development of an in-vitro organoid assay to study ... · dysfunction occurs: alzheimer’s,...
TRANSCRIPT
Development of an In-vitro Organoid Assay to Study Engraftment of Photoreceptor Precursors
by
En Leh Samuel Tsai
A thesis submitted in conformity with the requirements for the degree of Master of Science
Department of Laboratory Medicine and Pathobiology University of Toronto
© Copyright by En Leh Samuel Tsai, 2017
ii
Development of an In-vitro Organoid Assay to Study Engraftment
of Photoreceptor Precursors
En Leh Samuel Tsai
Master of Science
Department of Laboratory Medicine and Pathobiology University of Toronto
2017
Abstract
Labeled cells in the host retina following transplantation of reporter-labeled donor cells were
thought to arise from donor cell migration and engraftment into the tissue, but more recently this
interpretation has been challenged with new findings that material transfer occurs between host
and donor photoreceptors. In-vivo studies are laborious and impractical to investigate the
mechanisms of cell engraftment. As such, we have developed a simpler in-vitro assay that uses
retinal organoids to monitor photoreceptor precursor engraftment. Dissociated retinal cells have
the propensity to self-organize and form spherical laminated structures or organoids that have
features in common with normal retinal organization. Here, we characterize the cellular
composition and the cell type requirement for efficient organoid formation. We have further
developed an engraftment assay, established a cell integration baseline and shown the application
of this assay to models of retinal degeneration.
iii
Acknowledgments
I would like to offer my sincere gratitude my supervisor, Dr. Valerie Wallace, for her invaluable
mentorship and guidance during my time as a graduate student. Her incredible aptitude as a
scientist is rivaled only by her genuine care for her students. I would also like to thank Dr.
Phillipe Monnier, Dr. Jeremy Sivak and Dr. van der Kooy for taking the time to be on my
committee and for their indispensable advice and guidance throughout my project. I would also
like to thank all the members in the Wallace Lab for their unwavering support and for making
my time in the lab truly memorable. Special shout out to Sheila for teaching me and establishing
the groundwork for my project, Cre for being such a supportive motherly figure, Arturo for being
the most fabulous ‘la passion’ to ever set foot in the lab and Phil for being a hoot and helping me
write. Finally, I would like to thank my parents, Joseph and Ella, my brother, Matthew, and my
girlfriend, Alice, for their unconditional love and support through this process. And to anyone
who fully reads this thesis, I thank you for validating the coffee, whisky and tears it took to write
this.
iv
Table of Contents
Acknowledgments.......................................................................................................................... iii
Table of Contents ........................................................................................................................... iv
List of Figures ............................................................................................................................... vii
List of Tables ............................................................................................................................... viii
List of Abbreviations ..................................................................................................................... ix
Chapter 1 ..........................................................................................................................................1
Background .................................................................................................................................1 1
1.1 General Overview ................................................................................................................1
Neurodegeneration ...................................................................................................1 1.
Retinal Degeneration and Repair .............................................................................2 2.
1.2 The Retina ............................................................................................................................3
Overview ..................................................................................................................3 1.
Anatomy and Function of the Retina .......................................................................4 2.
Photoreceptors..........................................................................................................6 3.
Phototransduction and the Pigment Epithelium .......................................................9 4.
Photoreceptor Development...................................................................................12 5.
Disease and Degeneration ......................................................................................15 6.
1.3 Photoreceptor Transplantation ...........................................................................................16
Overview ................................................................................................................16 1.
Lineage Specific Reporters ....................................................................................17 2.
Rod and Cone Photoreceptor Transplantation .......................................................18 3.
Material Transfer ...................................................................................................20 4.
v
1.4 Organoids ...........................................................................................................................20
Overview ................................................................................................................20 1.
Retinal Organoids ..................................................................................................22 2.
Chapter 2 ........................................................................................................................................26
Hypothesis and Rationale ..........................................................................................................26 2
2.1 Rationale ............................................................................................................................26
2.2 Hypothesis..........................................................................................................................26
2.3 Objectives ..........................................................................................................................26
Chapter 3 ........................................................................................................................................27
Materials and Methods ..............................................................................................................27 3
3.1 Animals and Genotyping ...................................................................................................27
3.2 Preparation of Glass Surface ..............................................................................................29
3.3 Organoid Formation ...........................................................................................................29
3.4 Engraftment Assay .............................................................................................................30
3.5 Fixation and Immunostaining ............................................................................................30
3.6 Confocal Imaging, Quantification and Statistics ...............................................................32
Chapter 4 ........................................................................................................................................33
Results .......................................................................................................................................33 4
4.1 Optimization and Immunocytochemical Characterization of Mouse Retinal Organoid Culture................................................................................................................................33
4.2 Non-photoreceptor cells are required for efficient organoid assembly .............................39
4.3 Organoids are polarized structures that depend on junctional integrity ............................41
4.4 Establishment of Organoid Engraftment Assay .................................................................44
4.5 Rod-GFP donor cells exhibit a unique neurite outgrowth engraftment phenotype in Crx-/- organoids ...................................................................................................................47
Chapter 5 ........................................................................................................................................50
Discussion .................................................................................................................................50 5
vi
5.1 Establishment of an Organoid Culture ...............................................................................50
5.2 Utility of organoids in a novel engraftment assay .............................................................51
5.3 Comparisons to established in-vitro retinal models ...........................................................53
5.4 Photoreceptor motility .......................................................................................................54
Chapter 6 ........................................................................................................................................56
Conclusion ................................................................................................................................56 6
References ......................................................................................................................................57
vii
List of Figures
Figure 1.1 – Structure of the retina………………………………………………………… 4
Figure 1.2 – Schematic of the phototransduction cascade………………………………7
Figure 1.3 – Structure of rod and cone photoreceptors……………………………………. 9
Figure 1.4 – Transcriptional control of photoreceptor development ……………………... 12
Figure 1.5 – Timeline of retinal organoid research………………………………………... 21
Figure 4.1 – Schematic and localization of retinal organoid formation…………………… 32
Figure 4.2 – 3-dimensional and post-mitotic nature of retinal organoids………………….. 33
Figure 4.3 – Immunocytochemical characterization of retinal organoids…………………. 34
Figure 4.4 – Cell-type require for organoid formation…………………………………….. 36
Figure 4.5 – Polarization markers and calcium sensitivity in retinal organoids…………… 39
Figure 4.6 – Organoid engraftment assay………………………………………………….. 42
Figure 4.7 – Donor cell engraftment into degenerate organoids…………………………... 45
viii
List of Tables
Table 3.1: Summary of mouse lines used………………………………………………….. 25
Table 3.2: Primer sequences used for genotyping…………………………………………. 25
Table 3.3: List of antibodies used for immunocytochemistry……………………………... 28
ix
List of Abbreviations
ALS Amyotrophic lateral sclerosis
AMD Age-related macular degeneration
BSA Bovine serum albumin
CARR Cone arrestin
CRALBP Retinaldehyde binding protein-1
CRX Cone rod homeobox
DIV Days in-vitro
DNA Deoxyribonucleic acid
EdU 5-Ethynyl-2´-deoxyuridine
EGTA Ethylene glycol-bis(β-aminoethyl ether)-N,N,N',N'-tetraacetic acid
ES Embryonic stem cell
FACS Fluorescence activated cell sorting
GCL Ganglion cell layer
GDP Guanosine diphosphate
GFP Green fluorescent protein
x
cGMP Cyclic guanosine monophosphate
GS Glutamine synthetase
GTP Guanosine triphosphate
LCA Leber’s congenital amaurosis
LGN Lateral geniculate nucleus
INL Inner nuclear layer
IPL Inner plexiform layer
N-CAD Neural cadherin
NFL Nerve fibrillary layer
NR2E3 Nuclear receptor subfamily-2 group E member-3
NRL Neural leucine zipper
OLM Outer limiting membrane
ONL Outer nuclear layer
OPL Outer plexiform layer
OTX2 Orthodenticle homeobox-2
PAR3 Partitioning defective-3
PAX6 Paired box protein-6
xi
PBS Phosphate buffered saline
PDL Poly-D-lysine
PNA Peanut agglutinin
RAX Retina and anterior neural fold homeobox
RBPMS RNA-binding protein with multiple splicing
RNA Ribonucleic acid
RORβ RAR-related orphan receptor β
RP Retinitis Pigmentosa
RPC Retinal precursor cells
RPE Retinal pigment epithelium
RXRγ Retinoid x receptor γ
SOX2 Sex-determining region Y box-2
SEM Standard error of the mean
TRβ2 Thyroid hormone receptor β-2
VSX2 Visual system homeobox-2
ZO1 Zonula occludens-1
1
Chapter 1
Background 1
1.1 General Overview
Neurodegeneration is possibly the cruelest forms of torture: it takes your memories, your ability
to feel, your ability to sense and interact with the world and when you’re at your most
vulnerable, your ability to be human.
Neurodegeneration 1.
If one thinks of their body as a complex machine, neurons would be the wiring between all the
different components. Sensory neurons detect information of the outside world, interneurons
relay information from these sensors and motor neurons give commands for the different parts of
the body to move. At the peak of it all is the brain, the master computer, a collection of
intricately connected wires that processes all information and controls the machine. Every
perception, thought and action anyone has ever experienced is mediated by neurons. This
incredibly complicated network of wires and sensors is arguably the most important system in
the body; the philosopher scientist, Gilbert Harman, once argued that it is probable that all of
humanity could simply be reduced to brains in jars meaning that being human relies solely
having a brain, a housing unit of over 100 billion neurons. This makes it all the more devastating
when this system goes awry.
2
Neurodegeneration is a family of diseases that manifests itself in a variety of different symptoms
with neuronal and/or synapse (connections between neurons) loss and death as an underlying
cause. Neurodegeneration can manifest itself in various ways depending on where the
dysfunction occurs: Alzheimer’s, Parkinson’s and Huntington’s disease arise from dysfunction in
neurons in the central nervous system, amyotrophic lateral sclerosis (ALS) arises from neuronal
dysfunction in motor neurons and age-related macular degeneration, retinitis pigmentosa and
hearing loss arise from dysfunction in sensory neurons. These diseases are characterized by a
general or subtype-specific death and loss of neurons. Neurodegenerative diseases strike hard,
often rendering the victim incapable of controlling their movements, remembering their
memories and sensing the world around them. Heartbreakingly, another common feature shared
by neurodegenerative disorders is the lack of curative therapies.
Retinal Degeneration and Repair 2.
Sensory neurons, as their name implies, are the neurons that sense cues from the environment
and relay this information to the brain. The sense of smell and taste arises from chemoreceptors
in the nose and tongue, the sense of hearing and touch from mechanoreceptors in the ear and
skin, the sense of temperature from thermoreceptors all over the body. These sensory receptors
take chemicals, mechanical stimuli and temperature and convert them into electrical signals to be
processed by the brain, but perhaps the most interesting sensory receptor of all is the
photoreceptor. Photoreceptors convert light into an electrical signal giving us the sense of sight.
These fascinating cells have developed to make proteins that react to light causing a cascade of
events that lead to a signal that can be interpreted by the brain. However, like the neurons in the
brain, genetic factors and perturbations in the environment can cause these photoreceptors to
degenerate.
3
Blindness caused by retinal degeneration is irreversible and is a leading cause of incurable vision
loss. Retinal degeneration can have different underlying genetic or environmental causes that
ultimately lead to blindness from the death of the sensory neurons in the eye, the photoreceptors.
The most common forms of retinal degeneration are age-related macular degeneration (AMD)
and retinitis pigmentosa (RP) (Hartong, D.T. et al., 2006, Hamel C.P., 2007, Wright, A.F., et al.,
2010). AMD is a disease that is increasing in prevalence; AMD affects 1 in 4 people over the age
of 75 and is characterized by a loss of daylight high acuity vision (Hamel, C.P., 2007, Wright,
A.F., et al., 2010). RP is a rarer form of retinal degeneration that affects 1 in 2000 with genetic
defects being the underlying cause (Hartong, D.T., et al., 2006). RP typically manifests itself as a
loss in night vision followed by a progressive loss of daylight vision (Hartong, D.T., et al.,
2006). Like all neurodegenerative diseases, there are no curative therapies for blindness caused
by retinal degeneration. Current therapies manage symptoms and attempt to slow the progression
of disease (Yonekawa et al., 2015); the lack of a curative therapy has researchers looking for
novel ways to treat retinal degeneration.
1.2 The Retina
“The whole is greater than the sum of its parts.” - Aristotle
Overview 1.
The retina is a neural laminar tissue that is located in the posterior region of the eye. Retinal
cells, cells comprising the retina, are specialized in the conversion of light sensory stimuli into
neural signals feeding into the optic nerve. These signals are then sent to the brain for further
processing to produce vision. The structure of the retina was described as early as 1900 by
Santiago Ramon y Cajal: a man revered as the father of modern neuroscience. His hand drawn
4
diagrams back in the 1900’s depict the structure of retina to an incredible degree of accuracy
(Figure 1.1) (Ramon y Cajal, S., 1900, Wassle, H. and Boycott, B.B., 1991, Masland, R.H.,
2001).
Anatomy and Function of the Retina 2.
The retina consists of three cell layers: the outer nuclear layer (ONL), the inner nuclear layer
(INL) and the retinal ganglion cell layer (GCL) (Figure 1.1). The ONL consists of the rod
photoreceptors and cone photoreceptors (Masland, R.H., 2001). Photoreceptors are the light-
sensitive cells of the retina. Rod photoreceptors and cone photoreceptors extend rod spherules
and cone pedicles, respectively, to synapse with bipolar cell and horizontal cell dendrites of the
INL (reviewed in Masland, R.H., 2001). This layer of neuronal synapses is known as the outer
plexiform layer and lies between the ONL and INL (Masland, R.H., 2001). The INL lies basal to
OPL and consists of bipolar cells, horizontal cells, amacrine cells and Müller glia. Bipolar cells
then further extend their neural processes basally to synapse with retinal ganglion cell dendrites
(Euler, T., et al., 2014, Masland, R.H., 2001). This layer of neuronal synapses is called the inner
plexiform layer (IPL). Basal to the IPL is the GCL, which consists mainly of retinal ganglion
cells and displaced amacrine cells (Perry, V.H. and Walker, M., 1980). The retinal ganglion
cells extend axons that bunch up to form the nerve fibrillary layer (NFL), which then exits the
retina as the optic nerve (Masland, R.H., 2001). The ganglion cell axons synapse in the thalamus
of the brain, specifically in the lateral geniculate nucleus (LGN) (Hubel, D.H. and Wiesel, T.N.,
1968). From there, neurons carry the information further into the visual cortex of the brain where
it is processed into what we perceive as vision (Hubel, D.H. and Wiesel, T.N., 1968).
5
Figure 1.1: Structure of the retina. Drawings by Ramon y Cajal from 1900 (reproduced under
public domain license). In the outer nuclear layer (3): rod photoreceptors (a, c), cone
photoreceptors (b, d). In the inner nuclear layer (5): horizontal cell (c), bipolar cell (f, g),
amacrine cell (h) and Müller glia (B). In the ganglion cell layer: ganglion cells (i, j).
6
Photoreceptors 3.
While rod photoreceptors are fairly homogenous between mammalian retinas, the distributions
and subtypes of cone photoreceptors differ substantially between mammalian species (Carter,
L.D. and Lavail, M.M., 1979). Humans have 3 types of cone photoreceptors that can be
classified into S-cones, M-cones and L-cones (Jacobs, G.H., 1993, Boynton, R.M., 1988). Mice,
however, only have S and M-cones (Jacobs, G.H., 1993). Additionally, the retina has
melanopsin-positive ganglion cells, which are also sensitive to light; these cells are important in
the maintenance of circadian rhythm and influence the release of melatonin in the pineal gland
(Freedman, M.S., et al., 1999). However, these cells are very rare, are not the primary cells
mediating vision loss in retinal degeneration and thus, will not be further discussed.
Rod and cone photoreceptors differ in their distribution in the retina. In humans, cone
photoreceptors are most abundant in the central retina in an area known as the fovea, while rod
photoreceptors are more abundant in the peripheral retina (Curcio, C.A., et al., 1987). Mice,
however, do not have a fovea and instead cone photoreceptors in the murine retina are dispersed
throughout rather than concentrated at a fovea (Jeon, C.J., et al., 1998, Ortin-Martinez, A., et al.,
2014). In both mice and humans, cone photoreceptors comprise the minority of the
photoreceptors of the eye: 5% of the photoreceptors in humans, and 3% of the photoreceptors in
mice are cones (Curcio, C.A., et al., 1987, Jeon, C.J., et al., 1998). However, it should be noted
that while being a small minority of the photoreceptor population, more than half of the sensory
output of the human retina is from cone photoreceptors owing to the high ratio of cone
photoreceptors to ganglion cells: often 5 cones:1 ganglion cell compared to 1000 rods:1 ganglion
cell (Curcio, C.A. et al., 1990).
7
Photoreceptors are a highly specialized sensory neuron that has evolved to efficiently detect
photons and this is reflected in the unique morphological features of this cell type. The
photoreceptor consists of a cell body with an inner fiber, inner segment and outer segment.
Starting with the nuclear morphology, rod photoreceptors in nocturnal animals, such as the
mouse, are characterized by a spherical nucleus with a singular tightly packed heterochromatin
core surrounded by a small layer of euchromatin (Figure 1.2) (Carter, D.H. and Lavail, M.M.,
1979). Cone photoreceptors, however, have an elongated nucleus with several foci of
heterochromatin (Figure 1.2) (Carter, D.H. and Lavail, M.M., 1979). Furthermore, the synaptic
terminals of cone and rod photoreceptors also differ. Rod photoreceptors synapse on rod bipolar
cells via a small spherule terminal, whereas cone photoreceptors synapse on cone bipolar cells
via a comparatively large broom-shaped terminal called a pedicle (Figure 1.2) (Carter, D.H. and
Lavail, M.M., 1979). Basal to the cell body, the inner fiber of the photoreceptor synapses with
cone or rod specific bipolar cells. Cone photoreceptors and rod photoreceptors are named after
the shape of their outer segments when they were first described in frogs; the morphological
differences between cone and rods in mammalian retinas are more subtle (Figure 1.2) (Walls,
G.L., 1942, Carter, D.H. and Lavail, M.M., 1979). These outer segments consist of densely
packed discs that are contained within the cell membrane in rod photoreceptors and continuous
with the cell membrane in cone photoreceptors (Carter, D.H. and Lavail, M.M., 1979). These
discs contain opsin molecules as well as cation channels, proteins that are essential for the
phototransduction cascade (Carter, D.H. and Lavail, M.M., 1979).
8
Figure 1.2: Schematic of murine photoreceptor morphology: rod photoreceptor on the left and
cone photoreceptor on the right.
9
Phototransduction and the Pigment Epithelium 4.
Phototransduction is the process by which light stimuli are converted into a change in membrane
potential that subsequently causes a change in neurotransmitter release. Photoreceptors produce
what is known as a dark current; whereas most neurons in the body depolarize when activated,
photoreceptors, in the absence of light, are depolarized. In the absence of light, the opsins are
bound to a light-sensitive chromophore, 11-cis-retinal (reviewed in Arshavsky, V.Y., et al.,
2002). When light hits retinal, it undergoes an isomerization to all-trans-retinal (Arshavsky,
V.Y., et al., 2002). All-trans retinal no longer fits within opsin and is ejected from its binding site
causing a conformational change in opsin (Arshavsky, V.Y., et al., 2002). When not bound to
retinal, opsin is able to activate G-coupled protein, transducin, which switches out its GDP for
GTP allowing its Gα subunit to dissociate with its Gβ and Gγ subunits (Figure 1.3) (Arshavsky,
V.Y., et al., 2002). The GTP bound Gα subunit of transducin then activates phosphodiesterase,
which starts breaking down the signaling molecule, cGMP, into 5’-GMP (Figure 1.3)
(Arshavsky, V.Y., et al., 2002). The lowering of cGMP levels causes sodium channels to close
resulting in a hyperpolarization of the membrane potential due to the constant efflux of
potassium ions (Figure 1.3) (Arshavsky, V.Y., et al., 2002). This hyperpolarization closes
voltage-gated calcium channels, lowering the calcium levels in the cell (Figure 1.3) (Pugh, E.N.
and Lamb, T.D., 1990, Arshavsky, V.Y. et al., 2002). Subsequently, less glutamate is released,
as calcium is required for the fusion of glutamate vesicles to exit the cell (Figure 1.3)
(Arshavsky, V.Y., et al., 2002). Lower glutamate levels disinhibit the bipolar cells, causing them
to be activated and relay the information to ganglion cells and ultimately the brain.
10
An important cell layer that is not part of the retina, but is crucial for its function, is the retinal
pigment epithelium (RPE), which lies apical to the photoreceptors (Masland, R.H., 2001,
Strauss, O., 2015). The RPE is an integral player to the phototransduction process and recycles
all-trans retinal to 11-cis retinal (Figure 1.3) (Arshavsky, V.Y., et al., 2002, Lamb, T.D. and
Pugh, E.N., 2006, Strauss, O., 2005). Additionally, maintaining a dark current requires a large
amount of energy and generates a high level of oxidative stress (Strauss, O., 2005). The RPE
engulfs the damaged discs of the photoreceptors, as well as supplying glucose and oxygen to
them (Strauss, O., 2005). Moreover, the pigment in the RPE absorbs any extra light to prevent
light from causing additional oxidative stress (Strauss, O., 2005). As there are many players
involved in the phototransduction cascade, problems with any of the players can have large
deleterious effects on vision and the retinal cells.
11
Figure 1.3: Schematic of the phototransduction cascade. Light striking rhodopsin in the discs (1)
causes 11-cis-retinal to undergo a conformational change becoming all-trans retinal (2). The
conformational change causes retinal to dissociate from opsin (3). The unbound opsin activates
transducin, which switches its GDP to GTP. Activated transducin now binds to
phosphodiesterase, activating it (4). Phosphodiesterase catalyzes the conversion of cGMP to
GMP. The decrease in intracellular levels of cGMP causes cGMP-gated cation channels to close
(5). The membrane potential hyperpolarizes which decreases downstream glutamate release. All-
trans retinal is transported to the RPE (A-B). All-trans retinal is then converted via several
enzymatic steps back into 11-cis retinal (C) and is transported back into the photoreceptor to
restart the cycle (D). (Adapted from Lamb, T.D. and Pugh, E.N., 2006)
12
Photoreceptor Development 5.
In mice, the eye starts developing in the embryo at 8 days post conception. Evaginations of the
ventral ectodermal neuroepithelial cells near the forebrain form optic vesicles, which will
develop into the eye (Chow, R.L. and Lang, R.A., 2001). The optic vesicle will invaginate upon
itself and form two layers: the outer layer and the inner layer separated by the intraretinal space
(Chow, R.L. and Lang, R.A., 2001). The outer layer will differentiate into the RPE whereas the
inner layer will differentiate into the neural retina (Chow, R.L. and Lang, R.A., 2001). The inner
layer is home of the retinal precursor cells (RPCs). These RPCs are multipotent and will generate
the seven subtypes of cells in the neural retina: cone photoreceptors, rod photoreceptors, bipolar
cells, horizontal cells, amacrine cells, ganglion cells and Müller glia (Turner, D.L. and Cepko,
C.L., 1987, Bassett, E.A. and Wallace, V.A., 2012). The timing of the birth and differentiation of
the various cell types is depicted in the schematic shown in Figure 1.4. Cells fated to become
ganglion cell drop out of cell cycle first and the majority of ganglion cells have been made by
E15 (Young, R.W., 1985). Horizontal cells, cone photoreceptors and amacrine cells are also
specified in the late embryonic days (Young, R.W., 1985). Most cone photoreceptors are
specified and come out of cell cycle around E16.5. The peak production of rod photoreceptors,
the largest proportion of cells within the neural retina, occurs at P0. The peak of bipolar cell and
Müller glia specification occurs later at around P4 (Young, R.W., 1985).
RPCs exit cell cycle to become photoreceptor precursors and these precursors will then start to
up-regulate photoreceptor specific genes, such as phototransduction genes. The maturation of
photoreceptor precursors into fully functional photoreceptors takes place over weeks to months
and occurs postnatal (Swaroop, A., et al., 2010).
13
Transcription factors play a key role in the regulation and direction of photoreceptor
development. One such transcription factor is orthodenticle homeobox 2 (OTX2): an homeobox
transcription factor that specifies a bipolar or photoreceptor cell fate. OTX2 can then upregulate
the expression of cone-rod homeobox (CRX) to activate photoreceptor-specific genes or visual
homeobox 2 (VSX2) to specify bipolar cell fate (Chen, S., et al., 1997, Furukawa, T., et al.,
1997, Furukawa, T., et al., 1999, Koike, C., et al., 2007). Nuclear receptor subfamily 2 group e
member 3 (NR2E3) and neural retina-specific leucine zipper (NRL) are both transcription factors
that direct precursors towards rod fate and are essential for rod photoreceptor development
(Mears, A.J., et al., 2001, Haider, N.B., et al., 2000). Cone progenitors will further preferentially
differentiate into M cones (as opposed to S cones) by the expression of thyroid hormone receptor
β 2 (Trβ2), onecut1/2 (Oc1/2) and neurod2 (Ng, L., et al., 2001, Hennig, A.K., et al., 2008,
Brezinski, J.A. and Reh, T.A., 2015).
Mutations of these factors can lead to deleterious effects on the retina. A deletion of Nrl gene in
mice results in an all-cone retina (Mears, A.J., et al., 2000). OTX2 and CRX deficiency in mice
result in a severe degeneration of photoreceptors and profound congenital blindness (Furukawa,
T., et al., 1999, Koike, C., et al., 2007). In humans, mutations in Otx2 have been related bilateral
anophthalmia, mutations in Crx are correlated with Leber’s congenital amaurosis (LCA) and
mutations in Nrl and Nr2e3 are associated with enhanced S-cone syndrome or Goldmann-Favre
syndrome (Tajima, T., et al., 2009, Swaroop, A., et al., 1999, Wright, A.F., et al., 2004).
14
Figure 1.4: Transcriptional regulation of photoreceptor precursors showing the major
transcription factors regulating the differentiation of rod and cone photoreceptors from mitotic
multipotent precursors (Adapted from Hennig, A.K., et al., 2008)
15
Disease and Degeneration 6.
The most common heritable form of retinal degeneration is RP (Hartong, D.T. et al., 2006).
Although there are more than 44 genetic subtypes, there are very few phenotypic characteristics
that can reliably distinguish between them (Wright, A.F., et al., 2010). The most common cause
of RP is mutations in rhodopsin, though mutations in other components of the phototransduction
cascade are also implicated in RP. (Wright, A.F., et al., 2010, Hartong, D.T., et al., 2006). Such
mutations cause a disruption in the function and proper trafficking of this protein to the outer
segments leading to death of rod photoreceptors (Wright A.F., et al., 2010). Patients with RP
suffer from night-blindness followed by progressive loss of the peripheral visual field leading to
tunnel vision (Hartong, D.T., et al., 2006). Unfortunately, in most cases the degeneration will not
spare the cone photoreceptors, resulting in loss of central visual field and total blindness
(Hartong, D.T., et al., 2006). Depending on the mutation, RP will affect the patient from early
infancy to late adulthood (Hartong, D.T., et al., 2006). Leber’s congenital amaurosis (LCA),
while similar to RP, is different in that the onset of blindness occurs at birth or a few months
after birth (Wright, A.F., et al., 2010). There is a genetic overlap between RP and LCA; there are
at least six genes that when mutated can cause either disorder (Wright A.F., et al., 2010).
Whereas RP usually affects patients before mid-adulthood, AMD usually affects patients during
late adulthood, hence the name (Wright A.F., et al., 2010). AMD is also much more genetically
complex than RP: 20% of patients with typical AMD have an affected relative, but monogenic
cases of AMD are incredibly rare (Wright A.F., et al., 2010). The incidence of AMD is far
greater than that of RP, being the cause of over one half of blindness and vision impairment in
the industrialized world (Wright A.F., et al., 2010). AMD is phenotypically diagnosed by
16
presence drusen, yellow lipid deposits, in the macula (Yonekawa, Y., et al., 2015). AMD patients
typically report a progressive loss in central vision. In severe cases of AMD, known as wet-
AMD, neovascularization occurs in the subretinal space (Wright A.F., et al., 2010). These
ectopic blood vessels leak proteins and blood under the macula and can cause significant damage
if unmanaged (Wright A.F., et al., 2010). The pathogenesis of AMD, that is what the root cause
of photoreceptor death, is unclear, though it is clear that the pathologies in the RPE play a role in
the progression of the disease and there is an emerging hypothesis that inflammation may play a
role as well (Yonekawa, Y., et al., 2015).
The pharmacological management for dry-AMD is limited to lutein and zeaxanthine
supplements, both of these supplements have limited supporting clinical data for dry-AMD
(Hobbs, R.P. and Berstein, P.S., 2014). Similarly, RP is managed using large doses of vitamin A;
though, the use of vitamin A, like lutein and zeaxanthine supplements for dry-AMD, also has
limited supporting clinical data (Berson, E.L., et al., 1993). Wet-exudative AMD, the more
severe form of AMD, can be managed using laser coagulation and antibodies that prevent
neovascularization or the formation of blood vessels (Yonekawa, Y., et al., 2015). In addition to
being invasive and incredibly expensive, these treatments only temporarily slow the progression
of AMD: there are no treatments that halt or reverse the progression of AMD.
1.3 Photoreceptor Transplantation
Overview 1.
Although novel approaches to treat AMD and RP, including RPE transplantation, are at pre-
clinical and early stage clinical trials, this approach, unfortunately, cannot reverse vision loss
after cone degeneration (Schwartz, S.D., et al., 2012). Thus, researchers need to develop novel
17
strategies, such as cone transplantation, to restore vision to the AMD retina. In murine models of
photoreceptor degeneration, photoreceptors are the only cell type affected leaving the
downstream neural networks generally unscathed (Furukawa, T., et al., 1999). The observation
of conserved retinal neural network led to the hypothesis that cell replacement therapy was
possible. Thus, researchers investigated the feasibility of cell-mediated rescue of retinal
degeneration.
Lineage Specific Reporters 2.
One of the first hurdles that researchers needed to overcome is how to track the donor cells in the
recipient retina. In 2006, researchers generated a mouse strain GFP reporter tagged to the Nrl
promoter; as previously mentioned, Nrl is a rod-lineage specific transcription factor and is
expressed in immature rod precursors and mature adult rods (Akimoto, M., et al., 2006). This
mouse strain allowed researchers to track donor rod photoreceptors and also enabled the
enrichment of rod photoreceptors via fluorescence activated cell sorting (FACS). With this new
tool, researchers were able to investigate the feasibility of rod transplantation.
However, finding a similar way to enrich for cone photoreceptors proved to be a challenge.
Generating a cone-specific reporter mouse line was a challenge since there were very few cone
lineage markers known at the time. Further adding to the challenge, only 3% of murine
photoreceptors are cone photoreceptors (Jeon, C.J., et al., 1998). Both the lack of a method to
enrich and track cone populations, and the rarity of cones in the retina has caused a lag of cone
transplantation studies behind rod studies. In 2001, though, researchers generated an Nrl
knockout mouse strain (Nrl-/-) that was characterized by a cone-dominant retina (Mears, A.J., et
al., 2001, Daniele, L.L., et al., 2005). RNAseq and other experiments to determine expressome
were performed using this mouse line to identify cone lineage markers (Mears, A.J., et al., 2001,
18
Yoshida, S., et al., 2004). Researchers found that the Nrl-/- mouse retina overexpresses many
hallmark cone genes and that the mouse has an exaggerated b-wave in their electroretinogram
(ERG) traces, indicating that the cone photoreceptors were functionally active (Mears, A.J., et
al., 2001, Daniele, L.L., et al., 2005). By crossing the Nrl-/- mouse with a ubiquitous GFP
reporter mouse, researchers were able to enrich for reporter labeled cone photoreceptors using
magnetic bead sorting using the CD73, a pan photoreceptor surface receptor (Koso, H., et al.,
2009, Santos-Ferrera, T., et al., 2015). However, it was not until 2016, that researchers were able
to enrich for endogenous cones using a cone-specific GFP reporter mouse line, using a GFP
gene-trap into the locus Coiled-coil domain containing 136 (Ccdc136) gene (Yoshida, S., et al.,
2004, Smiley, S., et al., 2016). The Ccdc136GFP/GFP mouse labels cones as early as embryonic
day 13.5, during peak cone production, making it a novel early cone-lineage marker (Smiley, S.,
et al., 2016). Ccdc136GFP/GFP also labels bipolar cells in the retina at postnatal day 14; however,
since cone and bipolar cell development is temporally distinct, researchers were able to enrich
for cones without contamination from bipolar cells (Smiley, S., et al., 2016). Such tools set the
stage for research studying cone transplantation.
Rod and Cone Photoreceptor Transplantation 3.
Although researchers had been transplanting cells into the subretinal space of mice (Chacko,
D.M., et al., 2000), one could argue the ignition of the field of rod photoreceptor transplantation
occurred in 2006 when researchers published functional rescue following transplantation of rod
photoreceptors that were enriched from the Nrl-GFP mouse (MacLaren, R.E., et al., 2006).
Morphologically mature GFP-labeled rod photoreceptors were observed in the ONL of the
recipient retina (MacLaren, R.E., et al., 2006). The number of these GFP-labeled cells was
interpreted as being correlative to the amount of functional rescue achieved in the recipient
19
(MacLaren, R.E., et al., 2006). To optimize conditions for transplantation of rods enriched from
the Nrl-GFP mouse, a series of publications investigated the effects of donor age, and a variety
of different behavioural and electrophysiological tests to assess function in several murine
models of retinal degeneration (West, E.L., et al., 2008, Bartsch, U., et al., 2008, Pearson, R.A.,
et al., 2012, Barber, A.C., et al., 2013, Singh, M.S., et al., 2013). These publications used the
readout of the number of GFP-labeled cells in the ONL as a measure of engraftment. The data
from these publications identified P4 donors as most optimal and implicated both the outer
limiting membrane (OLM) and presence of extracellular matrix as a potential factor in limiting
photoreceptor engraftment (West, E.L., et al., 2008, Pearson, R.A., et al., 2012, Barber, A.C., et
al., 2013). Other studies have also documented engraftment and functional rescue following
transplantation of photoreceptors derived from human ES cells, murine ES cells and also retinal
stem cells (Tucker, B.A., et al., 2011, Lamba, D.A., et al., 2009, Ballios, B.G., et al., 2015).
The first cone transplantation was performed in 2015 by Santos-Ferreira, T. et al. utilizing
genetic and magnetic bead methods to enrich for cone-like (cod) photoreceptors in a Nrl-/-
background. There was modest rescue using electrophysiological measures, in this case retinal
ganglion cell patch clamping. Furthering the field, in 2016, Smiley, S., et al. transplanted cone
photoreceptors using similar genetic manipulation and fluorescence activated cell sorting with
the advantage of a cone-specific GFP reporter mouse line. It was then, that the researchers
reported the interesting observation that the engrafted cells in the outer nuclear layer of wildtype
recipients had rod-like morphology, even though cone cells were transplanted (Smiley, S., et al.,
2016). This observation would call into question the nature of donor cell engraftment.
20
Material Transfer 4.
Late in 2016, it was reported that GFP-labeled cells in the outer nuclear layer of recipient mice,
that had been transplanted with donor GFP+ photoreceptors, were actually a result of material
transfer rather than donor cell engraftment proper (Pearson, R.A., et al., 2016, Santos-Ferreira,
T., et al., 2016, Singh, M.S., et al., 2016, Ortin-Martinez, A. et al., 2017). Though researchers
were skeptical that there would be sufficient reporter transfer to fill an entire cell, evidence soon
mounted against the traditional interpretation of transplantation: dual-reporter transplant
experiments showed double labeled cells, indelible EdU-labeled donor cells failed to enter the
outer nuclear layer and Y-chromosome labeling showed that male donor nuclei did not engraft
into the recipient retina (Pearson, R.A., et al., 2016, Santos-Ferreira, T., et al., 2016, Singh, M.S.,
et al., 2016, Ortin-Martinez, A., et al., 2017).
The advent of this discovery required the careful re-interpretation of data generated over a
decade as the factors that were previously interpreted as affecting engraftment may be actually
affecting material transfer instead. With the increased scrutiny for future experiments and also
the unresolved issue of low photoreceptor engraftment, a new approach is required to determine
the factors at play in this incredibly complex system.
1.4 Organoids
“All things being equal, the simplest solution tends to be the best one” – William of Ockam
Overview 1.
While in-vivo studies have the advantage of being more relevant and recapitulating of what
happens in a fully functioning organism, in-vitro studies have the advantage of being easier and
21
quicker to perform. Due to the laborious nature of in-vivo experiments, in-vitro models are a
useful tool to gain insight into the players and pathways present for a particular phenotype.
Organoids, as the name suggests, are an in-vitro structure that are a level of complexity above
single cells, but not quite at the organizational level of a full organ (Lancaster, M.A. and
Knoblich, J.A., 2014). Organoids are typically characterized as 3-dimensional miniature version
of an organ that can be grown in-vitro. The idea of growing organs in a dish was proposed after
the observation that sea sponge cells after being dissociated into a single cell suspension would
re-aggregate to form the original organism. However, it would not be until after the discovery of
stem cells that the potential of cells to grow into different organs was fully realized.
To classify an aggregate as an organoid, the following criterion was developed: One: organoids
must be comprised of more than one organ-specific cell type formed by organ-specific stem or
progenitor cells. Two: organoids must be capable of recapitulating some specific function of the
original organ. Three: the cells must be spatially organized in a manner similar to the organ
(Lancaster, M.A., Knoblich, J.A., 2014). Organoids have been described for many organs of the
human body, including thyroid, lung, pancreas, liver, stomach, intestine, heart, skeletal muscle,
bone, kidney, brain, retina, pituitary, mammary gland, inner ear and skin (Lancaster, M.A.,
Knoblich, J.A., 2014). These organoids allow researchers to ask mechanistic questions about
phenotypes that include, but are not limited to cell development, motility, induction and
lamination, in a simplified system where genetic manipulations can be performed with relative
ease. In addition to providing to transplantable material that resembles the host tissues,
researchers can use these organoids to quickly screen through small biological molecules, siRNA
libraries and drugs to see if the organoid will produce a particular phenotype. Moreover, these
organoids have been used extensively to study development and disease states.
22
Retinal Organoids 2.
Embryonic retinal dissociates form rosette shaped organoids when cultured (Vollmer G. et al.,
1984, Kelley, M.W., et al., 1994). Retinal organoids were first explored in chick embryonic
dissociates in the early 1960’s (Steffanelli, A. et al., 1961, Moscona A. A., 1962). These studies
showed that chick embryonic dissociates formed beautifully laminar structures, termed
‘spheroids’, that recapitulate the layers of the retina when grown in culture. In a later study,
researchers showed that the orientation of these structures depended on the presence of RPE in
the culture; presence of RPE caused the structure to be apical, photoreceptor layer, oriented on
the outside of the spheroid, whereas in the absence RPE the layers adopted the opposite topology
(Vollmer, G., et al.,1984, Vollmer, G. and Layer, P.G., 1986). This in-vitro model has been used
to study retinal development and photoreceptor specification (Vollmer G. and Layer P.G., 1986,
M.W. Kelley et al., 1999). Later studies using chick retinal dissociates implicated cholinesterases
in the regulation of retinal cell proliferation and the requirement of Müller glia for the proper
formation and lamination of the aggregates (Vollmer, G., and Layer, P.G., 1987, Willbold, E., et
al., 2000). Similar experiments performed using embryonic rat retinal dissociates showed the
effects of taurine and retinoic acid on photoreceptor differentiation (Kelley, M.W., et al, 1994,
Kelley, M.W., et al., 1999). In a later study, using a rotational culture system, rat retinal
aggregates increased in size and showed the additional presence of both amacrine and ganglion
cells (Rothermel, A., et al., 2005). The structure and orientation of the rodent dissociates were
similar to chick dissociates cultured in the absence of the RPE: photoreceptors oriented with their
apical processes oriented towards the lumen with the basal side facing out. Research performed
using these organoids or in-vitro retinae as the researchers termed them (IVR) were primarily
performed to ask questions regarding the developmental cues that induce the differentiation of
23
the RPCs (Vollmer, G. and Layer, P.G., 1986). These experiments would provide insights for
later work that unveiled the transcriptional regulation and other developmental cues that allow
RPCs to differentiate. Most, if not all, experiments performed today utilize in-vivo models with
knock-ins or knockouts of key genes to study development.
Pluripotent cell technology combined with the wealth of knowledge of molecular regulation of
development prompted the next generation of experiments to differentiate eye and retinal tissues
from pluripotent cells. Researchers used mouse embryonic stem cells to form embryoid bodies,
culturing them in a 3-dimensional culture using Matrigel and media that encouraged
neuroectoderm differentiation (Eiraku M. et al., 2011). The embryoid body will then form buds
that resemble optic vesicles and have the capacity to form a bilayer; they separated the optic cups
from the embryoid body and grew the optic cup in a media that supported retinal differentiation
(Eiraku M. et al., 2011). More recently, researchers used human pluripotent stem cells to form
these optic cups (Nakano, T. et al., 2012). While similar to murine eye cups, eye cups derived
from human cells took longer to culture, were larger and showed apical nuclear positioning
(Nakano, T. et al., 2012). The ES-derived eye cups are incredibly homologous to what is
observed in-vivo: in addition to mimicking the transcriptional timing and patterning of the
developmental program, the eye-cups are also bear striking morphological similarity to the
developing eye (Eiraku, M., et al., 2011, Nakano, T., et al. 2012). There are advantages and
disadvantages to using primary cells versus ES cells as a source for organoid formation. While
rodent and chick retinal aggregates needed only a culture time of roughly one week, the eye cups
formed from mouse ES cells and human ES cells required a much longer 20 days and 126 days
in culture to fully form, respectively (Vollmer, G., et al., 1984, Kelley, M.W., et al., 1994,
Eiraku, M., et al., 2011, Nakano, T., et al. 2012). Moreover, the culture conditions required to
form the eyecups require various media changes and condition changes throughout the culture
24
period, whereas the rodent and chick aggregates use one medium throughout (Vollmer, G., et al.,
1984, Kelley, M.W., et al., Eiraku, M., et al., 2011, Nakano, T., et al., 2012). As a result, though
ES cell-derived organoids are more morphologically similar and relevant to the in-vivo retina, its
reproducibility issues, extended culture time and requirement for suspension culture make it an
impractical choice as an in-vitro model for engraftment.
25
Figure 1.5: Timeline of retinal organoid research (Adapted from Lancaster, M.A. and Knoblich,
J.A., 2014)
26
Chapter 2
Hypothesis and Rationale 2
2.1 Rationale The field of photoreceptor transplantation is constantly challenged by low engraftment rates.
Compounding this issue is the material transfer phenotype, which is difficult to distinguish from
proper engraftment. The identification of the molecular regulators of photoreceptor cell
integration and differentiation would be facilitated by the development of an in-vitro system.
Retinal dissociates self-organize into organoids and have been used to study differentiation of
photoreceptors making them a good candidate for studying engraftment and the differentiation of
exogenous photoreceptors.
2.2 Hypothesis Self-organizing organoids formed from dissociated perinatal mouse retina are an in-vitro retina
surrogate and encourage exogenous photoreceptors to differentiate. These organoids can be
further used to model and study donor photoreceptor integration into the outer nuclear layer.
2.3 Objectives To test this hypothesis, I had the following objectives:
1. Optimize and characterize mouse retinal organoid formation in-vitro
2. Characterize the cell-type requirement of retinal organoid formation
3. Establish a cell-engraftment assay using retinal organoids generated from wildtype and
degenerate retinas.
27
Chapter 3
Materials and Methods 3
“The only difference between science and mucking about is writing it down” – Adam Savage
3.1 Animals and Genotyping
The use of animals in this study was in accordance to the guidelines set out in the Association for
Research in Vision and Ophthalmology Statement for Use of Animals in Ophthalmic and Vision
Research. All experiments performed were approved by the University Health Network Research
Ethics Board, in accordance to the guidelines of the Canadian Council on Animal Care and in
conformity with the University Health Network Care Committee (protocol 3499.10). Mouse
strains used in this study as summarized in Table 3.1. Briefly, C57BL/6J (Charles River), Nrl-
GFP (Rod-GFP) (Akimoto, M., et al., 2006), Nrl-/-;Ccdc136GFP/GFP (Cod-GFP) (Smiley, S., et
al., 2016) and Crx-/- (mouse model of retinal degeneration) (Furukawa, T., et al., 1999) mice of
both sexes were used in this study. Genotyping was performed by extracting genomic DNA from
ear clips or tail snips using an alkaline lysis buffer (25 mM NaOH, 0.2 mM EDTA, pH 8.0) for
one hour at 95˚C. The samples were then neutralized with neutralization buffer (40 mM Tris-
HCl) and PCR was performed using the primer sets summarized in Table 3.2.
28
Table 3.1: Mouse lines used in this study Strain Background Reference
C57BL/6J C57BL/6J
Nrl-GFP C57BL/6J (Akimoto, M., et al., 2006)
Crx-/- Mixed (Furukawa, T., et al., 1999)
Nrl−/−;Ccdc136GFP/+ C57BL/6J (Smiley, S., et al., 2016)
Table 3.2: Primer sequences used for genotyping
Target Primer (5' - 3')
Crx forward AGGAGTTTGGCATTCCAGGG
Crx reverse CGATGATCTCGTCGTGACCC
Ccdc136 wildtype, forward CCGTGGTGGGGGTTGAATCCAA
Ccdc136 wildtype, reverse TGGCAAAGTCATGAAGGGACCACA
Ccdc136 GFP, forward CACATGAAGCAGCACGACTT
Ccdc136 GFP, reverse TGCTCAGGTAGTGGTTGTCG
Nrl wildtype, forward GTGTTCCTTGGCTGGAAAGA
Nrl wildtype, reverse CTGTTCACTGTGGGCTTTCA
Nrl knockout, forward TGAATACAGGGACGACACCA
Nrl knockout, reverse GTTCTAATTCCATCAGAAGCTGAC
mT/mG, common CTCTGCTGCCTCCTGGCTTCT
mT/mG, wildtype reverse CGAGGCGGATCACAAGCAATA
mT/mG, mutant, reverse TCAATGGGCGGGGGTCGTT
29
3.2 Preparation of Glass Surface
In preparation for retinal cell cultures, glass-bottomed 96 well plates (Mat-Tek) were coated with
poly-D-lysine (PDL) (Sigma Aldrich) by incubating PDL in Baxter water for 3 hours or
overnight at a concentration of 10 µg/mL at 37 ˚C. The plates were then washed 3 times with
Baxter water and coated with laminin (Sigma Aldrich) in Baxter water for 1 hour at a
concentration of 1 µg/mL at 37 ˚C.
3.3 Organoid Formation
To establish self-organizing cultures, retinas from C57BL/6J, or Crx-/- at postnatal day 1-2, were
harvested in CO2 independent media (Fisher Scientific) and dissociated with papain
(Worthington Biochemical, UK) in accordance to manufacturer’s directions. The cells were then
washed in Ca2+/Mg2+ free phosphate buffered saline (PBS) and subsequently counted using a
hemocytometer and 0.4% trypan blue viability stain. To enrich for photoreceptors, the cells were
re-suspended in 0.5% bovine serum albumin (BSA) (Sigma Aldrich) 25 mM HEPES, 2 mM
EDTA, 0.005% DNAse (Sigma Aldrich) in Ca2+/Mg2+-free PBS and the GFP+ cells were
isolated using fluorescence activated cell sorting (Aria III, BD Biosciences) into 10% BSA in
Ca2+/Mg2+-free PBS. The sorted cells were then counted using 0.4% trypan blue. The cells were
then re-suspended in explant culture medium (DMEM with GlutaMAX (Gibco, 0.5 mL/mL),
Nutrient F12 Ham (Gibco, 0.5 mL/mL), Sato’s supplement (10 uL/mL), insulin (Sigma Aldrich,
10 ug/mL), N-acetyl-cysteine (Sigma Aldrich, 60 ug/mL), gentamycin (Gibco, 10ug/mL) and
plated on pre-coated glass-bottomed 96-well plate described above, 250 000 cells in 100 uL of
media per well. The cultures were topped off with 100 uL media after 3 days in-vitro (DIV) and
cultured for an additional 3 days for a total of 6 DIV. In the pharmacological disruption
30
experiments, wildtype rosettes were cultured in the presence of varying concentrations of
ethylene glycol-bis(β-aminoethyl ether)-N,N,N',N'-tetraacetic acid (EGTA), 0.01 mM, 0.1 mM
and 1 mM, for the duration of the culture period. All experiments were performed a minimum of
3 times in technical triplicates.
3.4 Engraftment Assay
For the integration assay, rosettes were pre-formed as described above. Donor cells were
prepared using retinas from Nrl-GFP or Nrl-/-;Ccdc136GFP/GFP mice at postnatal day 3-6. The
retinas were dissociated and sorted as described above. The purified donor cells were then added
to preformed rosettes at a concentration of 25 000 cells per well. The cultures were incubated for
another 3 DIV before fixation and immunostaining.
3.5 Fixation and Immunostaining
To prepare the rosette cultures for immunostaining, the cultures were fixed by incubating with
4% paraformaldehyde for 10 minutes followed by 3 washes with PBS (0.14 M NaCl, 2.5 mM
KCl, 0.2 M Na2HPO4, 0.2 M KH2PO4). The cultures were then blocked in 10% donkey serum
(DS) (Sigma Aldrich), 0.5% Triton-X in PBS for one hour at room temperature. The primary
antibodies were diluted at various concentrations summarized in Table 3.3 in 5% DS, 0.25%
Triton-X in PBS and were incubated overnight at 4˚C. The cultures were then washed 3 times
using PBS and then incubated with secondary antibodies at various concentrations summarized
in Table S4 in PBS for 1.5 hours at room temperature in a light protected humidified box. Cell
nuclei were counterstained with Hoechst 33342 (Life technologies) diluted in PBS at a
concentration 1:15000 for 20 minutes at room temperature. The cultures were then washed one
last time with PBS before being stored in a light protected container or imaging.
31
Table 3.3: List of antibodies used for immunocytochemistry
Antibody Species Dilution Supplier
Primary Antibodies
Anti-Glutamine synthetase Rabbit 1:5000 Abcam (AB49873)
Anti-β-catenin Mouse 1:1000 Millipore (05-665)
Anti-Cone arrestin Rabbit 1:1000 Millipore (AB15282)
Anti-Vsx2 Sheep 1:500 Exalpha (X1179P)
Anti-EGFP Goat 1:500 Rockland Inc. (600-101-215)
PNA Lectin Biotinylated 1:1000 Vector (B-1975)
Anti-RNA Binding Protein
with Multiple Splicing
Rabbit 1:1000 Abcam (AB194213)
Anti-Rhodopsin (B630) Mouse Supernatant
Anti-tdTomato Rabbit 1:500 Rockland Inc (600401379)
Anti Zo-1 Mouse 1:500 Life technologies (33-9100)
Secondary Antibodies
Streptavidin Cy3 Biotin 1:1000 Cedarlane (CLCSA1010)
Anti-goat 488 Donkey 1:1000 Thermo Fisher (A-11055)
Anti-sheep 555 Donkey 1:1000 Thermo Fisher (A-21436)
Anti-mouse 488 Donkey 1:1000 Thermo Fisher (A-21202)
Anti-mouse 555 Donkey 1:1000 Thermo Fisher (A-31570)
Anti-mouse 647 Donkey 1:1000 Thermo Fisher (A-31571)
Anti-rabbit 488 Donkey 1:1000 Thermo Fisher (A-21206)
Anti-rabbit 555 Donkey 1:1000 Thermo Fisher (A-31572)
Anti-rabbit 647 Donkey 1:1000 Thermo Fisher (A-31573)
32
3.6 Confocal Imaging, Quantification and Statistics
Rosette cultures were imaged using a LSM 780 confocal microscope. Images for quantification
were taken at a 20X magnification and representative images were taken at 40X magnification.
Acquisition parameters were as follows: resolution was 2048 by 2048 pixels, laser intensity was
set at 2%, digital gain at no more than 800, averaging was 4 and pinhole size was 1 airy unit (as
determined by Zeiss). Comparative images were taken using identical parameters. Live imaging
was performed using identical parameters at 20X magnification and 15 minute intervals in a
CO2-buffered environmental chamber (Zeiss). Both rosette size and number were quantified
using ImageJ. Rosettes were counted if their lumen stained positive for peanut agglutinin (PNA)
and if they had a significant up-regulation of β-catenin. A two-tailed student’s t-test or a one-way
ANOVA was used to determine significance where appropriate. All data are presented as mean ±
standard error of the mean (SEM).
33
Chapter 4
Results 4
4.1 Optimization and Immunocytochemical Characterization of
Mouse Retinal Organoid Culture
We optimized the conditions required to generate reproducible organoid formation in serum free
conditions from dissociates of perinatal mouse retina (Figure 4.1A schematic) by comparing
tissue stage, cell density, well size, and coating substrate, all of which affect cellular organization
in-vitro. We used defined, serum free conditions because of the reported inhibitory effects of
serum on photoreceptor differentiation (Neophytou, C., et al., 1997). We determined that P1-2
retinas plated at 106 cells/0.785 cm2 (24 well plate well) formed aggregates by 6 days in-vitro (6
DIV) more frequently than retinas from P4-P8 pups. Plating with multiple coating substrates
determined that re-aggregate formation requires the presence of laminin. Although poly-D-lysine
was not required for re-aggregate formation, it facilitated cell adherence to the glass surface to
allow for easier handling and staining post-fixation. We characterized the landscape of cultures
by quantifying the size and location of individual re-aggregates across multiple wells (Figure
4.1B-C). Re-aggregate structures formed at a 10-20-fold higher frequency in proximity to the
wall of the well, having an average area of 2613 (± 454) μm2 (Figure 4.1D). Orthogonal axis
evaluation of re-aggregates via confocal Z-stack reconstruction revealed the 3-D organization of
these structures (Figure 4.2A), which contain a central acellular lumen that extends throughout
the full extent of the Z-axis (Figure 4.2A’-A’’’). Previous studies describe the transient
persistence of cell cycling by rodent retinal progenitors (Lillien, L. and Cepko, C., 1992); and
34
continued proliferation of Müller glia (Nickerson, P.E., et al., 2008) when maintained in-vitro.
To assay whether residual proliferation was associated with re-aggregate formation we pulsed
cultures continuously with EdU starting from either day 0 (plating) or 24 hours after plating
(Figure 4.2B-C). Cultures pulsed at day 0 and evaluated at 6 DIV contained EdU-positive re-
aggregates (7.7 EdU-positive nuclei per organoid ± 1.1 – Figure 4.2D). In contrast, EdU labeling
was nearly absent in cultures pulsed at 24h (0.6 EdU-positive nuclei per re-aggregate ± 0.2),
indicating that aggregates grown in mitogen-free conditions are derived from post-mitotic cells
and progenitors that completed their last S-phase in culture. To determine the cellular
composition of retinal re-aggregates, we seeded cultures formed from either wildtype retinas,
evaluation of immunocytochemical profiling with cell-type specific antibodies or lectins revealed
that retinal re-aggregates contain multiple classes of retinal cells (Figure 4.3A-G). Specifically,
cells in re-aggregates expressed the photoreceptor marker Otx2, cone markers PNA and cone
arrestin (CArr), rod markers rhodopsin, Müller glia markers glutamine synthetase (GS) and
retinaldehyde binding protein (CRALBP), and the bipolar cell marker visual system homeobox 2
(Vsx2). The absence of Vsx2/CRALBP co-localization (Figure 4.3H) indicated that Vsx2
labeling was specific to bipolar neurons, and that Müller glia do not exhibit features of de-
differentiation in these conditions. Re-aggregates did not stain positive for RNA Binding Protein
with Multiple Splicing (RBPMS), indicating the absence of surviving retinal ganglion cells by 6
DIV (Figure 4.3J). Quantification of the cell lineage composition of organoids based on our
marker panel showed that >95% of re-aggregates stained positive for rhodopsin, GS and CArr,
whereas only 20% of re-aggregates stained positive for Vsx2 (Figure 4.3K), indicating perinatal
mouse retinal re-aggregates are composed of rod and cone photoreceptors, Müller glia, with
variable levels of bipolar cell participation. We furthermore observed that the spatial distribution
35
of apical markers PNA and rhodopsin was restricted to the lumen of retinal organoids (Figure
4.3A, C), indicating that apical/basal polarity is a feature of these structures.
36
Figure 4.1: Spatial and size characterization of retinal organoids. Schematic diagram of the organoid culture protocol (A). Low
magnification DIC image of retinal organoids (A’). Spatial distribution of organoids quantified and rendered as inner and outer quadrants
(B-C). Organoids form at 10-20 fold higher frequency in proximity to the well wall (n = 4) (C). Size distribution of organoids (n = 4) (D).
37
Figure 4.2: 3-dimensional and post-mitotic nature of organoids. Z-stack confocal rendering of the
3-dimensional nature of retinal organoids (A). Visualization of the organoid central lumen at
apical, central and basal optical sections in z-stack rendered image (A’-A’’’). EdU staining
showing the loss of S-phase after 24 hours in culture. (B-C). Quantification of EdU+ cells in
organoids (n = 3) (D). Scale bar = 20 µm
38
Figure 4.3: Immunocytochemical characterization of retinal organoids. Cone markers peanut
agglutinin (PNA) and cone arrestin (CArr) (A-B), rod marker rhodopsin (C-D), Müller glial
markers cellular retinaldehyde binding protein (CRALBP) and glutamine synthetase (GS) (E-F)
bipolar cell marker Vsx2 (G) is not expressed in CRALBP-positive Müller glia (H). The
intermediate filament protein GFAP is up-regulated in organoid Müller glia (I). Absence of
RBPMS-positive retinal ganglion cells (J). Cell fate marker membership within organoids (n = 3)
(K). Scale bar = 20 µm.
39
4.2 Non-photoreceptor cells are required for efficient organoid
assembly
The major cell classes that make up organoids are photoreceptors and Müller glia, which is
reminiscent of the close association between photoreceptor cell bodies and apical processes of
Müller glia in the outer nuclear layer of the retina. To investigate the requirement for
intercellular interactions in organoid formation we asked whether rod photoreceptors alone could
self-organize to form these structures (Figure 4.3).
We enriched rod by cells by fluorescent activated cell sorting (Figure 4.4A-B) of GFP+ cells
from P1-P2 retinas of Nrl-GFP mice, which express enhanced green fluorescent protein under
the control of the rod-specific Nrl promoter (Akimoto, M., et al., 2006) and cultured these cells
as described above. To control for effects of cell sorting, and genetic background effects of the
Nrl-GFP mice, we cultured un-enriched Nrl-GFP cells that were run through the FACS as well
as unsorted wildtype and Nrl-GFP retinal cells. Rod-enriched cultures generated on average 3-
fold fewer organoids compared will all other control groups, indicating that non-rod cell types
are required for efficient organoid assembly (Figure 4.4C). Immunostaining of the few
organoids that did form in the rod-enriched cultures revealed that they contained Müller glia,
which likely represents a minor contamination from the cell sorting (Figure 4.4D). The role of
Müller glia in retina lamination and organization in-vivo and in-vitro is well-documented. Thus,
although not causal, the positive correlation between Müller glial markers and successful
organoid assembly is suggestive of their participation in this process.
40
Figure 4.4: Cell-type requirement of retinal organoids. FACS enrichment of NRL-GFP rods (A). Low magnification DIC and
immunofluorescence image of enriched NRL-GFP rods at time of plating (B). Quantification of organoids in cultures generated from
photoreceptor-enriched fractions as well as non-purified (FACS-treated), unsorted and wildtype controls (n = 3) (C).
Immunocytochemical stains showing mixed composition of Müller glial (GS) and rod-GFP markers in photoreceptor-enriched cultures
(D-D’’’). Yellow scale bar = 100 μm. White scale bar = 20 µm.
41
4.3 Organoids are polarized structures that depend on junctional
integrity
Cytochemical analysis (above) revealed that apical (inner/outer segment) markers such as PNA
and rhodopsin localize to the lumen of the retinal organoids, illustrating the propensity of these
structures to polarize. In-vivo, Müller glia form adherens and tight junctions along the inner
segments of photoreceptors to form an OLM. To determine whether organoids establish
analogous OLM characteristics, we stained for markers associated with a selection of junctional
proteins (Figure 4.5A-H). We observed expression of β-catenin, N-cadherin, ZO-1 and the cell
polarity regulator Par-3 in the organoids (Figure 4.5A, C, G, E). However, instead of them
forming a compact line at the apical side of the organoid, analogous to the OLM in the retina,
these markers were enriched in a diffuse pattern in the organoid lumen (β-cat, Zo-1 and N-cad)
or distributed throughout the organoid (Par3) (Figure 4.5A, C, G, E). With the exception of
Par3, the expression of the other junctional markers was nearly undetectable in basal regions of
the organoid and in single cells in the cultures (Figure 4.5B, D, F, H), suggesting that the luminal
accumulation was an indication of the presence of functionally relevant junctions. In-vivo, the
absence or disruption of junctional complexes results in loss of apical/basal integrity and the
formation of rosettes and dysplasic foci at the OLM (Masai, I., et al., 2003, Wong, G.K., et al.,
2012). Junctional complexes have been shown to be dependent on the presence of calcium, and
depletion of calcium has been shown to disrupt their ability to form (Bleich, M., et al., 2012). To
test whether calcium-dependent organoid junctions are necessary for assembly and polarity, we
cultured retinal dissociates in the presence of varying concentrations of the calcium chelating
agent, EGTA, and quantified the number of organoids at 6 DIV. Organoid assembly was
42
significantly disrupted in a dose-dependent manner, with a concomitant dose-dependent decrease
in the level of β-catenin staining (Figure 4.5I-L’, M). To rule out the possibility that this effect
was secondary to EGTA-induced toxicity, we quantified cell density in the central region of the
well where organoids typically do not form, and verified that the density was not significantly
different across treatment groups (Figure 4.5N). Thus, organoids exhibit apical enrichment of
junction proteins and their formation is dependent on Ca2+ signaling, which together suggests
that Ca2+-dependent junction formation is required for self-organization.
43
Figure 4.5: Upregulation of junctional markers in organoids. Immunocytochemical stains
showing presence of β-catenin (A-B), N-cadherin (C-D), Par-3 (E-F) and ZO-1 (G-H) in retinal
organoids and single cells. Cadherin junctions (I-N) in organoids are sensitive to presence of
calcium. A dose-dependent decrease in β-catenin is observed when EGTA added (I-L). Although
no loss in cell density is observed in organoid-free regions of the well with EGTA-treatment (n =
3) (N), organoid assembly decreases in a dose-dependent manner (n = 3) (M). Scale bar = 20 μm.
44
4.4 Establishment of Organoid Engraftment Assay
We sought to determine whether organoids can be used to investigate photoreceptor cell motility
and engraftment potential. To investigate both rod and cone dynamics, we FACS enriched
populations of Nrl-GFP (Rod-GFP), as well as GFP-expressing photoreceptors from Nrl-/-;Ccdc-
136GFP/GFP mice. Nrl-/-;Ccdc-136GFP/GFP mice contain a cone-rod (“Cod”) hybrid cell type that
expresses a gene-trap GFP at the Ccdc136 locus (Smiley, S., et al., 2016), and are referred to as
Cod-GFP cells. To test the engraftment potential of “donor” photoreceptors into organoids, Rod-
GFP and Cod-GFP cells were added to previously-established (6 DIV) organoid cultures. Live-
imaging over 5 days revealed the migration of single GFP-expressing photoreceptors toward
organoids (Figure 4.6A). Furthermore, motile cells engage with the perimeter of organoids, and
exhibit what appeared to be bona fide engraftment into the organoids (Figure 4.6A). Comparison
of Cod-GFP and Rod-GFP apparent engraftment rate indicated differential integration capacities,
with 64.8 ± 3.4% and 91.2 ± 3.7% of organoids containing at least one Cod or Rod-GFP+ cell,
respectively (Figure 4.6H). To further confirm cell engraftment, and to exclude GFP material
exchange-mediated false-positives, we pulsed Rod-GFP mice with three injections of EdU at P1
to indelibly label rod progenitors completing their last S-phase. At P4, EdU labeled retinas were
harvested, FACS enriched, and added to established organoid cultures. Initial flow cytometric
quantification of EdU coverage within the GFP+ population indicated that 15% of GFP donor
cells were EdU labeled. Analysis of recipient organoids revealed that 18% of engrafted GFP+
cells derived from organoid cultures were also EdU-positive, confirming that GFP+ cells within
organoids are of donor origin. Immunolabeling for β-catenin was performed to determine
whether engrafted donors exhibit markers expression of junctional proteins, and thus participate
in the polarized organoid structure. Staining revealed the β-catenin localization in GFP-positive
45
engrafted cells, indicating that donor cells upregulate junctional proteins (Figure 4.6B-F’).
Collectively, these data indicate that donor photoreceptors engraft into established organoids,
and participate with the polarization that is present in these structures.
46
Figure 4.6: Donor cells have capacity to engraft into organoids. Time-lapse series of Cod-GFP
donor cell motility and engraftment into wildtype organoids (A). Presence of β-catenin
surrounding engrafted donor cells (B-F). Pre-labeled EdU/Nrl-GFP co-labeled donor cell within
an organoid, indicating that engraftment is not a function of donor/host material exchange (G).
Quantification of the proportion of organoids that contain either Rod-GFP or Cod-GFP donor
cells (n = 3) (H). Frequency distribution histogram of Rod-GFP or Cod-GFP donor cell
engraftment into wildtype organoids (n = 3) (I). Scale bar = 20 µm
47
4.5 Rod-GFP donor cells exhibit a unique neurite outgrowth
engraftment phenotype in Crx-/- organoids
To investigate how photoreceptor maturation affects organoid formation and cell engraftment,
we assessed the ability of Crx-/- dissociates to form retinal organoids, and further to this, their
ability to permit the integration of Rod-GFP donors. As mentioned in the introduction, CRX is a
homeobox transcription factor that is required for photoreceptor development and in its absence
photoreceptors are still specified, but they fail to differentiate and ultimately, they undergo
degeneration (Furukawa, T., et al., 1997). Crx-/- cultures were able to form intact organoids,
however, the immunocytochemical features of these organoids differed from wildtype
counterparts. Specifically, although glutamine synthetase staining in Crx-/- cultures (Figure 4.7A)
was similar to controls (Figure 4.3F - above), the mature photoreceptor markers CArr, PNA and
rhodopsin were not detected (data not shown), indicating either an impairment of these cells to
participate in assembly, or a failure of participating photoreceptors to mature. Staining of Crx-/-
organoids for the early marker OTX2, a transcription factor that functions upstream of CRX and
is expressed in photoreceptors and bipolar cells (Bovolenta, P., et al., 1997) showed that the
majority of cells present were either a photoreceptor or bipolar cell fate (Figure 4.7B). Vsx2
staining revealed that much like wildtype organoids (Figure 4.3G), few bipolar cells are present
in Crx-/- cultures indicating that the majority of Crx-/- organoid cells remain as immature
photoreceptors (Figure 6C), which is consistent with the in-vivo defects in the Crx-/- retina
[furukawa]. To test the integration capacity of Crx-/- organoids, we added P4 wildtype Rod-GFP
photoreceptors to established Crx-/- organoids and quantified the number of engraftment events.
No significant differences in total integration events were observed when comparing Crx-/-
organoids to wildtype, despite a slight downward trend in the Crx-/- cultures (% of engrafted
48
organoids wildtype 91.2 +/- 3.7% vs Crx-/- 80.2% +/- 4.2%) (Figure 4.6H ,4.7D). Morphological
analysis revealed that a subset of integrated Rod-GFP donor cells exhibited an increase in neurite
extension in Crx-/- compared with wildtype organoids (Figure 4.7E-F). Quantification of the
proportion of integrated Rod-GFP cells with neurites revealed that 40% (+/- 0.4%) of these cells
had processes compared to 18% (+/- 4.3%) of wildtype counterparts (Figure 4.7G). Although not
statistically significant, Rod-GFP donors in Crx-/- cultures had longer mean neurite length
compared to those in wildtype recipient organoids (Figure 4.7H). Collectively, these data
indicate that CRX is not required for organoid formation but that CRX-deficiency exert a unique
outgrowth phenotype in wildtype donor rods, indicating that there are unique, non-cell
autonomous factors in mutant environment that influence wildtype photoreceptor behaviour.
49
Figure 4.7: Immunocytochemical characterization of Crx-/- organoids. Otx2 (A), Vsx2 (B) and
glutamine synthetase (C) stains showing presence of photoreceptors, bipolar neurons and Müller
glia respectively, in Crx-/- organoids. Engraftment of donor cells and donor cell processes in both
Crx-/- (G-I) and wildtype organoids (J-L). Quantification of number of cells with neural
processes (D) and length of neural processes (E) of donor cells in Crx-/- and wildtype cultures (n
= 3). Quantification of donor cell engraftment in Crx-/- organoids (F). Scale bar = 10 µm
50
Chapter 5
Discussion 5
“Part of what it is to be scientifically-literate, it's not simply, 'Do you know what DNA is? Or
what the Big Bang is?' That's an aspect of science literacy. The biggest part of it is do you know
how to think about information that's presented in front of you.” – Neil DeGrasse Tyson
5.1 Establishment of an Organoid Culture
Previous work has shown the capacity of embryonic and perinatal retinal dissociates to re-
aggregate into laminar structures (Vollmer, G., and Layer, P.G., 1987, Willbold, E., et al., 2000,
Kelley, M.W., et al., 1994). Here we have characterized in more detail the self-organization
property of murine retinal dissociates. Similar to experiments performed using chick and rat
dissociates in a rotating culture, murine re-aggregates form polarized 3-dimensional structures
organized around an apical acellular lumen. The cellular composition of these retina re-
aggregates is consistent with previous studies revealing the presence of rod and cone
photoreceptors, bipolar cells and Müller glia (Kelley, M.W., et al., 1994, Rothermel, A., et al.,
2005).
The cellular composition of our aggregates mimics that of the ONL of a retina in-vivo. An
integral component of the ONL is the OLM, which is formed from the interaction between
photoreceptors and Müller glia. Although not as organized and well-defined as the OLM in-vivo,
our re-aggregates display up-regulation of relevant OLM junctional proteins. Consistent with the
hypothesis that the up-regulation and formation of this OLM-like structure is required for re-
51
aggregation, we show that disruption of calcium ion concentrations inhibit the re-aggregation of
retinal cells. Our aggregates show self-organization, the presence of multiple post-mitotic cell
types in our aggregates and the up-regulation of relevant junctional proteins allow us to classify
these structures as organoids.
We also wanted to determine whether organoid formation required specific cell types.
Interestingly, we found that there was a requirement for a non-photoreceptor cell type for
aggregation to occur. Re-aggregation in purified photoreceptor cultures was associated with
contaminating Müller glial cells and together with our analysis showing that Müller glia, as
opposed to bipolar cells, are represented in nearly all regular aggregates, strongly suggests a role
for Müller glia in the self-organization. This idea is consistent with the integral role of Müller
glia in the aggregation process in both chick and zebrafish dissociates (Willbold, E., et al., 2000,
Eldred, M.K., et al., 2017). Thus, although we did not test the requirement for Müller glia
directly, our findings strongly suggest that Müller glia play an essential role in the ability of cells
to aggregate.
5.2 Utility of organoids in a novel engraftment assay
Organoids are being exploited to model disease states, as a platform for drug screening and as an
efficient way of generating specific cell types for transplantation therapy (Lancaster, M.A., and
Knoblich, J.A., 2014). Indeed, with respect to the retina, previous studies have shown the
potential for ES and retinal stem cells to generate transplantable photoreceptors in a 3-
dimensional culture system (Eiraku, M., et al., 2010, Inoue, T., et al., 2010). Here, in contrast,
we investigated whether organoids could be used to model photoreceptor cell engraftment.
Donor cells transplanted in the subretinal space need to overcome many obstacles to engraft,
52
primary of which is to migrate and interact with host tissue in a heterologous environment. The
retinal organoids described in this study recapitulate aspects of the cellular composition and
intercellular interactions in the endogenous ONL, including presence of photoreceptors and
Müller glia making it a suitable platform for modeling the interaction between donor cells and
host photoreceptors and Müller glia in-vivo.
Indeed, we show that donor photoreceptors added to established organoids can migrate in the
culture and integrate into these structures. Additionally, we observe no evidence that donor cells
disassociate from organoids after integration prompting us to speculate that donor cells are
interacting with cells in the organoid. Furthermore, we confirm that reporter positive cells within
organoids are a result of engraftment proper and not a result of material transfer. There is donor
to recipient specificity to the engraftment: engraftment rates differ between rods and hybrid cone
donor cells and mutant recipients affect the maturation of donor cells.
Although our organoid system recapitulates some of the interactions in an in-vivo transplant
scenario, there are differences between our system and the in-vivo equivalent: these limitations
include, partial maturity of the organoid cells, the inverted topology where in our system, the
donor cell would encounter the basal surface instead of the apical surface as they would in a
transplant scenario lack of RPE and immune response. However, while the developmental timing
may not fully mimic the in-vivo environment, regulators of engraftment in this context could still
be relevant and exploited in the in-vivo adult retina. Furthermore, our data validate the utility of
donor-recipient modeling through the use of organoid cultures, and provide a baseline metric for
follow-up studies that screen for mechanisms that impact this process.
53
5.3 Comparisons to established in-vitro retinal models
The topology exhibited by self-organizing retinal cultures differs between species and culture
conditions. Classical work from Layer and Willbold demonstrated the capacity of dissociated
chick retinal cells to self-organize and assemble into the various retinal layers (Layer, P.G., et
al., 2002, Layer, P.G., et al., 2001). Recent work in zebrafish has established a similar potential
of ocular organoids to organize into multi-laminar retinal structures (Eldred, M.K., et al., 2017).
Notably, these fish cultures, like avian organoids, require both retinal and RPE cells, and use of
conical-bottom culture dishes that encourage the physical aggregation of cells into a pellet-like
mass. Although these retina/RPE co-cultures provide an organoid preparation that exhibits
similar architecture to the in-vivo retina and can be used to characterize the impact of
neurochemical and cellular regulation of retinal development, these studies were performed in
model systems that are not relevant for studying engraftment in the context of photoreceptor
transplantation.
In mammalian systems, organoids formed using embryonic or perinatal tissues were unable to
recapitulate the 3-dimensional structures with retinal layers observed in avian studies. Early
studies using rat dissociates showed the presence of a 2-dimensional organized structure with
multiple cell types. It was not until 2005 that Rothermel, A., et al. used a rotational culture
system that 3-dimensional structure were generated using a mammalian dissociates. In contrast
with the study performed by Rothermel, A. et al. in 2005 using rat dissociates, there was no
presence of retinal ganglion cells. This difference could be attributed to both the species
differences and the differences in culturing media: the presence of serum in their culture system
versus serum-free condition in ours. The presence of serum could also explain the differences in
the number of mitotic cells between the two cultures (Rothermel, A., et al., 2005). As serum has
54
been shown to have inhibitory effects on photoreceptor development (Neophytou, C., et al.,
1997), it seems that the presence of serum pushes organoids into an IPL-like spheroid and the
lack thereof encourages the formation of an ONL-like organoid (Rothermel, A., et al., 2005).
Additionally, due to the increasing number of genetic tools at their disposal, there is a shift in the
scientific community to use mice over rats.
Another in-vitro retinal system researchers have utilized is the embryonic stem cells eye cups
that bear striking resemblance to a developing eye (Eiraku, et al., 2011, Nakano, et al., 2012) and
while this model may be more physiologically relevant, it has the caveat of requiring long
incubation times and a suspension cultures system. The suspension culture system prevents
donor cells from being added into a uniform field. These caveats coupled with reproducibility
issues make this model impractical for modeling engraftment and potential high-throughput
screens. Caveats aside, the ES-derived eye cup system could be modified to an engraftment assay
for validating a refined list of candidate targets.
5.4 Photoreceptor motility
In a developmental context, photoreceptors and their precursors, unlike other neurons in the
CNS, are not required to migrate at any point during their life cycle (Chow, R.L. and Lang, R.A.,
2001). Photoreceptors are born in the apical region and do not exhibit movement as they are
anchored both apically and basally (Baye, L.M. and Link, B.A., 2008). Although, it has been
observed that during development, photoreceptors engage in interkinetic nuclear migration, this
movement is limited to the nucleus rather than the cell itself (Baye, L.M. and Link, B.A., 2008).
Thus, it is a surprising observation that donor cells are not only capable of movement, but also
capable of engraftment into an established organoid. A potential mechanism underpinning the
55
observed motility could be the absence of tissue interactions that inhibit motility. Previous work
studying neuronal migration has shown the motility of dissociated neural precursor cells in-vitro
(Flanagan, L.A., et al., 2006). Interestingly, a major mediator of neural precursor cell motility in-
vitro was laminin (Flanagan, L.A., et al., 2006): the same substrate used to induce aggregation in
this study. Similarly, laminin enhanced migration of post-mitotic olfactory neurons as well
(Calof, A.L. and Lander, A.D., 1991). Thus, the observed motility may be an inherent property
of photoreceptors, but this phenotype is never observed due to the cell-cell interactions within
the tissue and the presence of inhibitory cues. Further studies will be required to conclude which
molecular pathways are involved in this process. Another potential factor underlying
photoreceptor motility is the aforementioned interkinetic nuclear migration. The developmental
timing of this process coincides with the dissociation of the donor cells used in this study (Baye,
L.M. and Link, B.A., 2008). Further studies will be required to determine the effect of
developmental age on cell motility.
56
Chapter 6
Conclusion 6
Retinal degeneration is slated to affect more than 200 million people worldwide by 2020 (Wong,
W.L., et al., 2014). As there is no curative therapy currently, researchers have studied the
feasibility of photoreceptor transplantation; however, with recent findings in photoreceptor
transplantation confounding a decade’s worth of research, a validated tool is required to
determine factors that influence engraftment and transfer specifically. Self-organizing primary
and stem-cell derived cultures provide valuable insight into the collective interaction of
heterogeneous cell populations that result in complex tissue structures. The procurement of organ
and tissue primordia from a diversity of animal systems allows us to model the kinetics of cell
motility, contact and aggregation in-vitro, with the further benefit of allowing us considerable
control over the culture microenvironment. Building on decades of in-vitro retinal culture
modeling, we have established highly reproducible organoid protocol that can be used to test the
engraftment of donor photoreceptors.
57
References
1. Agathocleous, M., & Harris, W. A. (2009). From progenitors to differentiated cells in the vertebrate retina. Annual Review of Cell and Developmental, 25, 45-69.
2. Akimoto, M., Cheng, H., Zhu, D., Brzezinski, J. A., Khanna, R., Filippova, E., ... & Zareparsi, S. (2006). Targeting of GFP to newborn rods by Nrl promoter and temporal expression profiling of flow-sorted photoreceptors. Proceedings of the National Academy of Sciences of the United States of America, 103(10), 3890-3895.
3. Arshavsky, V. Y., Lamb, T. D., & Pugh Jr, E. N. (2002). G proteins and phototransduction. Annual review of physiology, 64(1), 153-187.
4. Ballios, B. G., Cooke, M. J., Donaldson, L., Coles, B. L., Morshead, C. M., van der Kooy, D., & Shoichet, M. S. (2015). A hyaluronan-based injectable hydrogel improves the survival and integration of stem cell progeny following transplantation. Stem cell reports, 4(6), 1031-1045.
5. Barber, A. C., Hippert, C., Duran, Y., West, E. L., Bainbridge, J. W., Warre-Cornish, K., ... & Pearson, R. A. (2013). Repair of the degenerate retina by photoreceptor transplantation. Proceedings of the National Academy of Sciences, 110(1), 354-359.
6. Bartsch, U., Oriyakhel, W., Kenna, P. F., Linke, S., Richard, G., Petrowitz, B., ... & Ader, M. (2008). Retinal cells integrate into the outer nuclear layer and differentiate into mature photoreceptors after subretinal transplantation into adult mice. Experimental eye research, 86(4), 691-700.
7. Bassett, E. A., & Wallace, V. A. (2012). Cell fate determination in the vertebrate retina. Trends in neurosciences, 35(9), 565-573.
8. Baye, L. M., & Link, B. A. (2008). Nuclear migration during retinal development. Brain research, 1192, 29-36.
9. Berson, E. L., Rosner, B., Sandberg, M. A., Hayes, K. C., Nicholson, B. W., Weigel-DiFranco, C., & Willett, W. (1993). A randomized trial of vitamin A and vitamin E supplementation for retinitis pigmentosa. Archives of ophthalmology, 111(6), 761-772.
10. Bleich, M., Shan, Q., & Himmerkus, N. (2012). Calcium regulation of tight junction permeability. Annals of the New York Academy of Sciences, 1258(1), 93-99.
11. Boynton, R. M. (1988). Color vision. Annual review of psychology, 39(1), 69-100.
12. Brem, R. B., Robbins, S. G., Wilson, D. J., O'Rourke, L. M., Mixon, R. N., Robertson, J. E., ... & Rosenbaum, J. T. (1994). Immunolocalization of integrins in the human retina.
58
Investigative ophthalmology & visual science, 35(9), 3466-3474.
13. Brzezinski, J. A., & Reh, T. A. (2015). Photoreceptor cell fate specification in vertebrates. Development, 142(19), 3263-3273.
14. Carter ‐Dawson, L. Structural analysis using light and electron microscopy. Journal of Comparative Neurology, 188(2), 245-262.
15. Cayouette, M., & Raff, M. (2003). The orientation of cell division influences cell-fate choice in the developing mammalian retina. Development, 130(11), 2329-2339.
16. Chacko, D. M., Rogers, J. A., Turner, J. E., & Ahmad, I. (2000). Survival and differentiation of cultured retinal progenitors transplanted in the subretinal space of the rat. Biochemical and biophysical research communications, 268(3), 842-846.
17. Chen, S., Wang, Q. L., Nie, Z., Sun, H., Lennon, G., Copeland, N. G., ... & Zack, D. J. (1997). Crx, a novel Otx-like paired-homeodomain protein, binds to and transactivates photoreceptor cell-specific genes. Neuron, 19(5), 1017-1030.
18. Chow, R. L., & Lang, R. A. (2001). Early eye development in vertebrates. Annual review of cell and developmental biology, 17(1), 255-296.
19. Curcio, C. A., Sloan Jr, K. R., Packer, O., Hendrickson, A. E., & Kalina, R. E. (1987). Distribution of cones in human and monkey retina: individual variability and radial asymmetry. Science, 236, 579-583.
20. Daniele, L. L., Lillo, C., Lyubarsky, A. L., Nikonov, S. S., Philp, N., Mears, A. J., ... & Pugh, E. N. (2005). Cone-like morphological, molecular, and electrophysiological features of the photoreceptors of the Nrl knockout mouse. Investigative ophthalmology & visual science, 46(6), 2156-2167.
21. Eiraku, M., Takata, N., Ishibashi, H., Kawada, M., Sakakura, E., Okuda, S., ... & Sasai, Y. (2011). Self-organizing optic-cup morphogenesis in three-dimensional culture. Nature, 472(7341), 51-56.
22. Eldred, M. K., Charlton-Perkins, M., Muresan, L., & Harris, W. A. (2017). Self-organising aggregates of zebrafish retinal cells for investigating mechanisms of neural lamination. Development, 144(6), 1097-1106.
23. Euler, T., Haverkamp, S., Schubert, T., & Baden, T. (2014). Retinal bipolar cells: elementary building blocks of vision. Nature Reviews Neuroscience, 15(8), 507-519.
24. Flanagan, L. A., Rebaza, L. M., Derzic, S., Schwartz, P. H., & Monuki, E. S. (2006). Regulation of human neural precursor cells by laminin and integrins. Journal of neuroscience research, 83(5), 845-856.
59
25. Friedman, D. S., O’colmain, B. J., Munoz, B., Tomany, S. C., McCarty, C., De Jong, P. T., ... & Kempen, J. (2004). Prevalence of age-related macular degeneration in the United States. Arch ophthalmol, 122(4), 564-572.
26. Furukawa, T., Morrow, E. M., & Cepko, C. L. (1997). Crx, a novel otx-like homeobox gene, shows photoreceptor-specific expression and regulates photoreceptor differentiation. Cell, 91(4), 531-541.
27. Furukawa, T., Morrow, E. M., Li, T., Davis, F. C., & Cepko, C. L. (1999). Retinopathy and attenuated circadian entrainment in Crx-deficient mice. Nature genetics, 23(4), 466-470.
28. Germer, A., Kühnel, K., Grosche, J., Friedrich, A., Wolburg, H., Price, J., ... & Mack, A. F. (1997). Development of the neonatal rabbit retina in organ culture. Brain Structure and Function, 196(1), 67-79.
29. Haider, N. B., Jacobson, S. G., Cideciyan, A. V., Swiderski, R., Streb, L. M., Searby, C., ... & Duhl, D. (2000). Mutation of a nuclear receptor gene, NR2E3, causes enhanced S cone syndrome, a disorder of retinal cell fate. Nature genetics, 24(2), 127-131.
30. Hamel, C. P. (2007). Cone rod dystrophies. Orphanet Journal of Rare Diseases, 2(7), 1750-72.
31. Hartong, D. T., Berson, E. L., & Dryja, T. P. (2006). Retinitis pigmentosa. The Lancet, 368(9549), 1795-1809.
32. Hennig, A. K., Peng, G. H., & Chen, S. (2008). Regulation of photoreceptor gene expression by Crx-associated transcription factor network. Brain research, 1192, 114-133.
33. Hobbs, R. P., & Bernstein, P. S. (2014). Nutrient supplementation for age-related macular degeneration, cataract, and dry eye. Journal of ophthalmic & vision research, 9(4), 487.
34. Hubel, D. H., & Wiesel, T. N. (1968). Receptive fields and functional architecture of monkey striate cortex. The Journal of physiology, 195(1), 215-243.
35. Inoue, T., Coles, B. L., Dorval, K. I. M., Bremner, R., Bessho, Y., Kageyama, R., ... & Tremblay, F. (2010). Maximizing functional photoreceptor differentiation from adult human retinal stem cells. Stem Cells, 28(3), 489-500.
36. Jacobs, G. H. (1993). The distribution and nature of colour vision among the mammals. Biological Reviews, 68(3), 413-471.
37. Jeon, C. J., Strettoi, E., & Masland, R. H. (1998). The major cell populations of the mouse retina. Journal of Neuroscience, 18(21), 8936-8946.
60
38. Kelley, M. W., Turner, J. K., & Reh, T. A. (1994). Retinoic acid promotes differentiation of photoreceptors in vitro. Development, 120(8), 2091-2102.
39. Kelley, M. W., Williams, R. C., Turner, J. K., Creech-Kraft, J. M., & Reh, T. A. (1999). Retinoic acid promotes rod photoreceptor differentiation in rat retina in vivo. Neuroreport, 10(11), 2389-2394.
40. Koike, C., Nishida, A., Ueno, S., Saito, H., Sanuki, R., Sato, S., ... & Kondo, M. (2007). Functional roles of Otx2 transcription factor in postnatal mouse retinal development. Molecular and cellular biology, 27(23), 8318-8329.
41. Koso, H., Minami, C., Tabata, Y., Inoue, M., Sasaki, E., Satoh, S., & Watanabe, S. (2009). CD73, a novel cell surface antigen that characterizes retinal photoreceptor precursor cells. Investigative ophthalmology & visual science, 50(11), 5411-5418.
42. Lamb, T. D., & Pugh, E. N. (2006). Phototransduction, dark adaptation, and rhodopsin regeneration the proctor lecture. Investigative ophthalmology & visual science, 47(12), 5138-5152.
43. Lamba, D. A., Gust, J., & Reh, T. A. (2009). Transplantation of human embryonic stem cell-derived photoreceptors restores some visual function in Crx-deficient mice. Cell stem cell, 4(1), 73-79.
44. Lancaster, M. A., & Knoblich, J. A. (2014). Organogenesis in a dish: modeling development and disease using organoid technologies. Science, 345(6194), 1247125.
45. Layer, P. G., Robitzki, A., Rothermel, A., & Willbold, E. (2002). Of layers and spheres: the reaggregate approach in tissue engineering. Trends in neurosciences, 25(3), 131-134.
46. Layer, P. G., Rothermel, A., & Willbold, E. (2001). From stem cells towards neural layers: a lesson from re-aggregated embryonic retinal cells. Neuroreport, 12(7), A39-A46.
47. Lillien, L., & Cepko, C.L. (1992). Control of proliferation in the retina: temporal changes in responsiveness to FGF and TGFa. Development, 115(1), 253-266.
48. Levine, E. M., Roelink, H., Turner, J., & Reh, T. A. (1997). Sonic hedgehog promotes rod photoreceptor differentiation in mammalian retinal cells in vitro. Journal of Neuroscience, 17(16), 6277-6288.
49. MacLaren, R. E., Pearson, R. A., MacNeil, A., Douglas, R. H., Salt, T. E., Akimoto, M., ... & Ali, R. R. (2006). Retinal repair by transplantation of photoreceptor precursors. Nature, 444(7116), 203-207.
50. Masai, I., Lele, Z., Yamaguchi, M., Komori, A., Nakata, A., Nishiwaki, Y., ... & Wilson, S. W. (2003). N-cadherin mediates retinal lamination, maintenance of forebrain
61
compartments and patterning of retinal neurites. Development, 130(11), 2479-2494.
51. Masland, R. H. (2001). The fundamental plan of the retina. Nature neuroscience, 4(9), 877-886.
52. Mears, A. J., Kondo, M., Swain, P. K., Takada, Y., Bush, R. A., Saunders, T. L., ... & Swaroop, A. (2001). Nrl is required for rod photoreceptor development. Nature genetics, 29(4), 447-452.
53. Moscona, A. A. (1962). Analysis of cell recombinations in experimental synthesis of tissues in vitro. Journal of Cellular and Comparative Physiology, 60(S1), 65-80.
54. Muzumdar, M. D., Tasic, B., Miyamichi, K., Li, L., & Luo, L. (2007). A global double‐fluorescent Cre reporter mouse. genesis, 45(9), 593-605.
55. Nakano, T., Ando, S., Takata, N., Kawada, M., Muguruma, K., Sekiguchi, K., ... & Sasai, Y. (2012). Self-formation of optic cups and storable stratified neural retina from human ESCs. Cell stem cell, 10(6), 771-785.
56. Neophytou, C., Vernallis, A. B., Smith, A., & Raff, M. C. (1997). Muller-cell-derived leukaemia inhibitory factor arrests rod photoreceptor differentiation at a postmitotic pre-rod stage of development. Development, 124(12), 2345-2354.
57. Ng, L., Hurley, J. B., Dierks, B., Srinivas, M., Saltó, C., Vennström, B., ... & Forrest, D. (2001). A thyroid hormone receptor that is required for the development of green cone photoreceptors. Nature genetics, 27(1), 94-98.
58. Nickerson, P. E. B., Da Silva, N., Myers, T., Stevens, K., & Clarke, D. B. (2008). Neural progenitor potential in cultured Müller glia: effects of passaging and exogenous growth factor exposure. Brain research, 1230, 1-12.
59. Nishida, A., Furukawa, A., Koike, C., Tano, Y., Aizawa, S., Matsuo, I., & Furukawa, T. (2003). Otx2 homeobox gene controls retinal photoreceptor cell fate and pineal gland development. Nature neuroscience, 6(12), 1255-1263.
60. Okabe, M., Ikawa, M., Kominami, K., Nakanishi, T., & Nishimune, Y. (1997). ‘Green mice’ as a source of ubiquitous green cells. FEBS letters, 407(3), 313-319.
61. Ortín-Martínez, A., Nadal-Nicolás, F. M., Jiménez-López, M., Alburquerque-Béjar, J. J., Nieto-López, L., García-Ayuso, D., ... & Agudo-Barriuso, M. (2014). Number and distribution of mouse retinal cone photoreceptors: differences between an albino (Swiss) and a pigmented (C57/BL6) strain. PLoS One, 9(7), e102392.
62. Ortin‐Martinez, A., Tsai, E. L. S., Nickerson, P. E., Bergeret, M., Lu, Y., Smiley, S., ... & Wallace, V. A. (2016). A Re‐interpretation of Cell Transplantation: GFP Transfer from Donor to Host Photoreceptors. STEM CELLS.
62
63. Pearson, R. A., Barber, A. C., Rizzi, M., Hippert, C., Xue, T., West, E. L., ... & Luhmann, U. F. O. (2012). Restoration of vision after transplantation of photoreceptors. Nature, 485(7396), 99-103.
64. Pearson, R. A., Gonzalez-Cordero, A., West, E. L., Ribeiro, J. R., Aghaizu, N., Goh, D., ... & Naeem, A. (2016). Donor and host photoreceptors engage in material transfer following transplantation of post-mitotic photoreceptor precursors. Nature communications, 7.
65. Perry, V. H., & Walker, M. (1980). Amacrine cells, displaced amacrine cells and interplexiform cells in the retina of the rat. Proceedings of the Royal Society of London B: Biological Sciences, 208(1173), 415-431.
66. Pugh, E. N., & Lamb, T. D. (1990). Cyclic GMP and calcium: the internal messengers of excitation and adaptation in vertebrate photoreceptors. Vision research, 30(12), 1923-1948.
67. Reh, T. A. (1992). Cellular interactions determine neuronal phenotypes in rodent retinal cultures. Journal of neurobiology, 23(8), 1067-1083.
68. Rothermel, A., Biedermann, T., Weigel, W., Kurz, R., Rüffer, M., Layer, P. G., & Robitzki, A. A. (2005). Artificial design of three-dimensional retina-like tissue from dissociated cells of the mammalian retina by rotation-mediated cell aggregation. Tissue engineering, 11(11-12), 1749-1756.
69. Ramon y Cajal, S. (1972). The structure of the retina. Charles C. Thomas Publisher.
70. Santos‐Ferreira, T., Postel, K., Stutzki, H., Kurth, T., Zeck, G., & Ader, M. (2015). Daylight vision repair by cell transplantation. Stem Cells, 33(1), 79-90.
71. Santos-Ferreira, T., Llonch, S., Borsch, O., Postel, K., Haas, J., & Ader, M. (2016). Retinal transplantation of photoreceptors results in donor–host cytoplasmic exchange. Nature communications, 7.
72. Schwartz, S. D., Hubschman, J. P., Heilwell, G., Franco-Cardenas, V., Pan, C. K., Ostrick, R. M., ... & Lanza, R. (2012). Embryonic stem cell trials for macular degeneration: a preliminary report. The Lancet, 379(9817), 713-720.
73. Sidman, R. L., & Rakic, P. (1973). Neuronal migration, with special reference to developing human brain: a review. Brain research, 62(1), 1-35.
74. Singh, M. S., Issa, P. C., Butler, R., Martin, C., Lipinski, D. M., Sekaran, S., ... & MacLaren, R. E. (2013). Reversal of end-stage retinal degeneration and restoration of visual function by photoreceptor transplantation. Proceedings of the National Academy of Sciences, 110(3), 1101-1106.
63
75. Singh, M. S., Balmer, J., Barnard, A. R., Aslam, S. A., Moralli, D., Green, C. M., ... & MacLaren, R. E. (2016). Transplanted photoreceptor precursors transfer proteins to host photoreceptors by a mechanism of cytoplasmic fusion. Nature Communications, 7.
76. Smiley, S., Nickerson, P. E., Comanita, L., Daftarian, N., El-Sehemy, A., Tsai, E. L. S., ... & Dixit, R. (2016). Establishment of a cone photoreceptor transplantation platform based on a novel cone-GFP reporter mouse line. Scientific reports, 6.
77. Stefanelli, A., Zacchei, A. M., & Ceccherini, V. (1961). Retinal reconstitution in vitro after disaggregation of embryonic chicken eyes (Translated from Italian). Acta Embryol Morphol Exper, 4, 47-55.
78. Strauss, O. (2005). The retinal pigment epithelium in visual function. Physiological reviews, 85(3), 845-881.
79. Swaroop, A., Kim, D., & Forrest, D. (2010). Transcriptional regulation of photoreceptor development and homeostasis in the mammalian retina. Nature Reviews Neuroscience, 11(8), 563-576.
80. Swaroop, A., Wang, Q. L., Wu, W., Cook, J., Coats, C., Xu, S., ... & Sieving, P. A. (1999). Leber congenital amaurosis caused by a homozygous mutation (R90W) in the homeodomain of the retinal transcription factor CRX: direct evidence for the involvement of CRX in the development of photoreceptor function. Human molecular genetics, 8(2), 299-305.
81. Tajima, T., Ohtake, A., Hoshino, M., Amemiya, S., Sasaki, N., Ishizu, K., & Fujieda, K. (2009). OTX2 loss of function mutation causes anophthalmia and combined pituitary hormone deficiency with a small anterior and ectopic posterior pituitary. The Journal of Clinical Endocrinology & Metabolism, 94(1), 314-319.
82. Tucker, B. A., Park, I. H., Qi, S. D., Klassen, H. J., Jiang, C., Yao, J., ... & Young, M. J. (2011). Transplantation of adult mouse iPS cell-derived photoreceptor precursors restores retinal structure and function in degenerative mice. PloS one, 6(4), e18992.
83. Turner, D. L., & Cepko, C. L. (1987). A common progenitor for neurons and glia persists in rat retina late in development. Nature, 328(6126), 131.
84. Wässle, H., & Boycott, B. B. (1991). Functional architecture of the mammalian retina. Physiological reviews, 71(2), 447-480.
85. West, E. L., Pearson, R. A., Tschernutter, M., Sowden, J. C., MacLaren, R. E., & Ali, R. R. (2008). Pharmacological disruption of the outer limiting membrane leads to increased retinal integration of transplanted photoreceptor precursors. Experimental eye research, 86(4), 601-611.
86. Walls, G. L. (1942). The vertebrate eye and its adaptive radiation.
64
87. Willbold, E., Rothermel, A., Tomlinson, S., & Layer, P. G. (2000). Müller glia cells reorganize reaggregating chicken retinal cells into correctly laminated in vitro retinae. Glia, 29(1), 45-57.
88. Wong, G. K., Baudet, M. L., Norden, C., Leung, L., & Harris, W. A. (2012). Slit1b-Robo3 signaling and N-cadherin regulate apical process retraction in developing retinal ganglion cells. Journal of Neuroscience, 32(1), 223-228.
89. Wong, W. L., Su, X., Li, X., Cheung, C. M. G., Klein, R., Cheng, C. Y., & Wong, T. Y. (2014). Global prevalence of age-related macular degeneration and disease burden projection for 2020 and 2040: a systematic review and meta-analysis. The Lancet Global Health, 2(2), e106-e116.
90. Wright, A. F., Reddick, A. C., Schwartz, S. B., Ferguson, J. S., Aleman, T. S., Kellner, U., ... & Lennon, A. (2004). Mutation analysis of NR2E3 and NRL genes in Enhanced S Cone Syndrome. Human mutation, 24(5), 439-439.
91. Wright, A. F., Chakarova, C. F., El-Aziz, M. M. A., & Bhattacharya, S. S. (2010). Photoreceptor degeneration: genetic and mechanistic dissection of a complex trait. Nature Reviews Genetics, 11(4), 273-284.
92. Vollmer, G., Layer, P. G., & Gierer, A. (1984). Reaggregation of embryonic chick retina cells: pigment epithelial cells induce a high order of stratification. Neuroscience letters, 48(2), 191-196.
93. Vollmer, G., & Layer, P. G. (1986). An in vitro model of proliferation and differentiation of the chick retina: coaggregates of retinal and pigment epithelial cells. Journal of Neuroscience, 6(7), 1885-1896.
94. Vollmer, G., & Layer, P. G. (1987). Cholinesterases and cell proliferation in “nonstratified” and “stratified” cell aggregates from chicken retina and tectum. Cell and tissue research, 250(3), 481-487.
95. Yonekawa, Y., Miller, J. W., & Kim, I. K. (2015). Age-related macular degeneration: advances in management and diagnosis. Journal of clinical medicine, 4(2), 343-359.
96. Yoshida, S., Mears, A. J., Friedman, J. S., Carter, T., He, S., Oh, E., ... & Hero, A. O. (2004). Expression profiling of the developing and mature Nrl−/− mouse retina: identification of retinal disease candidates and transcriptional regulatory targets of Nrl. Human molecular genetics, 13(14), 1487-1503.
97. Young, R. W. (1985). Cell differentiation in the retina of the mouse. The Anatomical Record, 212(2), 199-205.