coral disease diagnostics whataem.asm.org/content/early/2006/12/08/aem.02172-06.full.pdf3 48...

1

CORAL DISEASE DIAGNOSTICS: WHAT’S BETWEEN A PLAGUE AND A BAND? 1

2

Ainsworth TD1, Kramasky–Winter E

2, Loya Y

2, Hoegh-Guldberg O

1, Fine M

3 3

4

5

6

7

1Centre for Marine Studies, and The ARC Centre of Excellence for Coral Reef Studies 8

The University of Queensland, St. Lucia, QLD, 4072 Australia, 2Tel Aviv University, Tel 9

Aviv, Israel, and Faculty of Life Sciences, Bar-Ilan University, The Interuniversity 10

Institute for Marine Science, Eilat 88103, Israel. 11

12

Corresponding Author: 13

Tracy Ainsworth 14

Centre for Marine Studies 15

University of Queensland 16

Brisbane, 4072. Australia 17

Email: [email protected] 18

Phone: +61 7 3365 3548 19

Fax: +61 7 3365 4755 20

21

Keywords: Coral disease, histopathology, FISH, The Red Sea 22

Running Title: Coral diseases of Eilat, The Red Sea. 23

24

ACCEPTED

Copyright © 2006, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.02172-06 AEM Accepts, published online ahead of print on 8 December 2006

on June 15, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

http://aem.asm.org/

2

Abstract 25

Recently reports of coral disease have increased significantly across the world’s tropical 26

oceans. Despite increasing efforts to understand the changing incidence of coral disease 27

very few primary pathogens have been identified and most studies remain dependent on 28

the external appearance of corals for diagnosis. As such our current understanding of 29

coral disease, disease progression and the underlying cause of disease is very limited. In 30

the present study we use structural and microbial studies to differentiate different forms 31

of black band disease; atypical black band disease and typical black band disease. 32

Atypical black band diseased corals were infected with the black band disease microbial 33

consortium yet did not show any of the typical external signs of black band disease based 34

on macroscopic observations. In previous studies, these examples, here referred to as 35

atypical black band disease, would have not been correctly diagnosed. We also 36

differentiate white syndrome from white disease on the basis of tissue structure and 37

presence/absence of microbial associates. White diseases are those with dense bacterial 38

communities associated with lesions of symbiont loss and/or extensive necrosis of 39

tissues, while white syndromes are characteristically bacterial free with evidence for 40

extensive programmed cell death/apoptosis associated with the lesion and the adjacent 41

tissues. The pathology of coral disease as a whole requires further investigation. This 42

study emphasizes the importance of going beyond the external macroscopic signs of coral 43

disease for accurate disease diagnosis. 44

45

46

47

ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

3

Introduction 48

Coral disease is considered an important factor in the recent decline of coral reefs 49

worldwide (29, 30, 38, 64). Reports of disease and disease-like syndromes in reef-50

building corals have increased substantially since first being reported in 1973 (10). This 51

increase in the incidence of disease is due in part to a better awareness of coral health, but 52

is also linked to the increased environmental stresses affecting coral reefs (30, 31, 35, 53

44). Between 18 to 30 diverse coral diseases and syndromes are described worldwide 54

(29, 64, 65) on the basis of macroscopic features. Coral disease diagnosis is primarily 55

macroscopic, taking into account characteristics such as the extent of tissue loss, tissue 56

colour and exposure of coral skeleton. These macroscopic disease signs then become the 57

basis for nomenclature and diagnosis. While these characteristics allow broad 58

descriptions of change on reefs, they are unreliable for accurate disease diagnosis and do 59

not increase our understanding of the causes of coral disease and disease progression. 60

61

The reefs of Eilat have endured several decades of high levels of anthropogenic impact 62

(38, 39, 66). As a result coral disease and coral mortality have increased (39, 67) 63

resulting in decreases in coral abundance and diversity over the past 3 decades. 64

Increasing stress from global warming and ocean acidification has also been associated 65

with the overall declining health of Red Sea corals (40). Al- Moghrabi (5) have reported 66

outbreaks of black band disease in the northern Red Sea, and Antonius and Riegl (13) 67

have reported white syndrome on the reefs of the Sinai Peninsula with the most abundant 68

reef building species (Acropora hemprichii) suffering heaviest losses. Ben-Haim et al 69

(17) also reported a new disease of Pocillopora damicornis from the Gulf of Aqaba. In 70

addition anecdotal reports of black band disease became common in the early 1990s in 71

ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

4

the Eilat side of the Gulf of Aqaba although no study was conducted (Loya pers comm.). 72

Recently Barash et al (17) reported that many of the massive corals of Eilat were affected 73

by an infectious white plague-like disease. Despite reports and field observations of these 74

diseases and syndromes within the region, relatively little is known about the pathology, 75

cytology, microbial ecology and disease processes of corals in the Gulf. 76

77

While there have been numerous ecological and field based studies of corals exhibiting 78

disease (49, 50, 51), few primary pathogens have been identified to date (11, 16, 18, 24, 79

31, 32, 34, 36, 48, 53). Also few studies have examined the histopathological and 80

microbial characteristics of diseased corals. Black band disease (BBD) is considered one 81

of the major diseases impacting coral reefs worldwide. The first report of BBD was by 82

Antonius in 1973 (10). Since that time BBD has been observed to affect corals 83

worldwide, especially in polluted environments (5, 13). The black band that is typical of 84

this disease is composed of a mixed microbial mat that is dominated by cyanobacteria 85

and comprises sulphur reducing and sulphur oxidising bacteria, as well as a number of 86

other micro-organisms. The mat overgrows coral tissues, creating a toxic environment 87

and tissue loss is attributed to the presence of high sulphide levels (0.8 mM) in the tissues 88

adjacent the black band (22, 54). The distinct macroscopic signs of this disease and the 89

growth pattern of the mat in a top-down manner across polyps and tissue structures (10, 90

27, 54) are used as the primary method of the disease identification. BBD has been 91

described as one of the main diseases in the Caribbean and Florida Keys where it has 92

been responsible for reef decline (37). Most active during the summer months, BBD is 93

one of the most widespread and destructive coral diseases due to its high impact on 94

ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

5

massive and framework building corals with rates of tissue loss of up to 2 cm per day (27, 95

54). 96

97

White band and white plague diseases have also been described in many regions 98

worldwide, including the Red Sea and Gulf of Aqaba (5, 12, 13, 14, 17, 59). Field based 99

surveys and visual descriptions of these diseases have described them as typically having 100

a lesion of white recently exposed coral skeleton. It is believed that the white band 101

diseases have had a major role in the community structure shift occurring in the 102

Caribbean (15). Reefs off the coast of Florida have experienced increasing occurrence of 103

white diseases with patterns of disease spread suggesting a highly infectious nature (49). 104

While pathogens have been identified with some of the white diseases (24, 46, 48, 51), 105

others have been described as having no observable microbial community (13, 20, 21, 106

47). As such the majority of casual factors underpinning the rise in coral disease have 107

remained elusive particularly for many of the white diseases and white syndromes (21, 108

64). Richardson et al (52) has rightly called for an integrated approach to disease 109

diagnosis that incorporates field and laboratory studies. 110

111

ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

6

In the present study we demonstrate that integrating observations on microbial diversity 112

characteristics with specific cytological observations may be a useful tool in 113

understanding the disease process of corals and improving the basis on which disease is 114

diagnosed. This study has also pointed to some significant problems associated with 115

the simplistic use of macroscopic signs as the only means of identifying coral disease as 116

observed on the Reef of Eilat, Gulf of Aqaba in the summer of 2005. 117

118

Materials and Methods 119

Samples collection and disease identification 120

Corals were surveyed visually for signs of disease in June (early summer) 2005 at depths 121

of 1 to 18 m on coral reefs near the Marine Biological Laboratory at Eilat in the Gulf of 122

Aqaba. Massive and branching corals were assessed for the typical macroscopic signs of 123

disease including: tissue loss and apparent rapid exposure of coral skeleton which is 124

indicative of white diseases and white syndromes, as well as general paling from 125

bleaching and the presence/absence of black bands. All colonies exhibiting signs of 126

disease were photographed using a Nikon CoolPix 5000 (Nikon, Inc) digital camera 127

inside a Subal (Steyr, Austria) underwater housing prior to sampling. Replicate tissue 128

and skeleton samples (n,3) were collected from corals displaying each the observed 129

diseases and syndromes to investigate microbial populations and histopathological 130

features of these diseases. Of the diseases observed in massive (Favid) coral colonies, 6 131

classified as having black band disease (BBD) and 6 classified as having white band 132

disease were sampled in both early and late June 2005. Of the white diseases and white 133

syndromes of other massive and of branching corals replicate samples of each type (n, 3) 134

were collected. 135

ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

7

Sample preservation and tissue processing 136

Coral samples were fixed in 4 % (w/v) paraformaldehyde in sterile phosphate buffered 137

saline (PBS, pH 7.4)(20) for 12 hr, prior to decalcification with 20 % (w/v) EDTA (pH 8) 138

(63) and standard processing for paraffin embedding. Tissues were processed through 139

washes of 70 %, 80, two of 95 % and three of 100 % ethanol for 40 min each, three 140

xylene washes for 40 min and then 3 paraffin washes under vacuum for 40 min each prior 141

to embedding in paraffin. Serial tissue sections (4 µm) were collected onto Superfrost 142

Plus slides (Menzel, Brauschweig, Germany) for use in fluorescence in situ hybridisation 143

(FISH) and histopathology. 144

145

Fluorescence in situ hybridisation 146

Oligonucleotides were Cy3 labeled by Thermo Electron Corporation Pty Ltd, and used in 147

a conventional FISH protocol (6, 7, 8, 9, 41, 42, 43, 58). Paraffin sections were dewaxed 148

through 3 x 5 min washes in xylene and 4 x 5 min washes in fresh 100% ethanol. The 149

hybridisation was conducted in hybridisation buffer (0.9 M NaCl, 0.01% SDS, 0.01 M 150

Tris/HCl pH 7.2) for 1.5 to 2 hr at 46°C, followed by a 10 to 20 min wash in pre-warmed 151

(48°C ) wash buffer (0.08 M NaCl, 0.01 % SDS, 0.01 M Tris/HCl, 0.05 M EDTA) (3). A 152

Zeiss Meta 510 confocal scanning laser microscope (Zeiss, Germany) and spectral profile 153

imaging via the Zeiss Image Browser software were used to visualize tissue 154

autofluorescence and probe conferred fluorescence. Coral tissue sections treated with the 155

FISH protocol without the application of probe were used for spectral profiling (3). This 156

was repeated on several tissue sections for each coral species to determine variability in 157

fluorescence profiles. FISH probes used within this study include a universal bacterial 158

probe mix (EUBmix) and specific group probes for δ-proteobacteria (GAM42A), 159

ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

8

Cytophaga-Flavobacterium (CF319) and Vibrio sp. (MV) (Table 1). These probes were 160

selected as these represent major bacterial groups within oceanic communities and as 161

many Vibrio sp are pathogenic. 162

163

Histopathology 164

The general tissue condition associated with the lesion and the adjacent tissues of each of 165

the diseases was ascertained following staining using Harris’s haematoxylin and eosin 166

(with phyloxine B) (Sigma-Aldrich Pty Ldt, # HHS32 and HT110-1-32). The extent of 167

mass tissue necrosis (swelling and lysis of cells, disruption of cell structure) was 168

recorded. In situ labelling of 3’ end of DNA fragments was used to investigate the 169

presence and extent of programmed cell death (1, 4, 25, 26) using the ApopTag in situ 170

apoptosis detection kit as per manufacturers recommendations (S7101, Chemicon 171

International, Inc. USA). This has been shown to distinguish apoptosis from necrosis by 172

specifically detecting DNA cleavage and chromatin condensation associated with 173

apoptosis and confirmed by lack of necrotic morphology. Cells were defined as apoptotic 174

if the nuclear area of the cell was positively labeled as indicated by red stain as opposed 175

to the blue haematoxylin counter-stained non-apoptotic nuclei (1). 176

177

Results 178

Black band disease. 179

A simultaneous outbreak of black band disease and white band disease in massive 180

corals (from the genus Favia) on reefs of Eilat (Red Sea) was observed during June 181

2005. Black band diseased corals showed typical signs of the disease characterized by 182

a thick black microbial mat that appeared to grow over and into underlying coral tissues 183

ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

9

(Figure 1 A1, a1). The typical macro-scale signs of white band / plague disease in 184

Favia included an apparently clear lesion border between recently exposed bare white 185

skeleton and tissues. The lesion lacked any observable black, mixed microbial band on 186

the coral surface (Figure 1 B1, b1). Newly exposed clean white coral skeleton was 187

visible at the lesion interface and away from the disease lesion (Figure 1 b1). Based on 188

macro-scale signs these corals would be classified/diagnosed as suffering a white 189

disease or white plague. 190

191

Microbial and histopathological investigation of both black band (BBD) and white 192

band/white plague corals identified a similar distinctive cyanobacteria dominated 193

microbial mat. In the BBD the black encircling mat was easily visible on the colony 194

surface. In contrast the white disease/plague of Favia a similar black mat was found 195

deep within the polyp structure and underneath the disease lesion interface. This same 196

mat was identified in all white band sampled colonies in early and late June 2005 (n, 197

12). Given the similarity in cytological response and microbial community we refer to 198

this type of white band as atypical BBD (aBBD). Similar distinct cyanobacterial 199

dominated microbial communities was observed in both BBD and aBBD and appeared 200

to cause tissue lysis and necrosis (compare Figure 1 A2, a2 with Figure 1 B2, b2). 201

Imaging of the microbial communities identified similar morpho-type cyanobacteria 202

dominating the microbial community in both the typical (Figure 1A3,a3) and atypical 203

(Figure 1 B3, b3) black band diseased colonies. 204

205

ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

10

White disease and white syndrome. 206

Both massive and branching corals on the Eilat reefs appeared to be suffering from white 207

disease, typified by abrupt lesions and areas of exposed skeleton adjacent to otherwise 208

normally pigmented tissues. White disease was identified in the massive colonies of 209

Hydnophora sp. (Figure 2 A1, a1) and Porites sp. as well as the branching coral S. 210

pistillata (Figure 4 A1, a1). White syndrome was identified in coral colonies of the 211

plating coral Acropora sp. (Figure 5 A1, a1) in the region. 212

213

There were distinct cytological and microbial differences between these macroscopically 214

similar syndromes. The white disease of Hydnophora sp. was characterized by extensive 215

tissue breakdown and mass tissue necrosis within the lesion areas (Figure 2 A2, a2). The 216

lesions were also extensively populated by bacteria, which were found to penetrate all 217

tissue layers and infiltrating adjacent regions of tissue (Figure 2 A3, a3). Investigation of 218

several tissue sections showed the bacteria were from both δ-proteobacterial (Figure 3 b) 219

and Cytophaga-flavobacterium (Figure 3c) groups, and communities of Vibrio sp. were 220

also found within the lesion (Figure 3d). 221

222

In contrast the white disease observed in the branching coral S. pistillata (Figure 4 A1) 223

exhibited patches of bleaching close to the lesion border and regions of tissue loss (Figure 224

4 a1). Within this white disease or form of white disease, extensive bacterial communities 225

were found in tissue layers associated with the lesion (Figure 3 A3, a3) where a range of 226

bacterial groups were evident, with no single bacterial group being dominant. There was a 227

lack of evidence for extensive tissue breakdown and necrosis (Figure 3 A2, a2), with only 228

small regions of necrosis in the lesion of white disease of S. pistillata, this necrosis was 229

ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

11

limited only to regions of the gastroderm (Figure 4 aa2) presumably associated with 230

macroscopic areas of bleaching. 231

232

Disease signs consistent with descriptions of white syndrome were also observed in the 233

plating Acropora sp. with clear lesions evident between apparently healthy tissues and 234

recently exposed skeleton. The white syndrome identified on Acropora sp. (Figure 5 235

A1) had a distinctly clear lesion border that appeared to be moving quickly across 236

affected corals, as determined by the lack of macro-algal overgrowth over the large 237

exposed areas of skeleton. The exposed skeleton at the lesion was free of any evidence 238

for macro-algal overgrowth (Figure 5 a1) and tissues at the lesion border appeared 239

healthy despite disease progression (Figure 5 B1,b1). Microscopic analysis of the 240

lesion border showed it to be distinctly devoid of any significant bacterial populations 241

with tissue adjacent to the lesion lacking any evidence of tissue breakdown or necrosis 242

associated with the disease (Figure 5 A3, a3). This provides clear evidence of distinct 243

microbial community differences and morphological differences between white 244

syndrome and white diseases (Table 2), which requires further investigation. 245

246

Evidence of necrosis and apoptosis in disease. 247

Haematoxylin and eosin staining of tissue sections revealed extensive evidence for 248

necrosis associated with the tissue loss in Favid corals with black band disease. Tissue 249

breakdown consistent with necrosis was also evident in white disease in Hydnophora 250

sp. and Porites sp. Comparatively little/or no sign of necrosis or a mass loss of tissue 251

integrity were evident in the white disease of S. pistillata or Acropora sp.. In situ end 252

labeling of fragmented DNA used as a marker of programmed cell death, showed no 253

ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

12

evident staining in tissues of the black band diseased massive corals, either typical 254

(BBD, Figure 6 a) or atypical black band (aBBD, Figure 6b,c), or in any of the tissues 255

associated with the necrotic white disease of Hydrophora sp. (Figure 6e,f, g). However 256

positive staining was evident in large regions of tissues associated with white syndrome 257

of Acropora sp. within both epithelial (Figure 6h) and gastrodermal tissue layers 258

(Figure 6i) while no staining was evident in healthy tissue in the same colonies (Figure 259

6j). Positive staining was also evident with the tissue layers of white disease of S. 260

pistillata, (Figure 6k, l) however this was limited only to cells directly adjacent to the 261

tissue lesions (Figure 6m). Cells showing morphology associated with necrotic cell 262

death showed no staining using in situ end labeling for fragmented DNA (Figure 6a-f). 263

Cell death markers consistent with programmed cell death were therefore only 264

identified in the apparent bacteria free lesion of Acropora sp. white syndrome and in 265

the lesion edge of the white disease of S. pistillata and not associated with BBD, or 266

where mass tissue necrosis was evident (Table 2) again demonstrating that white 267

syndrome is distinctly different from white diseases, here based on patterns of cell 268

death associated with the necrotic diseases (Table 2). 269

270

Discussion 271

While coral disease has been reported on the reefs of the northern Red Sea (5, 13, 14, 17, 272

39, 40, 59) this is the first study to explore histopathological changes and in situ 273

microbiology associated with these diseases and syndromes. This approach to the study 274

of coral disease has revealed that dependence on visual macroscopic characteristics alone 275

is unreliable for accurate diagnosis and overlooks critical information on the cellular and 276

microbial processes associated with disease-like states. The incorporation of 277

ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

13

physiological assays, for example descriptions of photosynthetic assimilate translocation 278

(28, 55) which demonstrate colonial activity and integration, and assays addressing host 279

mechanisms (33) are also useful in understanding the coral colony responses to different 280

diseases and may provide important information for disease diagnosis. We suggest that 281

studies going beyond macroscopic disease signs by incorporating cytological, microbial 282

and physiological assays provide a greater detail to truly understand the processes of 283

disease in corals and will provide a better basis on which to make accurate disease 284

diagnosis (Figure 7). Accurate diagnosis of coral disease can direct research and 285

management practices towards addressing and managing the true underlying cause of 286

disease on reefs. 287

288

Atypical Black Band Disease 289

Rosenberg et al (59) and Barash et al (17) recently reported an anomalous temperature 290

spike in the Red Sea and a simultaneous outbreak of black band disease and white plague 291

in the summer months from 2001 to 2004. Attempts by these authors to determine 292

causative agents of the apparent white plague experienced difficulties in pathogen culture 293

and transmission of a suspected pathogen. In the present study histopathological 294

investigation revealed the presence of cyanobacterial dominated microbial mats deep 295

within the coral polyp structure of Favia exhibiting characteristics of white 296

disease/plague. These microbial populations and the pattern of coral tissue disruption 297

were consistent with those observed in the typical black band disease where 298

cyanobacterial filaments were found penetrating tissues deep within the polyp structure. 299

Based on the fact that the apparent white plague corals all contained cyanobacterial mats 300

deep in the tissues, this disease state appears to be an atypical form of black band disease, 301

ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

14

also it appears the black band consortium can cause an apparent white disease or there 302

can be a progression from a white disease into black band disease. We suggest the use of 303

the term atypical black band disease (aBBD) to describe this different form of black band 304

disease. This conclusion is supported by the results of Bythell et al (21) who previously 305

observed an apparent progression from white plague to black band disease in the 306

Caribbean. The difficulties in pathogen identification and infection studies experienced 307

by Barash et al (17) may be due to the fact that some of these diseased corals were 308

actually infected by atypical BBD, illustrating the confusion that relying on macroscopic 309

characteristics alone may incur. We also suggest that the incidence of BBD on reefs 310

maybe estimated if this type of atypical form is common. Studies investigating BBD 311

should also attempt to determine the extent and impact of atypical forms of this disease in 312

other regions. 313

314

White Disease and White Syndrome. 315

White diseases and white syndrome of corals showed marked differences, evident both 316

from microbiological and cytological investigation; here we define ‘white diseases’ and 317

“white syndrome” of corals based on specific microbial and cytological parameters. 318

White diseases characteristically show extensive bacterial infiltration of the lesion tissue 319

layers and tissues adjacent to the disease lesion, as well as extensive necrosis, loss of 320

tissue structure and/or symbiont loss. White diseases also characteristically had little or 321

no evidence for programmed cell death associated with the disease lesions. The term 322

‘white disease’ may encompass a range of diseases or states of the disease, as seen in the 323

example of white disease of S. pistillata in this study. A similar macroscopic pattern of 324

tissue loss was apparent in the white disease of S. pistillata and the white disease of 325

ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

15

Hydnophora sp., yet no mass loss of tissue structure and only small regions of necrosis of 326

the tissue layers were apparent in the white disease of S. pistillata. However dense and 327

mixed microbial communities were evident within the tissue layers characterising both 328

the white disease of massive and branching colonies, bacteria of Cytophaga-329

Flavobacterium and δ-Proteobacterial groups were present in both, as well as 330

communities of Vibrio sp., yet no single bacterial group appeared dominant. The potential 331

of secondary colonizers involved in white diseases and the role of opportunistic 332

pathogens in white disease progression maybe very important as evident by the diverse 333

microbial community of these diseases and also considering the source of highly diverse 334

microbial environments of the coral holobiont (19, 27, 45, 60, 61) and the coral reef. 335

336

In contrast there was a distinct lack of microbial community interaction associated with 337

the disease lesion of white syndrome. The disease lesion of white syndrome is 338

characteristically free of any evidence of mass tissue breakdown, with no loss of 339

structural integrity or necrosis, apparently healthy tissues bordered exposed coral 340

skeleton at the disease lesion. Extensive in situ end labeling of fragmented DNA, 341

suggestive of programmed cell death or apoptosis, was associated not only with the 342

tissue layers of the white syndrome lesion but also the adjacent tissues not directly 343

associated with the disease lesion. This is consistent with previous observations of 344

white syndrome of tabular Acropora sp. on the Great Barrier Reef (4, 56, 57). 345

Observations of extensive programmed cell death associated with white syndrome and 346

a lack of resource translocation to the white syndrome lesion site suggested the disease 347

to be a reaction of the host, which is progressing independently of an apparent pathogen 348

(4, 57). We suggest that white syndrome of corals in Eilat may be typical of a similar 349

ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

16

host reaction, or white syndrome, and that the syndrome is a divergent process of 350

disease progression to that seen in necrotic and bacterial white diseases. We therefore 351

define white syndrome of coral as characterized by a disease state that progresses 352

independently of an apparent pathogen or microbial colonization, with little or no 353

evidence for mass tissue necrosis and with extensive programmed cell death associated 354

with the lesion. 355

356

In this study we differentiate white syndrome from white diseases based on specific 357

cytological/morphological and microbial differences. Previous studies of coral disease 358

have also suggested white syndrome as being a distinct coral disease apparently linked 359

to a lack of observable microbial population associated with the disease progression 360

(13, 21). Weil (65) has defined a syndrome as a disease that has yet to have a causative 361

agent identified. However we suggest adhering to a medical definition of a “syndrome” 362

as one fulfilling a collection of specific signs that occur together to characterize the 363

particular disease or abnormality. We suggest that microbial, cytological and 364

physiological characteristics are useful criteria for differentiating coral diseases (Figure 365

7) and for determining the specific signs suitable for accurate disease diagnosis. This 366

also allows for the addition of other criteria, as shown in Figure 7, that may further 367

differentiate these diseases. Furthermore we postulate that the mechanisms of tissue 368

loss and disease progression in white diseases and white syndrome are divergent and 369

indicate the importance of understanding the physiological mechanisms that are 370

associated with these diseases to truly identify the underlying cause of their increases 371

worldwide. 372

373

ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

17

Primary versus opportunistic pathogens 374

Opportunistic pathogens are defined as those which infect compromised or previously 375

stressed individuals, whereas primary pathogens are those that cause disease in an 376

uncompromised host (62). The involvement of opportunistic, rather than primary 377

pathogens has been overlooked in coral disease research and needs to be considered 378

when attempting to understand disease and determine disease causation, disease 379

progression and colony mortality. This is further evident when considering the rapidly 380

changing and highly impacted environment of coral reefs. Increased environmental 381

stress and pollution may de-stabilize the coral holobiont creating increased potential for 382

possible opportunistic pathogens to affect the stressed corals. The question of 383

differentiating microbial pathogens involved in disease initiation and those involved in 384

disease progression or sources of secondary infections is of great importance. Future 385

work addressing disease causation should consider the definitions of various pathogens: 386

a primary pathogen, being the first infection by a pathogen in an uncompromised host 387

(62) and a secondary pathogen being one causing a secondary or subsequent infection 388

by multiplying within already diseased tissue but is not the primary pathogen (2). 389

Finally an opportunistic pathogen being a pathogenic organism that is normally 390

commensal but which gives rise to infection in compromised hosts (62). The use of a 391

range of diagnostic techniques will allow us to better understand the processes of 392

disease and address questions of underling causes of disease progression in dense and 393

diverse microbial ecosystems. 394

395

ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

18

Conclusions 396

This study has demonstrated the importance of cytological and in situ microbiological 397

studies in the investigation of coral disease. Comparative analysis of disease states 398

indicates that the current use of macroscopic disease signs is insufficient for 399

characterizing and understanding coral disease. A particularly good example is that of 400

black band disease within this study. The extent and impact of black band disease on 401

reefs worldwide may be underestimated if the lack of macroscopic disease signs, as 402

observed for Favia in Eilat, is common. Black band disease etiology and epidemiology 403

requires further analysis especially to determine if there is the potential of other diseases 404

to progress into this disease during summer months. Our study demonstrates that research 405

depending solely on macroscopic signs of disease run the risk of misdiagnosing diseases 406

among corals. 407

408

We strongly suggest that studies incorporating cytological, microbiological and 409

physiological investigations provide critical insights into the inception, progression and 410

causal factors underpinning the current global increase in coral disease. Accurate 411

diagnosis of coral disease is vital in providing researchers and managers with a better 412

basis for understanding disease causation on reefs. We therefore conclude that future 413

studies of coral disease, whether they be field or laboratory based must examine 414

fundamental cellular characteristics and physiological processes underlying disease 415

progression. 416

417

ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

19

Acknolwedgements 418

The authors would like to thank the Eilat Coral Beach Nature Reserve and Dr David 419

Zakai for assistance and expertise in sampling and surveying corals of Eilat Reefs. The 420

authors are grateful for support provided by the GEF Coral Reef Targeted Research 421

Program (www.gefcoral.org) and the ARC Centre of Excellence for Coral Reef Studies 422

(www.coralcoe.org.au). The authors would like to thank the Centre for Advanced Light 423

Microscopy at the University of Queensland for assistance with confocal microscopy, and 424

also Professor Oded Yarden and Dr Bill Leggat for conceptual, logistical and editorial 425

assistance. 426

427

References 428

1. Adle-Biassette H, Bell JE, Creange A, Sazdovitch V, Authier FJ, Gray F, Hauw J-J, 429

and Gherardi R. DNA breaks detected by in situ end labelling in dorsal root ganglia of 430

patients with AIDS. Neuropathology and Applied Neurobiology (1998) 24:373-380. 431

2. Agrios G.N 1997. Plant Pathology 4th

Edition, Academic Press. 432

3. Ainsworth TD, Fine M, Blackall LL and Hoegh-Guldberg O (2006). Fluorescence in 433

situ hybridisation and spectral imaging of coral associated bacterial communities. Appl. 434

Environ. Micro. 72(4): 3016-3020 435

4. Ainsworth TD, Kvennefors EC, Blackall LL, Fine M. and Hoegh-Guldberg O. (In 436

Press). Disease and cell death in white syndrome of Acroporid corals on the Great Barrier 437

Reef. Mar Biol (In Press). 438

5. Al-Moghrabi, S. M., 2001: Unusual black band disease (BBD) outbreak in the 439

northern tip of the Gulf of Aqaba (Jordan). Coral Reefs, 19(4): 330–331. 440

6. Amann RI, Binder BJ, Olson RJ, Chisholm SW, Devereux R, and Stahl DA (1990). 441

ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

20

Combination of 16S rRNA-targeted oligonucleotide probes with flow cytometry for 442

analysing mixed microbial populations. Appl. Environ. Micro. 56:1919–1925 443

7. Amann RI, Ludwig W, and Schleifer KH (1995). Phylogenetic identification and in 444

situ detection of individual microbial cells without cultivation. Microbiol. Rev. 59:143-445

169 446

8. Amman R, Snaidr J, Wagner M, Ludwig W, and Scleifer KH (1996). In situ 447

visualisation of high genetic diversity in a natural microbial community. J. Bacteriol. 178: 448

3496 – 3500. 449

9. Amann R, Fuchs BM, and Behrens S (2001). The identification of micro-organisms by 450

fluorescence in situ hybridisation. Curr. Opin. Biotech. 12: 231- 236. 451

10. Antonius A (1973). New observations on coral destruction in reefs. Abs. Assoc. Isl. 452

Mar. Lab. Caribb.10:3. 453

11. Antonius A (1977). Coral mortality in reefs: a problem for science and management. 454

Proc 3rd

Int Coral Reef Symp. Miami 2: 617–623. 455

12. Antonius A (1981). The ‘band’ diseases in coral reefs. Proc 4th

Int Coral Reef Symp. 456

Philippines 2: 7–14. 457

13. Antonius A and Riegl B (1997). A possible link between coral diseases and a 458

corallivorous snail (Drupella cornus) outbreak in the Red Sea. Atoll. Res. Bull. 447: 1–9. 459

14. Antonius A and Riegl B (1998). Coral diseases and Drupella cornus invasion in the 460

Red Sea. Coral Reefs 17: 48. 461

15. Aronson RB and Precht WF (2001). White-band diseases and the changing face of 462

Caribbean coral reefs. Hydrobiol. 460:25–38. 463

ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

21

16. Banin E, Israely T, Fine M, Loya Y, and Rosenberg E (2001). Role of endosymbiotic 464

zooxanthellae and coral mucus in the adhesion of the coral-bleaching pathogen Vibrio 465

shiloi to its host. FEMS Micro. Lett. 199:33–37 466

17. Barash Y, Sulam R, Loya Y, and Rosenberg E (2005). Bacterial strain BA-3 and a 467

filterable factor cause a white plague-like disease in corals from the Eilat coral reef. 468

Aquat. Micro. Ecol. 40:183-189 469

18. Ben-Haim Y, and Rosenberg E (2002). A novel Vibrio sp pathogen of the coral 470

Pocillopora damicornis. Mar. Biol. 141:47–55 471

19. Breitbart M, Bhagooli R, Griffin S, Johnston I, and Rowher F (2005). Microbial 472

communities associated with skeletal tumors on Porites compressa. FEMS Micro. lett. 473

Online release. 474

20. Bythell JC, Barer MR, Cooney RP, Guest JR, O’Donnell AG, Pantos O, Le Tissier 475

MDA (2002). Histopathological methods for the investigation of microbial communities 476

associated with disease lesions in reef corals. Lett. Appl. Micro. 34: 359–364. 477

21. Bythell JC, Pantos O, and Richardson L, (2004). White plague, White Band and 478

other “White” Diseases. In Coral health and Disease. (ed. E. Rosenberg and Y. Loya) 479

Springer-Verlag, Germany. 480

22. Carlton R, and Richardson LL (1995). Oxygen and sulphide dynamics in a 481

horizontally migrating cyanobacterial mat: black band disease of corals. FEMS Micro. 482

Ecol. 18:155-162 483

23. Daims H, Brühl A, Amann R, Schleifer KH, and Wagner M (1999). The domain-484

specific probe EUB338 is insufficient for the detection of all Bacteria: development and 485

evaluation of a more comprehensive probe set. Syst. Appl. Microbiol. 22:434-444. 486

ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

22

24. Denner EBM, Smith G, Busse HJ, Schumann P, Narzt T, Polson SW, Lubitz W, and 487

Richardson LL (2003). Aurantimonas coralicida gen. nov., sp. nov., the causative agent 488

of white plague type II on Caribbean scleractinian corals. Int. J .Syst. Evol. Microbiol. 489

53:1115–1122. 490

25. Dunn SR, Bythell JC, Le Tissier MDA, Burnett WJ, and Thomason JC (2002). 491

Programmed cell death and cell necrosis activity during hyperthermic stress induced 492

bleaching of the symbiotic sea anemone Aiptasia sp. J. Exp. Mar. Biol. Ecol. 272: 29–53. 493

26. Dunn SR, Thomason JC, Le Tissier MDA, and Bythell JC (2004). Heat stress 494

induces different forms of cell death in sea anemones and their endosymbiotic algae 495

depending on temperature and duration. Cell death and Diff. (2004): 1-10. 496

27. Frias-lopez J, Zerkle AL, Bonheyo GT, and Fouke BW (2002). Partitioning of 497

bacterial communities between seawater and healthy, black band diseased, and dead coral 498

surface. Appl. Env. Micro. 68(5): 2214 – 2228. 499

28. Fine M, Oren U, and Loya Y (2002). Bleaching effect on regeneration and resource 500

translocation in the coral Oculina patagonica. MEPS 234:119 -125 501

29. Green EP, and Bruckner AW (2000). The significance of coral disease epizootiology 502

for coral reef conservation. Biol. Conserv. 96: 347–361. 503

30. Harvell CD, Kim K, Burkholder JM, Colwell RR, Epstein PR, Grimes EE, et al. 504

(1999) Emerging marine diseases-climate links and anthropogenic factors. Science 285: 1 505

505–1510. 506

31. Harvell CD, Mitchell CE, Ward JR, Altizer S, Dobson AP, Ostfeld RS, and Samuel 507

MD (2002). Climate Warming and disease risks for terrestrial and marine biota. Science 508

296: 2158 – 2162. 509

ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

23

32. Kim K, Harvell CD, Kim PD, Smith GW, and Merkel SM (2000a). Fungal disease 510

resistance of Caribbean sea fan corals (Gorgonia spp). Mar. Biol. 36: 259–267. 511

33. Kim K, Kim PD, Alker AP, and Harvell CD (2000b). Chemical resistance of 512

gorgonian corals against fungal infections. Mar. Biol. 137: 393–401. 513

34. Kushmaro A, Loya Y, Fine M, and Rosenberg E (1996). Bacterial infection and 514

coral bleaching. Nature 380: 396 515

35. Kushmaro A, Rosenberg E, Fine M, Ben-Haim Y, and Loya Y (1998). Effect of 516

temperature on bleaching of the coral Oculina patagonica by Vibrio shiloi AK-1. MEPS 517

171: 131–137. 518

36. Kushmaro A, Banin E, Loya Y, Stackebrandt E, and Rosenberg E (2001). Vibrio 519

shiloi sp nov the causative agent of bleaching of the coral Oculina patagonica. Int. J. 520

Syst. Evol. Micro. 51: 1383–1388. 521

37. Kuta KG, and Richardson LL (1996). Abundance and distribution of black band 522

disease of corals in the northern Florida Keys. Proc 8th

Int Coral Reef Symp. 15:219 – 523

223. 524

38. Lesser MP (2004). Experimental biology of coral reef ecosystems. J. Exp. Mar. Bio. 525

Ecol. 300: 217 – 252. 526

39. Loya Y, and Kramarsky-Winter E (2003). In situ eutrophication caused by fish farms 527

in the northern Gulf of Eilat (Aqaba) is beneficial for its reefs: a critique. MEPS 261:299 528

- 303 529

40. Loya Y. (2004). The Coral Reefs of Eilat – Past, Present and Future: Three Decades 530

of Coral Community Structure Studies. In Coral health and Disease. (ed. E. Rosenberg 531

and Y. Loya) Springer-Verlag, Germany. 532

ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

24

41. Manz W, Amann R, Ludwig W, Wagner M, and Schleifer KH (1992). Phylogenetic 533

oligonucleotide probes for the major subclasses of proteobacteria: problems and 534

solutions. Syst. Appl. Micro. 15: 593-600 535

42. Manz W, Arp G, Schumann-Kindel G, Szemzyke U, and Reitner J (2000). 536

Widefield deconvolution epifluorescence microscopy combined with fluorescence in situ 537

hybridisation reveals the spatial arrangement of bacteria in sponge tissue. J. Micro. Meth. 538

40:125-134. 539

43. Moreno Y, Arias CR, Meier H, Garay E, and Aznar R (1999). In situ analysis of the 540

bacterial communities associated to farmed eel by whole-cell hydridisation. Lett Appl 541

Micro 29:160-165. 542

44. Mullen KM, Peters EC, and Harvell CD (2004). Coral Resistance to disease. In Coral 543

health and Disease. (ed. E. Rosenberg and Y. Loya) Springer-Verlag, Germany. 544

45. Pantos O, and Bythell JC (2006). Bacterial community structure associated with 545

white band disease in the elkhorn coral Acropora palmata determined using culture-546

independent 16S rRNA techniques. Dis. Aquat. Org. 69:79 – 88 547

46. Patterson KL, Porter JW, Ritchie KB, Polson SW, Mueller E, Peters EC, Santavy 548

DL, Smith GW(2002). The eitiology of white pox a lethal disease of the Caribbean 549

Elkhorn coral Acropora palmata. Proc Natl Acad Sci USA 99:8725-8730. 550

47. Peters EC (1984). A survey of cellular reactions to environmental stress and disease 551

in Caribbean scleractinian corals. Helgol Meeresunters 37: 113–137. 552

48. Peters EC, Oprandy JJ, and Yevich PP (1983). Possible causal agent of “white band 553

disease” in Caribbean acroporids corals. J. Invert. Pathol. 41: 394-396. 554

ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

25

49. Porter JW, Dunstan P, Jaap WC, Patterson KL, Kosmynin Y, Meir OW, Patterson 555

ME, Parsons M (2001). Patterns of spread of coral disease in the Florida Keys. 556

Hydrobiologia 460: 1 – 24. 557

50. Richardson LL, Goldberg WM, Carlton RG, and Halas JC (1998a). Coral disease 558

outbreak in the Florida Keys: plague type II. Rev. Biol. Trop. 46:187–198. 559

51. Richardson LL, Goldberg WM, Kuta KG, Aronson RB, Smith GW, Ritchie KB, 560

Halas JC et al. (1998b). Florida’s mystery coral killer identified. Nature 392: 557–558. 561

52. Richardson LL, Smith GW, Ritchie KB, and Carlton RG (2001). Integrating 562

microbiological microsensor molecular and physiologic techniques in the study of coral 563

disease pathogenesis. Hydrobiol. 460: 71–89. 564

53. Richardson LL, and Kuta KG (2003). Ecological physiology of the black band 565

disease cyanobacterium Phormidium corallyticum. FEMS Micro. Ecol, 43: 287 – 298 566

54. Richardson LL (2004). Black Band Disease. In Coral health and Disease. (ed. E. 567

Rosenberg and Y. Loya) Springer-Verlag, Germany. 568

55. Ritchie KB, and Smith GW (1997). Physiological comparison of Bacterial 569

communities from various species of scleractinian corals. Proceeding from 8th

570

International Coral Reef Symp. 1: 521-526. 571

56. Roff J (2004). Tabular Acropora syndrome on the Great Barrier Reef. Honours 572

Thesis University of Queensland, Australia. 573

57. Roff G, Hoegh-Guldberg O, and Fine M (2006). Intra-colonial response to Acroporid 574

“white syndrome” lesions in tabular Acropora app. (Scleractinia). Coral Reefs: Online 575

First 576

ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

26

58. Roller C, Wagner M, Amann R, Ludwig W, and Schleifer KH (1994). In situ probing 577

of gram positive bacteria with hight G+C content using 23S rRNA-targeted 578

oligonucleotides. Micro. 140; 2849 – 2858. 579

59. Rosenberg E, and Ben-Haim Y (2002). Microbial diseases of corals and global 580

warming. Environ. Micro. 4(6): 318 – 326. 581

60. Rowher F, Breitbart M, Jara J, Azam F, and Knowlton N (2001). Diversity of 582

bacteria associated with the Caribbean coral Montastrea franksi. Coral Reefs 20: 85-95. 583

61. Rowher F, Seguritan V, Azam F, and Knowlton N (2002). Diversity and distribution 584

of coral-associated bacteria. MEPS. 243:1-10 585

62. Stanier RY, Doudoroff M, and Adelberg EA (1987). General Microbiology. 586

Macmillian, London (1971). 587

63. St John JA, Tisay KT, Caras IW, and Key B (2000). Expression of EphA5 during 588

development of the olfactory nerve pathway in rat. J. Comp. Neuor. 416:540-550. 589

64. Sutherland KP, Porter JW, and Torres C (2004). Disease and immunity in Caribbean 590

and Indo-pacific zooxanthellate corals. MEPS 266: 273 – 302. 591

65. Weil E., Smith G., and Gil-Agudelo DL (2006). Status and progress in coral reef 592

disease research. Dis. Aquat. Org. 69: 1-7 593

66. Wielgus J. (2003) The coral reef of Eilat (northern Red Sea) requires immediate 594

protection. MEPS 263:307. 595

67. Winkler R, Antonius A, and Renegar DA (2004). The skeleton Eroding Band 596

Disease on Coral Reefs of Aqaba, Red Sea. Mar. Ecol. 25(2): 129 –144. 597

598

599

600

ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

27

Figure legends 601

602

Figure 1. Typical (A,a) and atypical black band disease (B,b) of Eilat, The Red Sea. 603

Underwater photographs of infected black band diseased colonies displaying typical 604

(A1,a1) and atypical (B1,b1) signs of disease. Tissue necrosis and microbial penetration 605

and disruption of tissue layers in black band diseased colonies evident by histopathology, 606

using Haematoxylin and Eosin staining of typical (A2,a2) and atypical (B2,b2) diseased 607

colonies, and FISH of typical (A3,a3) and atypical (B3,b3) diseased colonies. Scale 608

50um. Polyp (Po), Epithelium (Ep), Gastroderm (Ga), necrosis (Ne), Bacteria (bac). FISH 609

and spectral codes: Coral tissue (blue), Symbiodinium sp. (green), bacteria (red). 610

Uppercase labels demonstrates lower magnification images, lowercase denotes higher 611

magnification. 612

613

614

615

616

617

618

619

620

621

622

623

624

ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

28

625

Figure 2. Diseased Hydnophora sp. (a) with evident rapid tissue loss and clear lesion 626

borders between tissue and recently exposed skeleton (b), histopathology showed extensive 627

tissue necrosis (Ne) of cell layers (c) including epithelium, gastroderm (d), FISH revealed 628

extensive microbial population using the EUB universal bacterial probe(e, f, g) associated 629

with tissue necrosis and adjacent tissues. Scale 50 µm. Epithelium (Ep), Gastroderm (Ga), 630

Symbiodinium sp. (Zx), tissue necrosis (Ne), Bacteria (Bac). FISH and spectral color 631

codes: coral tissue (Blue), Symbiodinium sp. (Green), Bacterial (Red). Uppercase label 632

demonstrates lower magnification images, lowercase denotes higher magnification. 633

634

635

636

637

638

639

640

641

642

643

644

645

646

647

648

ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

29

Figure 3. FISH identified bacterial communities associated with diseased Hydnophora sp. 649

identified with EUBmix (a), as belonging to δ-proteobacteria (b) and a filamentous 650

Cytophaga-Flavobacterium (c), populations of a Vibrio species were also identified (d). 651

Scale 50 µm. Epithelium (Ep), Gastroderm (Ga), Symbiodinium sp. (Zx), tissue necrosis 652

(Ne), Bacteria (Bac), δ-proteobacteria (GAM), Cytophaga-Flavobacterium (CF) and Vibrio 653

sp (VB). FISH and spectral color codes: coral tissue (Blue), Symbiodinium sp. (Green), 654

Bacterial (Red). Uppercase label demonstrates lower magnification images, lowercase 655

denotes higher magnification. 656

657

658

659

660

661

662

663

664

665

666

667

668

669

670

671

672

j ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

30

Figure 4. White disease of Stylophora pistillata displaying tissue loss and partial bleaching 673

in pattern starting at the branch base and progressing rapidly up the branches and through 674

the colony (A1, a1), with 50% mortality of the colony is evident (A). Haematoxylin and 675

eosin staining shows tissue structures remain intact at the lesion border (A2,a2) with some 676

regions of structural loss of the gastroderm adjacent to the lesions (aa2) and FISH using the 677

EUB general bacterial probe identified large populations of bacteria associated with tissues 678

adjacent to the lesion border (A3), a mixed bacterial population dominated by δ-679

proteobacterial taxa (a3). Scale 50um. Epithelium (Ep), Gastroderm (Ga), Symbiodinium 680

sp. (Zx), tissue necrosis (Ne). FISH and spectral color codes: coral tissue (Blue), 681

Symbiodinium sp. (Green), Bacterial (Red). Uppercase label demonstrates lower 682

magnification images, lowercase denotes higher magnification. 683

684

685

686

687

688

689

690

691

692

693

694

695

e

j ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

31

Figure 5. White syndrome of Acropora sp. (a), evidence of clear lesion boundary between 696

healthy tissue and recently exposed skeleton (b), investigation of tissue structure using 697

haematoxylin and Eosin appear (c,d), a lack of microbial communities associated with the 698

tissues other than dense bacterial aggregates within gastrodermal tissue layers (e,f). Scale 699

50 µm. (Ep), Gastroderm (Ga), Symbiodinium sp. (Zx), tissue necrosis (Ne), Bacteria 700

(Bac),). FISH and spectral color codes: coral tissue (Blue), Symbiodinium sp. (Green), 701

Bacteria (Red). Uppercase label demonstrates lower magnification images, lowercase 702

denotes higher magnification. 703

704

705

706

707

708

709

710

711

712

713

714

715

716

717

718

j ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

32

Figure 6. In situ end labelling of fragmented DNA evident of apoptotic cell death is not 719

detected in Black band disease (atypical) (a), typical (b,c), white diseases of massive’s 720

(d,e,f), positive staining was evident at the lesion border in the white disease of 721

Stylophora pistillata (g,h), but not of tissues away from border (i) and a high density of 722

apoptotic cells associated with white syndrome (k,l), but not away from lesion border 723

(m). Uppercase label demonstrates lower magnification images, lowercase denotes higher 724

magnification. 725

726

727

728

729

730

731

732

733

734

735

736

737

738

739

740

741

742

ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

33

Figure 7. Profiling the interaction of holobiont changes and multiple levels of diseaase 743

signs can be used as a basis for identifying specific criteria for disease diagnosis and to 744

improve understanding of divergent disease processes underlieng coral disease 745

progession. 746

747

748

749

750

751

752

753

754

755

756

757

758

759

760

761

762

763

764

765

766

ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

34

Tables 767

Table 1. Bacterial Probes used in FISH. 768

Probe Target group Sequence (5’ – 3’) formamide From

EUBmix Universal

bacterial probe

GCTGCCTCCCGTAGGAGT

GCAGCCACCCGTAGGTGT

GCTGCCACCCGTAGGTGT

35% 6

23

BET42A β-proteobacteria GCCTTCCCACTTAGTTT 35% 41

GAM42A γ-proteobacteria GCCTTCCCACATCGTTT 35% 41

CF319 Cytophaga-

Flavobacterium

TGGTCCGTGTCTCAGTAC 35% 42

MV Vibrio spp. ACAGTACTCTAGTCTCGCCAG 35% 40

769

770

771

772

773

774

775

776

777

778

779

780

781

ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

35

782

Table 2. Summary of microbial and disease characteristics of coral diseases in Eilat*. 783

Black band disease

typical / atypical

White disease

(massive)

White disease

(branching)

White syndrome

(branching)

Bacterial

infiltration of

tissue layers

+ ve / +ve + ve + ve - ve

Mass tissue

necrosis

+ ve / +ve + ve - ve

(small region)

- ve

Programmed

cell death

- ve / -ve - ve + ve

(only adjacent

lesion border)

+ ve

*Presence of the characteristic indicated by +ve, a lack of the characteristic indicated by –784

ve. 785

786

787

788

789

790

791

792

793

794

ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

ACCEPTED on June 15, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

http://aem.asm.org/

ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

ACCEPTED on June 15, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

http://aem.asm.org/

ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Example 3:

Black band disease

1. Black microbial

growth at lesion border

(typical or atypical)

2. Black microbial

penetration of tissue

layers

3. Mass tissue necrosis

Example 2:

White disease 1. Clear lesion boundary

2. Exposed skeleton

3. Extensive microbial

involvement

4. No evidence for black

band consortium

5. Mass tissue necrosis

5.

Example 1:

White syndrome

1. Clear lesion boundary

2. Exposed skeleton

3. Lack of microbial

involvement in disease

progression

5. Evidence for extensive

apoptosis

Physiological changes

Scale

Microbial isolation and in situ detection/identification

• Presence /absence of microbial interaction & and extent of

microbial colonization?

Cytological disease indications?

• Mass necrosis / loss of structure or programmed cell death?

• Changes in respiration /photosynthesis / translocation?

• Microbial communities & community shifts

• Ability to determine pathogenic capacity?

Reefal observations & macroscopic indications of disease

• Ecological and colonial patterns?

• Tissue loss / exposed skeleton or bleaching /symbiont loss?

ACCEPTED


.asm.org/

Dow

nloaded from

http://aem.asm.org/

coral disease diagnostics whataem.asm.org/content/early/2006/12/08/aem.02172-06.full.pdf3 48...

Documents