conversion de protooncogenes en oncogenes

Download Conversion De Protooncogenes En Oncogenes

Post on 05-Jul-2015

17.003 views

Category:

Health & Medicine

2 download

Embed Size (px)

TRANSCRIPT

  • 1. HOSPITAL LLUS ALCANYS SERVICIO DE PATOLOGA Xtiva Valencia 12 al 14 de enero de 2009BASES MOLECULARES DEL CNCER APLICACIN A LA PATOLOGA TUMORAL

2. Conversin de Protooncogenes en Oncogenes Pascual Meseguer Garca Servicio de Patologa Hospital Llus Alcanys de Xtiva 3. ndice de la presentacin

  • El genoma
  • El gen
  • El protooncogn
  • El oncogn
  • Otros genes implicados en el cncer
  • Activacin de los oncogenes
  • El cdigo epigentico
  • Una breve resea histrica
  • Conclusiones

4. 1. Que es el genoma?

  • Todo elADNcontenido en un organismo:
    • Genes.
    • Secuencias no codificantes.
    • ADN mitocondrial.
  • El Genoma Humano est constituido por 3.000 1 000.000 bases (20.500genes)

19.500 genes 50.000 genes 5. cido desoxirubonuclico (ADN) Doble hlice denucletidos 1 m 6.

  • Un nucletido consta de:
  • Una molcula de azcar
  • Una molcula de cido fosfrico
  • Una base nitrogenada:
    • A denina
    • T imina
    • G uanina
    • C itosina

NucletidosA denina T imina G uanina C itosina 7.

  • Un nucletido consta de:
  • Una molcula de azcar
  • Una molcula de cido fosfrico
  • Una base nitrogenada:
    • A denina
    • T imina
    • G uanina
    • C itosina

NucletidosA denina T imina G uanina C itosina 8.

  • Un nucletido consta de:
  • Una molcula de azcar
  • Una molcula de cido fosfrico
  • Una base nitrogenada:
    • A denina
    • T imina
    • G uanina
    • C itosina

NucletidosA denina T imina G uanina C itosina T A G A A A A G G G T T T C T C C C 9. Cdigo gentico

  • Es el lenguaje en el que estn escritos los genes (es universal).
  • A ,T ,G , yCson las "letras" del cdigo gentico

Homo sapiens otospiralin (OTOS) ; Location: 2q37.3 CCCATCCAGGCAGCACGGCTGGCTGAGCAGAGACAAGGGCTGCCACACTGGGACTGGTAGAGGAAGCCCTGACGGATGGGTGGTCTCGCCCTTCCTGGGTTCATCCTGCTGCAGGTGGGCCTGAGTCGCAGATCAGAACACCGGGAAGATGCAGGCCTGCATGGTGCCGGGGCTGGCCCTCTCCTCCTACTGGGGCCTCTTGAGGGGCCAAGCCTGTGCAGGAGGAAGGAGACCCTTACGCGGAGCTGCCGGCCATGCCCTACTGGCCTTTTCCACCTCTGACTTCTGGAACTATGTGCAGCACTTCCAGGCCCTGGGGGCCTACCCCCAGATCGAGGACTGGCCCGAACCTTCTTTGCCCACTTCCCCCTGGGGAGCACGCTGGGCTTCCACGTTCCCTATCAGGAGGACTGAATGGTGTCCAGCCTGGTGCCCGCCCACCCCGCCAGGCTGCACTCGGTCGGGCCTCCACAGGCATGGAGTCCCCGCAAAAACCTGGCCCCTGCAGGAGTCAGGCCTGGTCTCACGCTCAATAAACTCCGGACTGAAGATGCA 10. Tamao del Genoma Humano170 m Monumento a Washington 11. Codn

  • Por ejemplo:
  • El codn TTT = Fenilalanina
  • El codn TTA = Leucina
  • El codn GTA = Valina.

Sontres basesnitrogenadas en una secuencia de ADN o ARN, las cuales especifican un solo aminocido (1 codn = 1 aa). 12. 2. Qu es un gen?

  • Unidad fsica y funcional de la herencia.
  • Estn compuestos por ADN. (100-2.000.000 bases).
  • La mayora contiene la informacin para elaborar una protena especfica.

Transcriptoma Transcriptoma:Conjunto de mRNAs que una clula determinada transcribe en una situacion normal o patolgica.Transcriptoma 13. Gen 14. Estructura de un Gen potenciador TTGIOCTGRACIASTPGBPORDLDCVATENDERDTTC TTGIOCT GRACIAS TPGB POR DLDCV ATENDER DTTC GRACIAS POR ATENDER 15. Replicacin del ADN 16. Transcripcin: DNA To mRNA Adenina Uracilo Guanina Citosina DNA 17. 18. 19. 20. Transferencia 21. 3. Qu es un protooncogn?

  • Es un gennormalque interviene la proliferacin celular.
  • Se considera que sondominantes , ya que transforman a las clulas aunque sus alelos sean normales.

22. 4. Qu es un oncogn?

  • Es la forma mutada de un protooncogn.
  • Codifica una protena anormal (oncoprotena), que se mantiene activa independientemente de las seales reguladoras (no se degrada).
  • Estoconvierte a la clula en tumoralpor una proliferacin desordenada.
  • En los humanos se han identificado ms de 60 oncogenes.

23.

  • Factores de crecimiento:v-sis, HST, KST
  • Receptores de los factores de crecimiento:
    • Con actividad Tirosina Kinasa:EGFR, c-KIT, HER2-NEU
    • Sin actividad Tirosina Kinasa: mas
  • Factores de transcripcin:v-fos, v-jun, v-myc(G0 a G1)
  • Remodeladores de la cromatina:ALL1 (MLL)
  • Transductores de seales:
    • Tirosina Kinasa citoplasmtica:SRC, ABL
    • Asociados a la protena G: H-RAS, K-RAS, N-RAS, BRAF

Clasificacin de los oncogenesEn funcin de la protena que codifican Lista de Oncogenes 24. Gen normal Protooncogn Gen mutado Oncogn Expresin Expresin Protena normal Protena anmala ( Oncoprotena ) Hay estmulo Hay estmulo La protena acta La protena acta No hay estmulo No hay estmulo La protenano acta La protena acta Mutacin Funcin normal Actividad excesiva Cncer Oncogn Sobreexpresin 25. 5. Otros genes implicados en el cncer Genes de invasin/metstasis Genes de los miRNA Genes de activacin/desactivacin de carcingenos Genes reparadores del ADN Genes que regulan el envejecimiento (Telomerasa) Genes de la Apoptosis (evasin de la apoptosis) Genes de diferenciacin celular Genes supresores del cncer Genes adicionales Principales responsables 26. Genes oncosupresores

  • Son genes normales queactan deteniendo la divisincelular.
  • La mutacin de un gen supresor hace que pierda esta funcin y se pueda desarrollar un tumor.
  • Para que se produzca la transformacin neoplsica de la clula, deben resultar daados los dos alelos (sonrecesivos ).

Cuando estn activos ejercen un efecto antiproliferativo en la clula 27. Gen oncosupresor Gen oncosupresor mutado Expresin Expresin Protena normal oncosupresora Protena anmala ( no Oncosupresora ) Hay estmulo Hay estmulo La protena acta La protena no acta No hay estmulo No hay estmulo La protenano acta La protena no acta Mutacin Funcin normal No hay actividadCncer Gen supresor 28. Ejemplos de Genes supresores

  • RB :Frena el avance de la fase G1 a S en el ciclo celular.
  • Retinoblastoma familiar
  • P53 :Induce a otros genes:
    • Detienen el ciclo celular (p21).
    • Promueven la reparacin de ADN (GADD45)
    • o promueven la apoptosis (BAX)
    • Sndrome de Li-Fraumeni
  • APC :Regula la degradacin de la -Catenina
  • Poliposis familiar adenomatosa de colon
  • NF-1, NF-2: Accin similar a APC(neurofibromatosis 1 y 2)
  • PTEN(sndrome de Cowden)VHL(von Hippel-Lindau),WT1

Producen sndromes cuando hay mutacin en la lnea germinal El guardin del genoma 29.

  • La va extrnseca o de los "receptores de muerte
    • Receptores: La protena Fas, TRAIL y TNF-
  • Va intrnseca o del estrs celular(o mitocondrial)
  • Protenas de la familiaBCL2
    • Subfamilia Bcl-2 (anti-apopttica): Bcl-2, Bcl-XL, Bcl-W, MCL-1
    • Subfamilia Bax (pro-apopttica): Bax, Bak, Bok
    • Subfamilia BH3 (pro-apopttica): Bad, Bid, Bik, Blk, BimL
  • Va citotxica(perforina/granzima)
  • Utilizada por los linfocitos T citotxicos y NK

Genes de la apoptosis Si estos genes estn mutados: La clula puede evadir la apoptosis y convertirse en tumoral 30. Genes que regulan la reparacin del ADN

  • Su funcin es reparar las mutaciones no letales de otros genes.
  • Tipos:
    • Reparacin de errores de emparejamiento (mismatch) *
    • MSH2, MLH1 (Sndrome de Lynch, Sindr. de Muir-Torre)
    • Reparacin de la escisin de nucletidos(1).
    • XPA, XPB, XPC (Xerodermia pigmentosa)
    • Reparacin de la recombinacin.
    • AMT (Ataxia telangiectasia) (BRCA1, BRCA2)
  • * Las mutaciones de lo genes mismatch se pueden manifestar como inestabilidad de los microsatlites (CACACACACA)
  • Human DNA repair genes

31. Genes reparadores de errores de emparejamiento F7-corrector ortogrfico 32. 6. Activacin de los oncogenes

  • UN PROTOONCOGN SE TRANSFORMA EN UN ONCOGN POR:
  • 1. Mutaciones ocasionadas por:
    • Error fortuito en la duplicacin de ADN.
    • Causas fsicas
      • Radicaciones ionizantes (Rx, R gamma).
      • Rayos ultravioleta (UVB, UVC)
    • Causas

Recommended

View more >