 strain in 250 ml flask and incubated with vigorous shaking overnight at 37°C. Next

day 200 ml fresh LB media was inoculated with 2 ml of previous culture in 1 liter

flask and incubate at 37°C with vigorous shaking until OD of culture reaches to 1.

Normally it takes 3-4 h. Cool down the cells by putting on ice for 30 min. Transfer the

culture to sterile 50 ml falcon tubes and centrifuge for 10 min at 4000 rpm and 4°C.

Discard supernatant and dissolve the pellet in 15 ml of 0.1M CaCl2. Cells were

incubated on ice for 30 min and then centrifuged again as previously for 8 min. Again

pellet was re-suspended in 5 ml of 0.1M CaCl2. 100% glycerol was added dissolved

properly and make aliquots to save on -70°C.

Appendix 10

Plasmid isolation from E. coli by alkaline lysis method

Miniprep Solutions

Solution A (Suspension solution)

Appendices

172

Tris (pH 7.4-7.6) 50 mM

EDTA 1 mM

RNase 100 μg/ml

Store at 4°C

Solution B (Lysis solution)

NaOH 0.2 N

SDS 1 %

Keep it in sterile plastic bottle. In glass bottle it precipitates.

Solution C (Neutralization solution)

Potassium acetate 3 M

Glacial acetic acid 11.5 ml/100 ml

(pH 4.8-5.0)

A single transformed E. coli colony was grown overnight at 37°C in 3 ml liquid

LB medium containing required antibiotic.

The above culture was centrifuged in 1.5 ml eppendorf tube for 1 min.

The supernatant was decanted.

Pellet was re-suspended in 150 μL of re-suspension solution.

250 μL of lysis solution was added to eppendorf tube and mixed well by inverting

gently for 5-6 times.

250 μL of neutralization solution was added to eppendorf tube mixed well and

then centrifuged for 5 min.

Take supernatant and add equal volume of phenol:chloroform:isoamylalcohl

(24:24:1)

Mix and centrifuge for 5 min

Take top layer carefully and add 2.5 volume of chilled 95% ethanol

Centrifuge for 10 min discard supernatant carefully leaving behind pellate

Wash pellate with 75% ethanol and air dry pellete

Dissolve the plasmid DNA pellete in appropriate volume of sterile d3H2O

Appendices

173

Appendix 11

Miniprep protocol (Plasmid isolation)

GeneJETTm

Plasmid Miniprep Kit, Fermentas cat no. K0503 was used for

plasmid isolation following the manufacturer’s protocol as under. All centrifugations

were carried out at > 12000Xg at room temperature.

A single transformed E. coli colony was grown overnight at 37°C in 3 ml liquid

LB medium containing required antibiotic.

The above culture was centrifuged in 1.5 ml eppendorf tube for 1 min.

The supernatant was decanted.

Pellet was re-suspended in 250 μL of re-suspension solution.

250 μL of lysis solution was added to eppendorf tube and mixed well by

inverting gently for 5-6 times.

350 μL of neutralization solution was added to eppendorf tube mixed well and

then centrifuged for 5 min.

The supernatant was loaded onto the column and centrifuged for 1 min.

Flow through was discarded and 500 μL wash solution was added to the column

and centrifuge for 1 min. This step was repeated two times.

Empty column was centrifuged for 1 min to dry the column.

Elute the DNA by adding 50 μL of elution buffer to the column and spin the

column for 2 min and store the DNA at-20°C.

Supplementary tables

174

Supplementary Table 1: Process ID of barcoded specimens, country of origin,

code used for each accession in haplotype analysis and Haplotype ID (Fig. 4.8).

a) Thrips tabaci

Sr.no. Process ID Country name My code Haplotype

1 SSWLE9584-13 CANADA CANADA1 Hap-01

2 GBA8566-12 CHINA CHINA1 Hap-01

3 GBMHT126-13 PERU PERU1 Hap-02

4 GBMIN19813-13 TANZANIA TANZANIA1 Hap-03

5 GBMIN19819-13 USA USA1 Hap-04

6 GMGRE2905-13 GERMANY GERMANY1 Hap-04

7 MATHR193-11 PAKISTAN PAKISTAN1 Hap-01




11 NGNA1221-13 CANADA CANADA2 Hap-01

12 NORTH090-11 NORWAY NORWAY1 Hap-04

13 RFTHY112-10 CANADA CANADA3 Hap-04

14 SSJAE4187-13 CANADA CANADA4 Hap-01

15 SSWLD1263-13 CANADA CANADA5 Hap-05


17 GBMHT133-13 JAPAN JAPAN1 Hap-03



20 GBMIN19852-13 MADAGASCAR MG1 Hap-04

21 GBMIN19854-13 TANZANIA TANZANIA2 Hap-03

22 GBMIN21886-13 SERBIA SERBIA1 Hap-02


24 GBMIN39464-13 JAPAN JAPAN3 Hap-08

25 GBMIN40725-13 UNITED KINGDOM UK1 Hap-04

26 GBMIN40854-13 BOSNIA HERZEGOVINA BA1 Hap-04





31 NGNAG1524-13 CANADA CANADA7 Hap-04

32 RFTHY051-10 AUSTRALIA AUSTRALIA1 Hap-01


34 SMTPD3379-13 CANADA CANADA9 Hap-01



37 GBMHT113-13 USA USA3 Hap-08

38 GBMHT331-13 INDIA INDIA1 Hap-01





43 GBMIN30384-13 CHINA CHINA2 Hap-01

44 GBMIN40730-13 BOSNIA HERZEGOVINA BA2 Hap-08







175


51 SIOCA253-10 CANADA CANADA12 Hap-01

52 SSJAF5104-13 CANADA CANADA13 Hap-01

53 SSWLD319-13 CANADA CANADA14 Hap-01

54 RBINA4647-13 CANADA CANADA15 Hap-04

55 SSBAD3516-12 CANADA CANADA16 Hap-01




59 CNBAN620-13 AUSTRALIA AUSTRALIA2 Hap-08











70 GMGRG4019-13 GERMANY GERMANY2 Hap-04





75 SSJAF4380-13 CANADA CANADA21 Hap-01


77 BBTHW047-10 CANADA CANADA23 Hap-01













90 RFTHY043-10 AUSTRALIA AUSTRALIA3 Hap-12




94 SSWLF2949-13 CANADA CANADA27 Hap-01

95 CNRMD1595-12 CANADA CANADA28 Hap-01










105 GBMIN40734-13 ISRAEL ISRAEL1 Hap-07


176




109 NGNAC2366-13 CANADA CANADA29 Hap-01


111 SSWLF4845-13 CANADA CANADA31 Hap-01















126 RBINA4648-13 CANADA CANADA32 Hap-01


128 SSWLB333-13 CANADA CANADA34 Hap-01




















148 SSJAD3291-13 CANADA CANADA39 Hap-01

149 SSWLB1342-13 CANADA CANADA40 Hap-05




b) Thrips palmi

Sr. no. Process ID Country name My code Haplotype



3 GBMIN40735-13 THAILAND THAILAND1 Hap-02

4 GBMIN40373-13 INDIA INDIA1 Hap-03


177



7 GBMIN40861-13 DOMINICAN REPUBLIC DO1 Hap-05















22 GBA8454-12 INDIA INDIA4 Hap-10














36 MAIMB471-09 PAKISTAN PAKISTAN9 Hap-11


























178


























































179

























c) Scirtothrips dorsalis

S. no. Process ID Country name My code Haplotype














14 GBA8455-12 INDIA INDIA14 Hap-01















180















42 GBA8577-12 CHINA CHINA Hap-11


d) Thrips flavus

Sr. no. Process ID Country name My code Haplotype

























25 MAMTJ1058-12 PAKISTAN PAKISTAN22 Hap-06












181











































78 MAMTH1053-12 PAKISTAN PAKISTAN70 Hap-06















182






















183

Supplementary Table 2: Initial Partition of thrips species using molecular data

of barcode region (COI-5 end sequences)

Group Species No. of

specimen

Process ID

1 Aeolothrips PK01 1 MATHR092-10 2 Aeolothrips PK02 3 MATHR304-11; MATHR449-12; MATHR301-11 3 Aeolothrips intermedius 13 MATHR302-11; MATHR305-11; MATHR426-12;

MATHR420-12; MATHR107-10; MATHR290-11;



MATHR303-11

4 Ananthakrishnana euphorbiae 1 MATHR454-12

5 Anaphothrips sudanensis 1 MATHR306-11 6 Apterygothrips pellucidus 2 MATHR287-11; MATHR273-11 7 Arorathrips mexicanus 3 MATHR188-10; MATHR003-10; MATHR187-10

8 Chaetanaphothrips orchidii 4 MATHR430-12; MATHR165-10; MATHR429-12;

MATHR166-10

9 Chirothrips meridionalis 4 MATHR004-10; MATHR434-12; MAMTJ1057-12;

MAMTJ1059-12 10 Dendrothripoides innoxius 8 MATHR001-10; MATHR277-11; MATHR081-10;


MATHR005-10; MATHR008-10

11 Frankliniella schultzei 22 MATHR062-10; MATHR364-11; MATHR367-11;


MAIMB477-09; MAIMB478-09; MAIMB479-09;

MAIMB481-09; MAIMB482-09; MATHR010-10;




MATHR361-11

12 Haplothrips andresi 6 MATHR121-10; MATHR095-10; MATHR054-10;

MATHR055-10; MATHR056-10; MATHR336-11

13 Haplothrips bagrolis 1 MATHR314-11

14 Haplothrips ciliatus 5 MATHR120-10; MATHR118-10; MATHR117-10;


15 Haplothrips ganglbaueri 39 MATHR256-11; MATHR255-11; MATHR254-11;













16 Haplothrips gowdeyi 1 MATHR050-10

17 Haplothrips PK01 1 MATHR458-12

18 Haplothrips reuteri 8 MATHR423-12; MATHR452-12; MATHR422-12;


MATHR459-12;MATHR455-12

19 Haplothrips stylatus 1 MATHR126-10

20 Haplothrips tenuipennis 25 MATHR052-10; MATHR053-10; MATHR057-10;









184

MATHR468-12

21 Hydatothrips atactus 1 MATHR002-10

22 Lefroyothrips lefroyi 1 MAMTX200-14

23 Liothrips infrequens 1 MATHR432-12

24 Megalurothrips pecularis 10 MATHR108-10; MATHR027-10; MATHR102-10;



MATHR034-10

25 Megalurothrips usitatus 5 MATHR084-10; MATHR015-10; MATHR099-10;



abdominalis 15 MATHR039-10; MATHR041-10; MATHR042-10;





27 Mycterothrips nilgiriensis 1 MATHR427-12

28 Neohydatothrips samayunkur 7 MATHR143-10; MATHR144-10; MATHR145-10;


MATHR104-10 29 Phlaeothripidae PK01 1 MAMTI1553-12

30 Phlaeothripidae PK02 6 MAMTF1456-12; MAMTI1556-12; MAMTF1455-12;

MAMTF1457-12; MAMTI1551-12; MAMTF1461-12

31 Plicothrips apicalis 15 MATHR337-11; MATHR026-10; MAMTJ1056-12;

MAMTN1009-13; MAMTO609-13; MAMTN1010-

13; MAMTN1007-13; MAMTN1013-13;

MAMTN1011-13; MAMTI1550-12; MAMTN1012-

13; MAMTN1014-13; MAMTN1016-13;

MAMTN1008-13; MAMTO608-13

32 Pseudodendrothrips bhattii 1 MATHR049-10 33 Scirtothrips dorsalis 10 MATHR387-12; MATHR386-12; MATHR381-12;


MAIMB475-09; MATHR215-11; MAIMB465-09;

MAIMB467-09 34 Scirtothrips oligochaetus 1 MATHR360-11 35 Scolothrips rhagebianus 1 MATHR354-11 36 Taeniothrips major 4 MATHR103-10; MATHR021-10; MATHR033-10;

MATHR111-10 37 Thripidae PK01 3 MATHR399-12; MATHR408-12; MATHR412-12

38 Thripidae PK02 5 MATHR098-10; MATHR097-10; MATHR139-10;


39 Thripidae PK03 1 MAMTW356-14

40 Thrips alatus 2 MATHR029-10; MATHR175-10 41 Thrips apicatus 5 MATHR325-11; MATHR248-11; MATHR278-11;

MATHR279-11; MATHR214-11 42 Thrips carthami 7 MATHR162-10; MATHR159-10; MATHR149-10;


MATHR163-10 43 Thrips coloratus 15 MATHR132-10; MATHR392-12; MATHR066-10;




MATHR170-10; MATHR135-10; MATHR134-10 44 Thrips decens 1 MATHR137-10 45 Thrips flavus 104 MATHR243-11; MATHR244-11; MATHR245-11;












185
























MATHR340-11; MATHR475-12 46 Thrips florum 2 MATHR153-10; MATHR158-10 47 Thrips hawaiiensis 2 MATHR315-11; MATHR385-12 48 Thrips palmi 36 MATHR213-11; MAIMB460-09; MATHR345-11;










MAIMB470-09; MAIMB469-09;MAIMB466-09;

MAIMB463-09; MAIMB462-09; MAIMB461-09 49 Thrips palmi 8 MATHR185-10; MATHR184-10; MATHR182-10;


MATHR356-11; MATHR358-11 50 Thrips PK01 1 MATHR160-10 51 Thrips PK02 7 MATHR072-10; MATHR044-10; MATHR045-10;


MATHR073-10 52 Thrips tabaci 36 MATHR199-11; MATHR352-11; MATHR349-11;











MATHR203-11; MATHR200-11; MATHR357-11 53 Thrips trehernei 4 MATHR402-12; MATHR424-12; MATHR425-12;

MATHR451-12


186

Supplementary Table 3: Recursive Partition of thrips species using molecular

data of barcode region (COI-5 end sequences)

Group Species BOLD ID No. of

specimen

Process ID

1 Aeolothrips intermedius BOLD:

AAZ8618

10 MATHR302-11; MATHR305-11;

MATHR107-10; MATHR290-11;




2 Aeolothrips intermedius BOLD:

AAU0572

3 MATHR426-12; MATHR420-12;

MATHR431-12

3 Aeolothrips PK01 BOLD:

AAN6626

1 MATHR092-10

4 Aeolothrips PK02 BOLD:

AAZ8619

3 MATHR304-11; MATHR449-12;

MATHR301-11

5 Ananthakrishnana

euphorbiae BOLD:

ACA2783

1 MATHR454-12

6 Anaphothrips sudanensis BOLD:

AAV3388

1 MATHR306-11

7 Apterygothrips pellucidus BOLD:

AAY6328

2 MATHR287-11; MATHR273-11

8 Arorathrips mexicanus BOLD:

AAN5064

3 MATHR188-10; MATHR003-10;

MATHR187-10

9 Chaetanaphothrips

orchidii

BOLD:

AAP7685

4 MATHR430-12; MATHR165-10;


10 Chirothrips meridionalis BOLD:

AAN5797

4 MATHR004-10; MATHR434-12;

MAMTJ1057-12; MAMTJ1059-12

11 Dendrothripoides

innoxius

BOLD:

AAN5065

8 MATHR001-10; MATHR277-11;




12 Frankliniella schultzei BOLD:

AAN6620

22 MATHR062-10; MATHR364-11;



MAIMB477-09; MAIMB478-09;


MAIMB482-09; MATHR010-10;






13 Haplothrips andresi BOLD:

AAN5799

6 MATHR121-10; MATHR095-10;



14 Haplothrips bagrolis BOLD:

AAZ8515

1 MATHR314-11

15 Haplothrips ciliatus BOLD:

AAU5460

5 MATHR120-10; MATHR118-10;


MATHR123-10

16 Haplothrips ganglbaueri BOLD:

ACF1370

39 MATHR256-11; MATHR255-11;











187










MATHR257-11

17 Haplothrips gowdeyi BOLD:

AAN5798

1 MATHR050-10

18 Haplothrips PK01 BOLD:

ACA2828

1 MATHR458-12

19 Haplothrips reuteri BOLD:

ACA2784

7 MATHR423-12; MATHR452-12;


MATHR421-12; MATHR459-

12;MATHR455-12

20 Haplothrips reuteri BOLD:

AAI6863

1 MATHR397-12

21 Haplothrips stylatus BOLD:

AAI6863

1 MATHR126-10

22 Haplothrips tenuipennis BOLD:

AAN4488

25 MATHR052-10; MATHR053-10;












MATHR468-12

23 Hydatothrips atactus BOLD:

AAN9110

1 MATHR002-10

24 Lefroyothrips lefroyi BOLD:

ACI6048

1 MAMTX200-14

25 Liothrips infrequens BOLD:

ACA2829

1 MATHR432-12

26 Megalurothrips pecularis BOLD:

AAN6623

10 MATHR108-10; MATHR027-10;





27 Megalurothrips usitatus BOLD:

AAM8053

5 MATHR084-10; MATHR015-10;


MATHR114-10


abdominalis

BOLD:

AAI0410

15 MATHR039-10; MATHR041-10;







MATHR040-10

29 Mycterothrips

nilgiriensis

BOLD:

ACA2806

1 MATHR427-12

30 Neohydatothrips

samayunkur

BOLD:

AAP7680

7 MATHR143-10; MATHR144-10;



MATHR104-10


188

31 Phlaeothripidae PK01 BOLD:

ACA9557

1 MAMTI1553-12

32 Phlaeothripidae PK02 BOLD:

ACK3864

6 MAMTF1456-12; MAMTI1556-

12; MAMTF1455-12;

MAMTF1457-12; MAMTI1551-

12; MAMTF1461-12

33 Plicothrips apicalis BOLD:

AAN6622

15 MATHR337-11; MATHR026-10;

MAMTJ1056-12; MAMTN1009-

13; MAMTO609-13;

MAMTN1010-13; MAMTN1007-

13; MAMTN1013-13;

MAMTN1011-13; MAMTI1550-

12; MAMTN1012-13;

MAMTN1014-13; MAMTN1016-

13; MAMTN1008-13;

MAMTO608-13

34 Pseudodendrothrips

bhattii

BOLD:

ACG8261

1 MATHR049-10

35 Scirtothrips dorsalis BOLD:

AAC9748

10 MATHR387-12; MATHR386-12;



MAIMB475-09; MATHR215-11;

MAIMB465-09; MAIMB467-09 36 Scirtothrips oligochaetus BOLD:

AAZ8518

1 MATHR360-11

37 Scolothrips rhagebianus BOLD:

AAZ8517

1 MATHR354-11

38 Taeniothrips major BOLD:

AAN6621

4 MATHR103-10; MATHR021-10;


39 Thripidae PK01 BOLD:

ACA3048

3 MATHR399-12; MATHR408-12;

MATHR412-12


AAP7681

5 MATHR098-10; MATHR097-10;


MATHR146-10


ACP4916

1 MAMTW356-14

42 Thrips alatus BOLD:

AAN6625

2 MATHR029-10; MATHR175-10

43 Thrips apicatus BOLD:

AAY6262

5 MATHR325-11; MATHR248-11;


MATHR214-11 44 Thrips carthami BOLD:

AAP7682

7 MATHR162-10; MATHR159-10;



MATHR163-10 45 Thrips coloratus BOLD:

AAK1804

15 MATHR132-10; MATHR392-12;







MATHR134-10 46 Thrips decens BOLD:

AAP7679

1 MATHR137-10

47 Thrips flavus BOLD:

AAN6624

104 MATHR243-11; MATHR244-11;








189













































MATHR340-11; MATHR475-12 48 Thrips florum BOLD:

AAP7683

2 MATHR153-10; MATHR158-10

49 Thrips hawaiiensis BOLD:

AAZ8516

2 MATHR315-11; MATHR385-12

50 Thrips palmi BOLD:

AAN2747

36 MATHR213-11; MAIMB460-09;
















190



MAIMB462-09; MAIMB461-09 51 Thrips palmi BOLD:

AAE7913

8 MATHR185-10; MATHR184-10;



MATHR356-11; MATHR358-11 52 Thrips PK01 BOLD:

AAP7684

1 MATHR160-10

53 Thrips PK02 BOLD:

AAN9111

7 MATHR072-10; MATHR044-10;



MATHR073-10 54 Thrips tabaci BOLD:

AAB3870

32 MATHR199-11; MATHR352-11;















MATHR200-11; MATHR357-11 55 Thrips tabaci BOLD:

AAB3870

4 MATHR316-11; MATHR201-11;


56 Thrips trehernei BOLD:

AAN9105

4 MATHR402-12; MATHR424-12;


dna based analysis of thrips diversity and thrips...

Documents