coordinate regulation of secretory stress proteins (psp/reg, pap i, pap ii, and pap iii) in the rat...

Coordinate Regulation of Secretory Stress Proteins(PSP/reg, PAP I, PAP II, and PAP III) in the Rat ExocrinePancreas during Experimental Acute Pancreatitis

R. Graf, Ph.D.,*,1 M. Schiesser, M.D.,* A. Lussi, Dipl.nat.,* Ph. Went, M.D.,†G. A. Scheele, M.D.,‡ and D. Bimmler, M.D.*

*Pancreatitis Research Laboratory, Department of Visceral and Transplant Surgery, and †Department of Pathology,University Hospital, 8091 Zurich, Switzerland; and ‡Institute of Genomic Medicine, La Jolla, California 92037

Journal of Surgical Research 105, 136–144 (2002)doi:10.1006/jsre.2002.6387

Submitted for publication October

Background. Pancreatic stone protein (PSP/reg) is aconstitutively secreted protein in pancreatic juice.Pancreatitis-associated protein (PAP) belongs to thesame family of proteins. PAP is highly increased dur-ing acute pancreatitis, while no exact data exist re-garding PSP/reg protein synthesis and secretion. Re-cently, an attempt to determine PSP/reg and PAPlevels in sera of rats with acute pancreatitis showed asignificant increase in PAP but failed to demonstratechanges in PSP/reg. Others reported that surgical ma-nipulation of the pancreas, including sham controls,affected mRNA levels of PSP/reg. Neither report deter-mined protein levels of PSP/reg.

Methods. Rats were treated intraperitoneally with asupramaximal dose of caerulein to induce pancreati-tis, a physiological dose of caerulein, or a saline injec-tion. Pancreata were analyzed for PAP and PSP/regusing ELISAs. RNA was extracted for Northern blotanalysis of PAP I, II, and III and PSP/reg mRNA.

Results. Experimental induction of acute pancreati-tis caused a coordinate increase in both PSP/reg andPAP. PAP showed an acute response and returned tolow levels within 48 h while PSP/reg exhibited a moresustained response. Intraperitoneal application of aphysiological dose of caerulein and even a saline in-jection caused an increase in PSP/reg.

Conclusion. PSP/reg and PAP levels are increasedthrough similar mechanisms by physiological and su-pramaximal doses of caerulein. However, PSP/reg reg-ulation appears to sustain high levels while PAP levelsare more transient. Since the regulation of this protein

1 To whom correspondence and reprint requests should be ad-

1360022-4804/02 $35.00© 2002 Elsevier Science (USA)All rights reserved.

001; published online July 8, 2002

family is affected even under mild stress, we define themas secretory stress proteins. © 2002 Elsevier Science (USA)

Key Words: pancreatic stone protein; rat pancreas;caerulein pancreatitis; pancreatitis-associated pro-tein; stress proteins.

INTRODUCTION

Recently, a group of 16-kDa proteins, including pan-creatic stone protein (PSP/reg) and isoforms ofpancreatitis-associated protein (PAP), have beenshown to constitute a family of pancreatic secretoryproteins with ample structural similarities [1, 2]. Ontrypsin or trypsin-like activation, these proteins poly-merize into highly organized fibrillar structures thatspan large topological surfaces. In the rat this family ofproteins, which includes PSP/reg and PAP isoforms I,II, and III, shows conserved structural homologies, in-cluding a sensitive trypsin cleavage site at the N ter-minus and three disulfide bridges.

Increased levels of PAP have been observed in pan-creatic juice during induction of experimental acutepancreatitis [3, 4] and PAP has been proposed as apotential marker representing the severity of ongoingacute pancreatitis [5, 6]. Pancreatic stone protein(PSP/reg), on the other hand, has been associatedmainly with chronic pancreatitis. Increased tissue lev-els of PSP/reg messenger RNA and increased serumconcentrations of PSP/reg were observed in patientswith acute pancreatitis. Additionally, PSP/reg is asso-ciated with regenerating islets during diabetes melli-tus [7, 8]. However, PSP/reg and PAP isoforms have

dressed at Pankreatitis Forschungslabor DL36, Dept. fur Viszeral-und Transplantations-Chirurgie, Universitatsspital Zurich, CH-8091Zurich, Switzerland. Fax: 411 255 43 93. E-mail: [email protected].

not been extensively studied in pancreatic tissue andjuice under conditions of either acute or chronic pan-creatitis.

5, 2

Over the past decade we have cloned, expressed, andpurified recombinant forms of PSP/reg, PAP I, PAP II,and PAP III in the rat [1, 2, 9, 10]. In this study weused newly developed ELISA and histochemical assaysto study, for the first time, the coordinate expression ofPSP/reg and PAP I, II, and III isoforms under condi-tions of physiology (saline and optimal caerulein stim-ulation) and stress (supramaximal caerulein stimula-tion). Supramaximal caerulein stimulation includedthe opportunity to study the expression of individualsecretory stress protein isoforms under conditions ofexperimental acute pancreatitis.

MATERIAL AND METHODS

Model of Experimental Acute Pancreatitis

A supramaximal dose of the CCK analogue caerulein applied in-traperitoneally or intravenously leads to a mild form of edematouspancreatitis with a low mortality [11]. To investigate PSP/reg andPAP expression in caerulein-induced pancreatitis, rats were injectedtwice intraperitoneally with either saline or 2 or 40 �g/kg body wtcaerulein dissolved in saline (Bachem, Switzerland) [12] with a 1-hinterval between injections. The animals were slightly doused withCO2 prior to injections; after being returned to the cage they imme-diately started to be active again. The pancreata of four animals eachwere excised after 24, 48, and 72 h. Four control rats were sacrificedat Time 0 (before injection). Two animals each that received thehighest dose of caerulein only were kept for either 7 and 35 days.Pancreatic tissue was procured for homogenization and protein anal-ysis, for RNA isolation, and for immunohistochemistry. All 44 rats(16-week-old Wistar rats, mean weight 360 g), purchased from BRLFullinsdorf (Switzerland), were specific pathogen free. They werehoused in groups of maximally four in “type IV standard cages” andkept in our animal facility (free access to standard rat chow andwater; specific pathogen-free conditions; 20°C; day/night cycle simu-lated by artificial lighting of 50 l from 7 AM to 7 PM, dimmed in theremaining hours to almost complete darkness; air humidity: 50–60%).

Prior to surgery or sacrifice, the rats were fasted overnight (16–18h) with free access to water. All manipulations conformed withfederal guidelines on animal experiments and were approved by thelocal ethics committee.

Protein Analysis

Preparation of samples. Tissue homogenates were prepared fromfrozen pancreas as described previously [13]. A commercially avail-able protein detection kit (Pierce Protein Assay) was used to deter-mine protein levels in pancreatic juice and tissue homogenates.

Amylase activity. Amylase activity was determined in an assayusing a colorigenic, p-nitrophenyl-based substrate (Amylase 250,purchased from Sigma Diagnostics, No. 577-250), dissolved in waterat 34 mg/ml. Porcine amylase (Worthington), diluted in 1% BSA inH2O, was used for standards (0.125–1.5 �g/ml).

Aliquots of tissue homogenates were diluted 1:200 and 1:1000 in1% BSA in H2O, and duplicates transferred to microtiter plates(Falcon). Prewarmed substrate (37°C) was added, and microtiterplates were incubated at 37°C for 20 min. Optical density was mea-sured at 405 nm (MRX reader, Dynatech).

PSP/reg ELISA, PAP ELISA. PSP/reg levels in pancreatic juiceor in tissue homogenates were measured by means of a “sandwich”ELISA, which has been established in our laboratory on the basis ofa guinea pig antiserum raised against recombinant rat PSP/reg andthe IgG fraction of a rabbit antiserum against recombinant rat PTP.

Recombinant rat PSP/reg (0.025–5 ng/ml) was used as standard. Thedevelopment of this ELISA and the standardized application protocolhave been described in detail previously [13].

PAP levels were determined with three different sandwichELISAs. Antibodies were generated in rabbits and guinea pigsagainst recombinant PAP I, II or III [1]. Briefly, PAP I–III levelswere determined on 96-well microtiter plates (EIA plates, flat bot-tom, NUNC, Maxi Sorp.) coated overnight with the IgG fraction ofguinea pig anti-rat PAP antiserum, diluted 1:250 in Tris-bufferedsaline (TBS: 20 mM Tris, pH 7.5, 0.9% NaCl). After being washedwith 0.05% Tween 20 in TBS, the plate was blocked with 1% BSA/TBS (this and all following incubations were 1 h each). The respec-tive PAP standards (0.1, 0.5, 1, 1.5, 2.5, 3.5, and 5 ng/ml in 1%BSA/TBS) and tissue homogenates were loaded in duplicate. Afteranother washing step, a 1:250 dilution of the IgG fraction of rabbitanti-rat PAP antiserum was added. The plate was washed and thenincubated with an alkaline phosphatase-conjugated monoclonalmouse anti-rabbit IgG antibody (Sigma) diluted 1:6000 in 1% BSA/TBS. The plate was washed again, and a soluble phosphatase sub-strate (Sigma 104 tablets: disodium p-nitrophenyl phosphate) wasadded in alkaline phosphatase buffer as the final step. After 50 minoptical density (OD) at 405 nm was measured in an MRX ELISAreader (Dynatech Laboratories). The dilutions necessary to getwithin the range (0.2–3.5 ng/ml) were established prior to the finaldeterminations.

The three PAP ELISAs have sensitivities of 0.15 ng/ml for PAP I,0.033 ng/ml for PAP II, and 0.005 ng/ml for PAP III (3 times thestandard deviation of the blank). For practical reasons, in all threeassays, measurement results from 0.2 to 3.5 ng/ml were accepted(Fig. 1A); intra- and interassay variations were less than 7 and 12%,respectively.

To determine whether the amount of PAP in a sample was accu-rately estimated, we performed two different tests: (1) a recovery testto see whether the protein was accessible to the antibodies, and (2) adilution test to show that the amount measured was proportional tothe dilution. First, the recovery of a known amount of protein addedto a sample was tested by adding three different concentrations totwo different samples for each PAP assay. The recovery was esti-mated as the percentage of PAP found after subtraction of the en-dogenous level of PAP. Recovery of recombinant protein added topancreatic juice and tissue homogenates was 91 and 89%, respec-tively, for PAP I, 122 and 132% for PAP II, and 100 and 94% for PAPIII. In a second test, serial dilutions of pancreatic juice and tissuehomogenates with high or low starting concentrations were per-formed for all three assays. If the protein in a sample is not blockedor bound, the dilution curve of the sample should be parallel to thestandard curve. In Fig. 1B we show the optical density readings fortwo samples with different starting concentrations plotted againsttheir dilution factors (logarithmic scale). On the same graph, thestandard curve from the same assay plate was plotted against theoptical density reading. The three lines were parallel, indicating thatthe amount detected was proportional to the dilution (Fig. 1B; PAPI, representative of all three assays).

In a third test, we estimated the amount of cross-reactivity of eachtest for the other two PAP isoforms by adding large amounts (200and 50 ng/ml) of recombinant PAP to the test. The PAP I ELISArecognized PAP II at less than 0.09% and PAP III at 0.8%. The PAPII ELISA exhibited an even higher specificity: 200 ng/ml PAP I or IIIyielded a return of less than 0.1 ng/ml, which was below the accep-tance limit for the assay, and the cross-reactivity was calculated tobe less than 0.017% for PAP I and 0.034% for PAP III. Finally, thePAP III ELISA showed no detectable PAP I cross-reactivity and PAPII was recognized below 0.01%.

Immunohistochemistry

Pancreatic tissue specimens were fixed in buffered 4% formalin (36h) and embedded in paraffin. The sections (thickness 4–5 �m) were

137GRAF ET AL.: PANCREATIC SECRETORY STRESS PROTEINS

deparaffinized in xylene and rehydrated through a graded ethanolseries. To unmask antigens, sections were immersed in 0.01 M tri-Nacitrate, pH 6.4, and brought to boiling temperature in a microwaveoven (30 min). After reaching room temperature again, the slideswere rinsed in buffer, and endogenous peroxidase activity wasblocked by incubation in methanol containing 0.3% H2O2.

The Vectastain ABC kit (Vector Laboratories, Burlingame, CA)was used for immunostaining, and the supplier’s recommendationswere observed.

Nonspecific binding sites were blocked with “normal goat serum”(provided with the kit), diluted 1:20 in 4% fat-free dry milk (O/N,4°C). The blocking serum was replaced by one of four differentprimary antibodies, all diluted 1:800 in 2% fat-free dry milk (2-hincubation at room temperature): (1) rabbit anti-rat PSP/reg, (2)rabbit anti-rat PAP I, (3) guinea pig anti-rat PAP II, (4) preimmuneserum from the rabbit that was used to raise anti-rat PSP/reg serum.A buffer solution (0.17 M NaCl, 0.005 M Tris, pH 7.5) was used for alldilutions and for washing steps.

Incubations with the biotinylated secondary antibodies and theABC reagent were performed as recommended. Staining with 0.06%(w/v) DAB (3,3-diaminobenzidine tetrahydrochloride dihydrate), con-taining 0.06% H2O2, was stopped after 7 min (all sections processedin parallel). The sections were counterstained with hematoxylin,dehydrated through a graded ethanol series, cleared by xylene, andembedded in Histomount.

RNA Isolation and Analysis

Samples of frozen rat pancreas (about 50 mg per animal) wereimmersed in liquid nitrogen and ground to a fine powder in a mortar.The frozen powder was transferred to a plastic tube into which thetip of a Polytron homogenizer was inserted. As soon as the liquidnitrogen had evaporated, extraction buffer (Qiagen RNeasy Midi Kit)was added and the mixture was homogenized on ice for 90 s. Extrac-tion was completed according to the manufacturer’s recommenda-tions.

Polymerase chain reaction (PCR) and hybridization. Amplifica-tion of cDNAs for PAP I, II, and III [1] or PSP/reg [9] was performedby adding 10 ng recombinant vector DNA (pBlueScript with therespective cDNA insert) as template to a PCR. The resulting cDNAswere electrophoretically separated on 2% agarose gels. The PCRproducts were cut out from the gel and extracted with self-made spincolumns [14]. The concentrations of the purified DNAs were deter-mined by analytical 1.5% agarose gel using standard DNA of known

concentrations. Oligonucleotides were designed according to the orig-inal published sequences of PAP I [15], PAP II [16], and PAP III [17].

PAP I sp 5� GAAGACTCTCCGAAGAAAATA 3� (PCR sense)PAP I ap1 5� CCTAAAGCTGTTTGCTGTCTG 3� (PCR antisense,

hybridizationprobe)

PAP I ap2 5� GTATTTTCTTCGGAGAGTCTTC 3� (hybridizationprobe)

PAP II sp 5� GAAGACTCCCAGAAGGCAGTGC 3� (PCR sense)PAP II ap1 5� CACTCAGGATGCTGCGGGTCT 3� (PCR antisense,

hybridizationprobe)

PAP II ap2 5� GCACTGCCTTCTGGGAGTCTTC 3� (hybridizationprobe)

PAP III sp 5� GAAGATGCCAAGGAAGATGTGC 3� (PCR sense)PAP III ap1 5� CGTGAGGTATATATCAACACA 3� (PCR antisense,

hybridizationprobe)

PAP III ap2 5� GCACATCTTCCTTGGCATCTTC 3� (hybridizationprobe)

Slot-blot and Northern blot. The PCR-amplified cDNAs of PAP I,II, and III and PSP/reg (1, 0.2, 0.04, and 0.008 ng) were diluted in 200�l denaturing solution (0.4 M NaOH, 10 mM EDTA), heated to 94°C,for 2 min, and chilled on ice. The samples were blotted on a mem-brane (Genescreen, NEN–DuPont) as previously described [13].

Total RNA, extracted from pancreata of four rats, was pooled foreach time point. For Northern blot preparation, 10 �g of total RNAwas separated by agarose gel electrophoresis and transblotted to amembrane (Genescreen) [13].

The slot-blot analysis with cDNA probes of PAP I, II, and IIIrevealed considerable cross-reactivity. To distinguish transcripts ofthe three genes, we radiolabeled oligonucleotides that exhibited ahigh degree of specificity for the respective isoforms.

Radioactive probes and hybridization. Radioactive cDNA probes(PAP II and PSP/reg) were generated in Ready-to-Go tubes (Amer-sham Pharmacia) using [32P]dCTP. Hybridization and washing con-ditions were described earlier [13]. To specifically distinguish ratPAP I, II, and III transcripts, radioactive probes were generated byT4 polynucleotide kinase end labeling of a mixture of two antisenseoligonucleotides (ap1 and ap2, see above). The hybridization and

FIG. 1. Standard curve and dilution series of pancreatic tissue samples. (A) Using recombinant PAP I, II, and III, standard curves wereestablished in the range 0.1–5 ng/ml: PAP I (■ ), PAP II (}), PAP III (F). The box at the bottom indicates the range accepted for determinationof sample concentrations (0.2–3.5 ng/ml). (B) Dilution of samples with a high ({) and a low (�) concentration of PAP I. Tissue samples wereserially diluted and compared with the OD readings of a standard curve for PAP I (F). The second x axis gives the dilution of the sample(5000� to 80,000�) on the same scale as the standard indicated on the x axis.

138 JOURNAL OF SURGICAL RESEARCH: VOL. 105, NO. 2, JUNE 15, 2002

washing procedures for cDNA and oligonucleotide probes were de-scribed previously [13]. The blots were exposed to X-ray films (Amer-sham Pharmacia Biotech) for various amounts of time (see Fig. 2).

Following exposure, the blots were stripped to remove the specificprobes and hybridized with a radioactively labeled 18S DNA frag-ment [13] to demonstrate the amount of total RNA loaded.

Statistical Analysis

Data are expressed as means � SEM. To test the significance ofdifferences in the caerulein pancreatitis experiments, the data weretransformed logarithmically, and a two-way analysis of variance(ANOVA) together with an a priori Fisher protected least significantdifference test was applied (public domain software: R (Version 1.1,http://www.r-project.org)) [18]. Differences were considered signifi-cant when the P value was �0.05.

RESULTS

Coordinate Increases in PSP/reg and PAP Expressionduring Caerulein-Induced Pancreatitis

Sustained PSP/reg response. PSP/reg is constitu-tively synthesized and secreted into pancreatic juice.To determine whether the induction of pancreatitiswould influence the rate of synthesis of PSP/reg, threedifferent types of intraperitoneal injections were made:a supramaximal dose (two injections of caerulein at 40�g/kg each), a physiological dose (2 �g/kg, twice), and acontrol (saline, twice) injection. Pancreata were ana-lyzed 1, 2, or 3 days after the injections, with fouranimals being kept for a longer period. Administrationof a supramaximal dose of caerulein resulted in abouta 100-fold increase in PSP/reg content of pancreatictissue, with a peak (roughly 20 �g/mg protein) 48 hafter the intraperitoneal injection (Fig. 2A). Although 7days postinjection PSP/reg levels were still elevated,they returned to normal (about 0.2 �g/mg) 35 daysafter injection, i.e., at a level corresponding to thatmeasured in age-matched control animals that had notreceived intraperitoneal injections. Injection of vehiclealone (physiologic saline) caused a distinct increase inPSP/reg, the highest 48 h after injection as well (Fig.2A). When animals were stimulated by intraperitonealapplication of a submaximal dose of caerulein, PSP/regexpression rose to a small peak within 24 h. However,after 48 or 72 h no relevant difference was seen be-tween submaximal caerulein and vehicle injections(Fig. 2A, inset, note logarithmic scale).

Acute response of PAP. In the same pancreata, lev-els of the three PAP isoforms were determined. A su-pramaximal caerulein injection caused an at least5000-fold increase in PAP I within 24 h (Fig. 2B, peakabout 28 �g/mg protein) and a more than 500-foldincrease in PAP II (Fig. 2C, peak about 1.8 �g/mg)within 24 h, followed by a decrease to almost normallevels at 7 days and to normal, barely detectable levels35 days after injection (0.1 ng/mg). A stimulatory effectof a submaximal caerulein dose was discernible 24 hafter the injection, followed by a decline toward basal

levels. Saline injection resulted in a low and delayedresponse which was highest after 48 h (see insets inFigs. 2B and 2C, note logarithmic scale). Thus, thekinetics of PAP synthesis were somewhat acceleratedcompared with the sustained response of PSP/reg. PAP

FIG. 2. Effect of caerulein-induced pancreatitis on PSP/reg andPAP levels analyzed by ELISA in rat pancreas. (A) PSP/reg levelswere determined in pancreatic tissue homogenates of rats after asupramaximal (F), a maximal (}), or a control saline (■ ) intraperi-toneal injection of caerulein. The same samples were assayed for (B)PAP I, (C) PAP II, and (D) PAP III; symbols as for PSP/reg. Meanvalues are given as �g/mg protein � SEM (A–C) or ng/mg (D); n � 4per time point, except n � 2 at 7 and 35 days. Significant differences(P � 0.05) between supramaximal doses versus no-caerulein controlof the same day were found on Days 1 and 2 (Fisher protected LSD).Insets in A–C: To demonstrate absolute levels of the secretory stressproteins under saline and maximal stimulation, the diagrams weretransposed to a logarithmic scale.


III, the least abundant PAP isoform, was not detect-able before induction of acute pancreatitis and reacheda maximal level of approximately 90 ng/mg in tissueextracts (Fig. 2D). A small increase was observed whena “maximal” dose of caerulein was injected.

No significant differences in amylase content of thetissue were observed in caerulein-stimulated andsaline-injected control rats during the experimentalperiod (not shown).

Expression of PSP/reg and PAP I, II, and III IsRegulated by Increased mRNA Levels duringCaerulein-Induced Pancreatitis

Establishment of a detection system that distin-guishes the three PAP isoforms using cDNA probesyielded considerable cross-hybridization (not shown).To circumvent the potential lack of specificity we usedoligonucleotides that recognized and specifically ampli-fied the three PAP cDNAs. For generation of radioac-tively labeled oligonucleotides, only the antisense oli-gonucleotides were selected and labeled. PAP I, II, andIII cDNAs were used in a slot-blot to evaluate specific-ity. PAP I and II probes recognized their respectivetranscripts with a 100-fold higher signal than the otherisoforms. The PAP III probe recognized PAP III cDNAwith a 50-fold higher signal than the heterologouscDNAs spotted onto the membrane. No cross-activity ofthe three PAP probes was found with respect to PSP/reg cDNA (Fig. 3A).

Analysis of individual transcripts demonstratedpeak levels on Day 1 after supramaximal caeruleinstimulation for PAP I and II mRNA, while PAP IIIdisplayed an almost undetectable peak at this timepoint (Fig. 3B). A small increase was also observed onDay 1 when a physiological dose of caerulein was ap-plied, whereas application of saline led to a small in-crease in PAP I and II mRNA on Day 2 only.

In contrast to PAP mRNA, PSP/reg mRNA was de-tectable in the untreated control animals, supportingthe constitutive nature of PSP/reg expression (Fig. 3B).Induction of an acute pancreatitis resulted in an in-crease in PSP/reg mRNA that persisted from Days 1 to3 and was still significantly raised at Day 7 beforereturning to low levels at Day 35. A weaker stimula-tory effect induced by the physiological caerulein dosewas observed which declined after Day 1. Again thesaline injection resulted in increased PSP/reg mRNAlevels as well.

Tissue Distribution of PSP/reg and PAP Isoforms Iand II during Caerulein-Induced Pancreatitis

Conventional histological assessment of the pancre-ata of control rats (Fig. 4A) and of rats given a maximaldose of caerulein (2 �g/kg body wt twice, Fig. 4B) didnot reveal changes in the normal cellular appearance.

After injection of a supramaximal dose of caerulein,dilation of acinar lumina and vacuolization were ob-served. These changes seemed to be more pronouncedearly after injection (Fig. 4C, arrowheads). Acinarchanges consisted of pseudotubular transformationand of apoptotic bodies. The latter were seen almostexclusively in animals that had received a supramaxi-mal dose of caerulein, irrespective of the time point.Increased inflammatory infiltrates were observed inanimals treated with a supramaximal dose of caerulein(Fig. 4D), particularly neutrophilic granulocytes andlymphocytes localized in and around ducts. These in-filtrates were more pronounced in the early stagesafter injection. Only one animal in the control groupshowed scant lymphocytic infiltrates, analyzed by con-ventional means (i.e., without immunohistochemistry).Only one animal that received a physiological caeruleininjection exhibited granulocytic infiltrates, and in fiveanimals lymphocytic infiltrates could be seen, butthese infiltrates were scarce and less dense (analyzedsemiquantitatively) than in the supramaximal caer-ulein group.

We have observed increased PSP/reg and PAP levelsin tissue homogenates during caerulein pancreatitis.However, cell-specific information is lost by homogeni-zation. Therefore, we analyzed the pancreatic tissue byimmunohistochemistry for PSP/reg and PAP I, II, andIII. First, the control tissue (no manipulation) wasinspected. PSP/reg exhibited a patchy distribution inwhich most cells were weakly positive while some cellsor groups of cells strongly expressed this protein (Fig.5, Day 0 PSP/reg, arrowhead). Neither of the PAPisoforms showed any visible staining in the controltissue. After induction with a supramaximal dose ofcaerulein PSP/reg was strongly expressed in all acinarcells, but neither islets nor duct epithelia were PSP/regpositive. PAP I and II were also strongly and specifi-cally expressed in the acinar tissue while PAP III wasnot detectable (not shown). At the later stages of pan-creatitis, inflammation and lobular fibrosis were ob-served, during which PSP/reg was still strongly ex-pressed. In serial sections, both PAP I and II were onlyweakly positive or not present anymore (Fig. 5, Day 3).The kinetics of expression were similar to the levelsdetermined by ELISA: the strongest reaction was ob-served after 48 h for PSP/reg while PAP I and II ap-peared at the highest intensities after 24 h.

DISCUSSION

In this study we have shown that PSP/reg and PAPisoforms I, II, and III are coordinately expressed dur-ing caerulein-induced pancreatitis. PSP/reg, PAP II,and PAP I were increased 100-, 500-, and 1000-fold,respectively. In absolute concentration, tissue levels ofPAP I, and PSP/reg reached 30 and 20 �g/mg, respec-tively, while PAP II reached levels that were 10-fold


less concentrated (1.8 �g/mg) and PAP III increases,although measurable, reached 90 ng/mg only. In con-trast, amylase levels in tissue did not increase underthese conditions.

The coordinated response in expression of these se-cretory (stress) proteins followed a rapid, phasic se-

quence of events. PAP isoforms I, II, and III all peakedat 24 h, the first time point measured. PAP levelsrapidly decreased over the ensuing 2 days and approx-imated normal by Day 3. Tissue levels of PSP/reg in-creased more slowly and peaked at 48 h. AlthoughPSP/reg levels declined by 72 h, they remained some-

FIG. 3. Analysis of mRNA transcripts for PSP/reg and PAP isoforms I, II, and III in pancreatic tissue during caerulein-inducedpancreatitis. (A) Specificity of PAP I, II, and III oligonucleotide probes. Decreasing amounts of cDNAs (PAP I–III, PSP/reg) were spotted ontomembranes. Radioactively labeled oligonucleotides specific for PAP I, II, or III were hybridized and X-ray film was exposed to the membranes.The probes for PAP I and II recognized their respective cDNAs at least 100 times better than the heterologous cDNAs. The PAP III proberecognized PAP III cDNA more than 50-fold better. No cross-reaction was detectable between any of the PAP probes and PSP/reg cDNA. (B)Messenger RNA levels in pancreatic tissue. Caerulein was injected twice on Day 0 at a physiological dose (2 � 2 �g/kg body wt) and asupramaximal dose (2 � 40 �g/kg). As a control, saline was injected (0). Animals were sacrificed after 1, 2, or 3 days. Some animals thatreceived the highest dose were analyzed after 7 and 35 days, respectively. Northern blots were generated by transferring total RNA. The blotswere probed with a cDNA coding for rat PSP/reg or with oligonucleotides specific for either PAP I, II, or III. At the bottom, a probe codingfor 18S RNA demonstrates that equal amounts of total RNA were loaded. On the right side, exposure times for the films are given. Days afterinjection are indicated at the top, above the line; the dose injected is given below the line.


what increased at 7 days. We conclude that the rise inPSP/reg is more sustained than that for PAP.

The rise in tissue levels of PSP/reg and PAP isoformswas parallel to changes in mRNA concentrations, sug-gesting that protein expression occurs as a function oftranscriptional changes. At the level of mRNA concen-tration the response of PSP/reg also appeared to bemore sustained than that observed for the three PAPisoforms, a finding that agrees with the protein levelsof secretory stress proteins in tissue.

Maximal stimulation with caerulein caused a tran-sient rise in PSP/reg and PAP I, II, and III isoformswhich peaked at 24 h and reached levels that were10–15% (PAP) or 25% (PSP/reg) those observed withsupramaximal doses of caerulein.

A not entirely unexpected finding was that intraperi-toneal injections of physiological saline caused signifi-cant elevations in PSP/reg, similarly to, although some-what later than, those observed for maximal doses ofcaerulein. This observation corroborates earlier re-ports on pancreatic PSP/reg expression after surgicalinterventions of varying severity, including a rise inPSP/reg after laparotomy and even after intraperito-neal injection of anesthetics [19]. In other studies itwas noted that PAP levels were increased followinginsertion of a cannula into the pancreatic duct or venacava [20]. Based on these observations, we concludethat stress reactions associated with surgical interven-tion and puncture wounds lead to increased expressionof PSP/reg and PAP.

Histochemical analysis of PSP/reg and PAP isoformsI and II in pancreatic tissue generally corresponded tothe results obtained with ELISA assays. However, un-expected findings occurred in two areas. First, PSP/regand PAP I and II isoforms were observed only in pan-creatic acinar cells. Ductal cells and endocrine tissue(islets of Langerhans) were devoid of staining, suggest-ing that PSP/reg and PAP isoforms are synthesizedexclusively in acinar tissue and secreted into the lumi-nal space of ductal structures. A similar cell-specificdistribution has been reported for PAP [20].

Second, the tissue distribution of these secretorystress proteins within acinar tissue was highly vari-able depending on basal, stimulatory, and poststimu-latory conditions. Under basal conditions, PSP/regshowed considerable variation in staining among cellswithin an individual acinus and between acinargroups. Following the stress associated with supra-maximal caerulein stimulation PSP/reg staining in-creased in all cells with a peak of expression at Day 2,coinciding with tissue levels determined by ELISA.PSP/reg staining at this point was uniform. Duringlater phases of acute pancreatitis when PSP/reg levelsdeclined, variable staining was again observed. Duringresolution of pancreatitis, highly inflamed areas, con-taining preapoptotic cells with increased nuclear size,lost the ability to express PSP/reg, again leading to aninhomogeneous appearance.

In contrast, staining for PAP I and II was absentprior to administration of supramaximal caerulein

FIG. 4. Histopathology of caerulein pancreatitis. (A) Low-power view of an HE-stained pancreas section of a control animal. (B)Pancreatic section of an animal that received a maximal dose of caerulein (2 � 2 �g/kg) 1 day previously. Normal appearance of cellulararchitecture. (C) One day after a supramaximal dose (2 � 40 �g/kg), there was edema, vacuolization, and pseudotubular acinar transfor-mation (arrowheads). (D) Three days after a supramaximal dose of caerulein. Arrowhead points to inflamed area. Original magnification,�150.


stimulation. Following secretagogue stress at supra-maximal levels near-homogeneous staining for PAP Iand II was observed at 24 h. During the resolutionphase variable staining became prominent, with strongpatterns in acinar tissue adjacent to ducts and islets.Three days after the stress reaction, PSP/reg was ob-served within inflamed areas of the pancreas and PAPstaining was generally absent. The functional signifi-cance of the differential expression of the various PAPisoforms is unknown. In the pancreas where PAP I andII are most abundant, PAP III levels are very low. Inthe small intestine, however, PAP III is relatively

abundant while PAP II is absent [21]. This differentialexpression pattern suggests that these isoforms do notsubstitute one another but may have different func-tional properties or may be required in various combi-nations for optimal efficiency in the different extracel-lular environment found in the pancreas and the smallintestine.

The mechanisms for variable staining under basal(PSP/reg) and resolution (PSP/reg, PAP I, and PAP II)conditions are unknown. We examined whether PSP/reg staining under basal conditions may be associatedwith cell proliferation. In colocalization studies, cells

FIG. 5. Immunohistochemical localization of PSP/reg and PAP in experimental caerulein-induced rat pancreatitis. PSP/reg, PAP I, andPAP II immunoreactivity before (Day 0) and Day 1, 2, or 3 after an intraperitoneal supramaximal caerulein injection. Arrowhead points toa PSP/reg-positive cell (Day 0, PSP/reg). Controls for individual antigens are not given but appear similar to the Day 0/PAP I picture. i, islet;d, duct. Original magnification, �100.


stained for proliferating nuclear antigen (PCNA) didnot stain with PSP/reg. We conclude that the variable(patchy) staining of PSP/reg-positive cells does not cor-relate with cells undergoing mitosis and proliferation.Whether selective expression of PSP/reg correlateswith other pathophysiological parameters, such as re-ceptor distribution [8] and membrane dynamics, re-mains to be studied.

ACKNOWLEDGMENTS

We thank M. Bain and R. Gassmann for excellent technical assis-tance. The support of the EM-Zentrallabor (Professor Th. Bachi andhis staff), University of Zurich, is highly appreciated. The project wasfunded by a Swiss National Science Foundation grant (32-052661.97), by the Union Bank of Switzerland (SBG/UBS) on behalfof an anonymous customer, and by a grant from the Amelie WaringStiftung.

REFERENCES

1. Schiesser, M., Bimmler, D., Frick, T. W., and Graf, R. Confor-mational changes of pancreatitis-associated protein (PAP) acti-vated by trypsin lead to insoluble protein aggregates. Pancreas22: 186, 2001.

2. Graf, R., Schiesser, M., Scheele, G. A., Marquardt, K., Frick,T. W., Ammann, R., and Bimmler, D. A family of 16 kDapancreatic secretory stress proteins form highly organizedfibrillar structures upon tryptic activation. J. Biol. Chem. 276:21028, 2001.

3. Keim, V., Rohr, G., Stockert, H. G., and Haberich, F. J. Anadditional secretory protein in the rat pancreas. Digestion 29:242, 1984.

4. Keim, V., and Loffler, H. G. Pancreatitis-associated protein inbile acid-induced pancreatitis of the rat. Clin. Physiol. Biochem.4: 136, 1986.

5. Iovanna, J. L., Keim, V., Nordback, I., Montalto, G., Camarena,J., Letoublon, C., Levy, P., Berthezene, P., and Dagorn, J. C.Serum levels of pancreatitis-associated protein as indicators ofthe course of acute pancreatitis. Multicentric Study Group onAcute Pancreatitis. Gastroenterology 106: 728, 1994.

6. Zenilman, M. E., Tuchman, D., Zheng, Q.-H., Levine, J., andDelaney, H. Comparison of reg I and reg III levels during acutepancreatitis in the rat. Ann. Surg. 232: 646, 2000.

7. Watanabe, T., Yonemura, Y., Yonekura, H., Suzuki, Y., Mi-yashita, H., Sugiyama, K., Moriizumi, S., Unno, M., Tanaka, O.,Kondo, H., Bone, A. J., Takasawa, S., and Okamoto, H. Pancre-atic beta-cell replication and amelioration of surgical diabetesby Reg protein. Proc. Natl. Acad. Sci. USA 91: 3589, 1994.

8. Kobayashi, S., Akiyama, T., Nata, K., Abe, M., Tajima, M.,Shervani, N. J., Unno, M., Matsuno, S., Sasaki, H., Takasawa,

S., and Okamoto, H. Identification of a receptor for reg (regen-erating gene) protein, a pancreatic beta-cell regeneration factor.J. Biol. Chem. 275: 10723, 2000.

9. Bimmler, D., Frick, T. W., and Scheele, G. A. High-level secre-tion of native rat pancreatic lithostathine in a baculovirus ex-pression system. Pancreas 11: 63, 1995.

10. Bimmler, D., Graf, R., Scheele, G. A., and Frick, T. W. Pancre-atic stone protein (lithostathine), A physiologically relevantpancreatic calcium carbonate crystal inhibitor? J. Biol. Chem.272: 3073, 1997.

11. Lampel, M., and Kern, H. F. Acute interstitial pancreatitis inthe rat induced by excessive doses of a pancreatic secretagogue.Virchow’s Arch. A 373: 97, 1977.

12. Yamaguchi, H., Kimura, T., Mimura, K., and Nawata, H. Acti-vation of proteases in cerulein-induced pancreatitis. Pancreas4: 565, 1989.

13. Bimmler, D., Angst, E., Valeri, V., Bain, M., Scheele, G. A.,Frick, T. W., and Graf, R. Regulation of PSP/reg in rat pancreas:Immediate and steady state adaptation to different diets. Pan-creas 19: 255, 1999.

14. Heery, D. M., Gannon, F., and Powell, R. A simple method forsubcloning DNA fragments from gel slices. Trends Genet. 6:173, 1990.

15. Iovanna, J., Orelle, B., Keim, V., and Dagorn, J.-C. MessengerRNA sequence and expression of rat pancreatitis-associatedprotein, a lectin-related protein overexpressed during acuteexperimental pancreatitis. J. Biol. Chem. 266: 24664, 1991.

16. Frigerio, J. M., Dusetti, N. J., Keim, V., Dagorn, J. C., andIovanna, J. L. Identification of a second rat pancreatitis-associated protein: Messenger RNA cloning, gene structure,and expression during acute pancreatitis. Biochemistry 32:9236, 1993.

17. Frigerio, J. M., Dusetti, N. J., Garrido, P., Dagorn, J. C., andIovanna, J. L. The pancreatitis associated protein III (PAP III),a new member of the PAP gene family. Biochim. Biophys. Acta1216: 329, 1993.

18. Ihaka, R., and Gentleman, R. A language for data analysis andgraphics. J. Comput. Graph. Stat. 5: 299, 1996.

19. Smith, F. E., Bonner, W. S., Leahy, J. L., Laufgraben, M. J.,Ogawa, Y., Rosen, K. M., and Villa, K. L. Pancreatic Reg/pancreatic stone protein (PSP) gene expression does not corre-late with beta-cell growth and regeneration in rats. Diabetolo-gia 37: 994, 1994.

20. Keim, V., Willemer, S., Iovanna, J. L., Adler, G., and Dagorn,J. C. Rat pancreatitis-associated protein is expressed in rela-tion to severity of experimental pancreatitis. Pancreas 9: 606,1994.

21. Sansonetti, A., Romeo, H., Berthezene, P., Scacchi, P., Dusetti,N., Keim, V., Dagorn, J. C., and Iovanna, J. L. Developmental,nutritional, and hormonal regulation of the pancreatitis-associated protein I and III gene expression in the rat smallintestine. Scand. J. Gastroenterol. 30: 664, 1995.


coordinate regulation of secretory stress proteins (psp/reg, pap i, pap ii, and pap iii) in the rat...

Documents