contribution of trimeric autotransporter c-terminal domains of … · yada-passenger domain (bp 1...

JOURNAL OF BACTERIOLOGY, July 2008, p. 5031–5043 Vol. 190, No. 140021-9193/08/$08.00�0 doi:10.1128/JB.00161-08Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Contribution of Trimeric Autotransporter C-Terminal Domains ofOligomeric Coiled-Coil Adhesin (Oca) Family Members YadA,

UspA1, EibA, and Hia to Translocation of the YadA PassengerDomain and Virulence of Yersinia enterocolitica�

Nikolaus Ackermann,† Maximilian Tiller,† Gisela Anding,Andreas Roggenkamp, and Jurgen Heesemann*

Max von Pettenkofer Institute for Hygiene and Medical Microbiology, Ludwig Maximilians University Munich,Pettenkoferstrasse 9a, 80336 Munich, Germany

Received 31 January 2008/Accepted 7 May 2008

The Oca family is a novel class of autotransporter-adhesins with highest structural similarity in theirC-terminal transmembrane region, which supposedly builds a beta-barrel pore in the outer membrane (OM).The prototype of the Oca family is YadA, an adhesin of Yersinia enterocolitica and Yersinia pseudotuberculosis.YadA forms a homotrimeric lollipop-like structure on the bacterial surface. The C-terminal regions of threeYadA monomers form a barrel in the OM and translocate the trimeric N-terminal passenger domain,consisting of stalk, neck, and head region to the exterior. To elucidate the structural and functional role of theC-terminal translocator domain (TLD) and to assess its promiscuous capability with respect to transport ofrelated passenger domains, we constructed chimeric YadA proteins, which consist of the N-terminal YadApassenger domain and C-terminal TLDs of Oca family members UspA1 (Moraxella catarrhalis), EibA (Esche-richia coli), and Hia (Haemophilus influenzae). These constructs were expressed in Y. enterocolitica and com-pared for OM localization, surface exposure, oligomerization, adhesion properties, serum resistance, andmouse virulence. We demonstrate that all chimeric YadA proteins translocated the YadA passenger domainacross the OM. Y. enterocolitica strains producing YadA chimeras or wild-type YadA showed comparablebinding to collagen and epithelial cells. However, strains producing YadA chimeras were attenuated in serumresistance and mouse virulence. These results demonstrate for the first time that TLDs of Oca proteins ofdifferent origin are efficient translocators of the YadA passenger domain and that the cognate TLD of YadA isessential for bacterial survival in human serum and mouse virulence.

Protein secretion in gram-negative bacteria is faced with theserious problem of traversing two different membrane-lipidbilayers. Therefore, several secretory pathways have evolved,which were classified into five different types (9, 11, 20, 29, 51).Recently, even two novel multicomponent secretion systems,type VI and type VII secretion, were introduced (1, 31, 40).While all other types engage a whole machinery of proteinexporting helper proteins, the type V secretion mechanism isthought to be less complex, since all necessary information fortransport through both membranes is contained in the secretedprotein itself, which has also led to the term “autotransporter”protein (20). With over 700 identified proteins to date, the typeV secretion family is the largest group, and many of its mem-bers are also confirmed virulence factors with effector func-tions such as adherence, invasion, proteolysis, cytotoxicity, se-rum resistance, and cell-to-cell spread (14, 37). An N-terminalsignal peptide is Sec dependently cleaved during passagethrough the inner membrane, while the process of transloca-tion through the outer membrane (OM) is still unresolved. The

C-terminal region forms a beta-barrel pore before or duringintegration into the OM and is essential for translocation ofthe N-terminal passenger domain across the OM (20). How-ever, the detailed process of passenger domain translocationremains unclear (6). Different models have been proposed toapproach this issue. According to the hairpin and the threadingmodel, the beta-barrel primarily integrates into the OM, andthe passenger domain slides through the pore starting with theC or N terminus (21, 36, 39). The multimeric model suggeststhat the passenger domain is translocated to the bacterial sur-face through a central channel built by a multimeric complex ofbeta-barrel pores (52), while the Omp85 model involves theOM protein Omp85/YaeT in the translocation process (54,55).

Previously, we could demonstrate that the Yersinia adhesinYadA of Yersinia enterocolitica and Yersinia pseudotuberculosisis the prototype of a novel class of oligomeric autotransporteradhesins (42), which we termed Oca (for oligomeric coiled-coiladhesins), which can be found in alpha-, beta-, and gamma-proteobacteria. In addition to YadA, several other familymembers, such as Hia and Hsf of Haemophilus influenzae,UspA1 and UspA2 of Moraxella catarrhalis, Eib proteins ofEscherichia coli, or NadA of Neisseria meningitidis, have beenidentified in the last few years (8, 12, 15, 23, 45, 48). Conven-tional autotransporters are monomeric proteins and form theirC-terminal translocator domain (TLD) with 12 transmem-

* Corresponding author. Mailing address: Max von PettenkoferInstitute for Hygiene and Medical Microbiology, Ludwig Maximil-ians University Munich, Pettenkoferstrasse 9a, 80336 Munich, Ger-many. Phone: 49(0)89-5160-5201. Fax: 49(0)89-5160-5202. E-mail:[email protected].

† N.A. and M.T. contributed equally to this study.� Published ahead of print on 16 May 2008.

5031

on February 24, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

brane beta-strands from their C-terminal 250 to 300 aminoacid (aa) residues, as could demonstrated by the recently re-solved crystal structures of NalP and EspP (5, 36). Oca familymembers form a trimeric 12-stranded beta-barrel pore withtheir last �70 C-terminal amino acids, which means that eachof the three monomers contributes four transmembrane anti-parallel beta-sheets to the oligomeric pore, roughly compara-ble with the oligomeric structure of the OM protein TolC fromE. coli (25). As demonstrated by C-terminal deletion con-structs (50), the assembly of the three TLDs is necessary fortranslocation of the N-terminal passenger domains to the bac-terial surface, which in case of trimeric YadA forms a lollipop-like structure comprising a head, neck, and coiled-coil stalkregion and remains uncleaved and covalently attached to theTLDs in contrast to several conventional autotransporters suchas the immunoglobulin A (IgA) protease of N. gonorrhoeae(39). It could be shown that the C-terminal 92 aa of YadAefficiently present a FLAG tag on the bacterial surface, thusforming an efficient translocon (42). For the C-terminal 76 aaresidues of Hia, comparable results could be obtained (48).Crystal structures of fragments of YadA and Hia N-terminalpassenger and C-terminal TLDs, which proved the trimericarchitecture of both adhesins, showed that the separate YadApassenger domain also possesses a translocator-independentcapacity to oligomerize and that the YadA and Hia C-terminalTLDs form a trimeric beta-barrel, confirming previous bio-chemical results and secondary structure predictions (24, 26,34, 56), which finally led to a novel, more restricted term forthe Oca family, i.e., trimeric autotransporter adhesins (56).Since it cannot be excluded, however, that in the future tet-rameric or other oligomeric variants of autotransporters will bediscovered, we suggest using the term Oca as a hypernym.

Certain regions of YadA could be assigned to distinct func-tional properties associated with virulence. While the ability tobind HEp-2 epithelial cells and extracellular matrix (ECM)proteins such as collagen is localized in an intact YadA head-neck-binding module (19, 42, 43, 49), adherence to neutrophilsrequires the first 53 aa of its head region (44), and the regionnecessary for autoagglutination (AA) could not precisely bedefined yet, but a hydrophobic region in the head domainseems to be involved (47, 50). Interestingly, the proximallylocated head-neck region was found to be not directly neces-sary for YadA-mediated serum resistance (42). The coiled-coilstalk region of YadA, which is formed by a variable number(six to nine) of 15-mer repeats depending on the Yersiniaserotype (23), seems to have a spacer function between theYadA head and the bacterial OM, since its length influencesthe efficiency of type III secretion-mediated Yop translocation(30). Although the stalk region is implicated in YadA-medi-ated serum resistance, it does not seem to be essential for thisphenomenon, since an in-frame deletion of the first four ofseven 15-mer repeats of the stalk region of Y. enterocolitica O:8YadA did not result in a loss of serum resistance (42). There-fore, the exact region for this phenotype could not be definedyet. Furthermore, it is still unknown whether the in vitro-observed phenomenon of serum resistance contributes to invivo Y. enterocolitica virulence. Although YadA mutants lack-ing collagen- or neutrophil-binding function were found to beattenuated in the mouse infection model, mutants with full

adhesive activity, but without mediation of serum resistance,were not yet available to study (43, 44).

To further elucidate the relative impact of changes in theC-terminal TLD on YadA passenger domain structure andfunction and to assess the promiscuous capability of Oca TLDswith respect to transport and translocation of related passen-ger domains, we constructed fusion proteins, which consist ofthe N-terminal YadA passenger domain and C-terminal TLDsof Oca family members UspA1, EibA, and Hia. These con-structs were expressed in Y. enterocolitica and compared forOM localization, surface exposure, oligomerization, resistanceto tryptic digestion, adhesion properties, resistance to serumbactericide, and virulence in a Y. enterocolitica mouse infectionmodel. From our results we conclude that C-terminal TLDs ofOca proteins UspA1, EibA, and Hia are efficient translocatorsof the heterologous YadA passenger domain and maintain itscollagen and cell adherence capability but are not sufficientto mediate serum resistance and mouse virulence like theYadA TLD.

(Parts of this study are included in the doctoral thesis of M.Tiller.)

MATERIALS AND METHODS

Bacterial strains and culture conditions. The bacterial species and strainsused in the present study are listed in Table 1. E. coli, M. catarrhalis, and H.influenzae were grown in Luria-Bertani (LB) medium at 37°C, and Y. enteroco-litica was grown at 27°C (18). For the induction of yadA gene expression, over-night cultures cultivated at 27°C in LB were diluted 1:40 in RPMI 1640 medium(Invitrogen, Paisley, United Kingdom) and grown at 37°C for 1.5 h (for bindingassays) or 6 h (for immunofluorescence assay [IFA], dot immunoblotting, en-zyme-linked immunosorbent assay [ELISA], and OM protein preparations).Antibiotics were used in the following concentrations: ampicillin, 100 �g/ml;kanamycin, 25 �g/ml; nalidixic acid, 60 �g/ml; and spectinomycin, 50 �g/ml.

DNA manipulations and PCR. Restriction endonuclease digestion, DNA li-gations, transformations, sequencing, and PCR were done according to standardtechniques (4). Conjugations were performed as described previously (43). Plas-mid DNA preparations and isolation of DNA fragments from agarose gels weredone with Macherey-Nagel kits (Macherey-Nagel GmbH & Co.KG, Duren,Germany) as described by the manufacturer.

Sequence alignment. Amino acid sequence alignment was done with DNAMAN5.2.9 software (Lynnon BioSoft, Quebec, Canada).

Construction of the YadA-hybrid proteins and expression in Y. enterocoliticaO:8. The pUC-A-1 ClaI-SphI backbone was prepared as described previously(42). YadA-hybrid proteins were generated with three separate PCR fragments(Fig. 1C) —(i) a ClaI-SacI fragment (PCR-1) of the yadA gene encoding theYadA-passenger domain (bp 1 to 993); (ii) a SacI-SacI fragment (PCR-2) en-coding the corresponding yadA (for control construct YadA [D332L, H333E]),uspA1, eibA, or hia gene TLD; and (iii) a SacI-SphI fragment (PCR-3) encodingthe yadA terminator region directly after the yadA stop codon—were ligated intoa ClaI-SphI vector backbone (pUC-A1) and subsequently transformed into E.coli DH5�. The oligonucleotides used in the present study are listed in Table 2.

In PCR-2 the primers used for the UspA1-insert were UspA1-2224-f andUspA1-2499-r, with M. catarrhalis O35E DNA as a template. We used EibA-916-f and EibA-1179-r for the EibA insert with E. coli ECOR9 DNA, A-1000-fand A-1269-r for the YadA (D332L, H333E) insert with Y. enterocolitica WA-314DNA, and Hia-3025-f and Hia-3297-r for the Hia insert with H. influenzae NTHi17035 DNA. Each of these PCR products was ligated with the products of PCR-1and PCR-3 into the pUC-A-1 ClaI-SphI backbone and transformed into E. coliDH5�.

To replace the yadA beta-barrel domain and hairpin-loop region of the yadAlinker domain with the homologous gene sequence of uspA1 or to replace onlythe beta-barrel domain of wild-type yadA with the corresponding sequence ofuspA1, two additional YadA-UspA1 fusion constructs, YadA-UspA1-2 andYadA-UspA1-3, were constructed by using a PCR mutagenesis strategy (22).Briefly, two PCR products with overlapping ends were synthesized, which werethen added into a second PCR where, with the help of an appropriate annealingtemperature (in this case 60°C), overlap of the two PCR products happens, and

5032 ACKERMANN ET AL. J. BACTERIOL.


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

a new PCR product is synthesized by external 5� and 3� primers. For the synthesisof YadA-UspA1-2, the primers A-Cla-f and A-U-1083-r with Y. enterocoliticaWA-314 DNA and the primers U-2308-f and A-Sph-r with M. catarrhalis O35EDNA were used for the construction of PCR products 1 and 2, respectively, andfor the synthesis of YadA-UspA1-3, the primers A-Cla-f and A-1104-r with Y.enterocolitica WA-314 DNA and the primers A-U-2329-f and A-Sph-r with M.catarrhalis O35E DNA were used. In the second PCR, the appropriate PCRproducts 1 and 2 were used as overlapping template DNA and with the primersA-Cla-f and A-Sph-r the fusion constructs were synthesized, digested with ClaIand SphI, and subsequently ligated in the pUC-A-1 ClaI-SphI backbone asdescribed before.

For subsequent expression studies in Y. enterocolitica, all yadA hybrid geneconstructs were cloned into the mobilizable suicide vector pGP704 with aninserted streptomycin-resistant spectinomycin-resistant � fragment (28) in E.coli SM10�pir for mobilization into Y. enterocolitica strains WA-314 harboring avirulence plasmid (pYVO-A-0) with a deleted yadA gene, as described previously(42). All of the constructs listed in Table 1 were verified by restriction enzymeanalysis of plasmid preparations, PCR, and sequencing.

IFA. To investigate the surface exposure of the YadA chimeras, Yersiniastrains were grown at 37°C for 6 h, harvested by centrifugation, and washed withphosphate-buffered saline (PBS). Bacteria were treated with a monoclonal an-tibody (MAb; 8D1) specific for the lower stalk region of YadA (aa 290 to 330)

TABLE 1. Bacterial strains and plasmids used in this study

Strain or plasmid Descriptiona Source orreference

StrainsY. enterocolitica

WA-314 Clinical isolate of serotype O:8, carrying virulence plasmid pYVO8 18WA-c Plasmidless derivative of WA-314 18

E. coliDH5� endA1 supE44 hsdR17(rK

� mK�) thi-1 recA1 gyrA96 relA1 (lacZYA-argF)U169 (80

lacZM15)17

Sm10�pir thi-1 thr leu tonA lacY supE recA::RP4-2-TC::Mu-Kan (�pir), Kmr 28ECOR-9 Clinical isolate, EibA� 35, 45

H. influenzae NTHi58670

Clinical isolate of a nontypeable H. influenzae strain, Hia� This study

M. catarrhalis O35E Clinical isolate, UspA1�, UspA2� 2

PlasmidspUC-A-1 pUC13 with 5-kb EcoRI-HindIII insert fragment of pYVO8 from WA-314 carrying the

yadA gene43

pUC-A-YadA-UspA1 pUC-A1334-422, carrying instead of the yadA linker and anchor region the homologouslast 90 aa of UspA1

This study

pUC-A-YadA-UspA1-2 pUC-A1362-422, carrying instead of the yadA loop and anchor region the homologouslast 63 aa of UspA1

This study

pUC-A-YadA-UspA1-3 pUC-A1369-422, carrying instead of the yadA anchor region the homologous last 56 aaof UspA1

This study

pUC-A-YadA-EibA pUC-A1334-422, carrying instead of the yadA linker and anchor region the homologouslast 87 aa of EibA

This study

pUC-A-YadA(D332L,H333E)

pUC-A1334-422, carrying the reinserted yadA linker and anchor region This study

pUC-A-YadA-Hia pUC-A1334-422, carrying instead of the yadA linker and anchor region the homologouslast 90 aa of Hia

This study

pGP704 Mobilizable suicide vector, R6K2 replicon, requires � protein in trans from the �pir-positive strain

28

pGPS-A-1 pGP704 � 1.8-kb Spcr cassette in the EcoRI site (�pGPS) carrying the yadA gene asan EcoRI-SphI fragment from pUC-A-1

43

pGPS-A-YadA-UspA1 pGPS carrying the yadA-uspA1 gene as an EcoRI-SphI fragment from pUC-A-YadA-UspA1

This study

pGPS-A-YadA-UspA1-2 pGPS carrying the yadA-uspA1-2 gene as an EcoRI-SphI fragment from pUC-A-YadA-UspA1-2

This study

pGPS-A-YadA-UspA1-3 pGPS carrying the yadA-uspA1-3 gene as an EcoRI-SphI fragment from pUC-A-YadA-UspA1-3

This study

pGPS-A-YadA-EibA pGPS carrying the yadA-eibA gene as an EcoRI-SphI fragment from pUC-A-YadA-EibA

This study

pGPS-A-YadA(D332L,H333E)

pGPS carrying the yadA(D332L, H333E) gene as an EcoRI-SphI fragment from pUC-A-YadA(D332L, H333E)

This study

pGPS-A-YadA-Hia pGPS carrying the yadA-hia gene as an EcoRI-SphI fragment from pUC-A-YadA-Hia This studypYVO8-A-0 pYVO8, yadA mutant, Kmr cassette inserted in the PstI sites of yadA by allelic

exchange43

pYVO8-A-1 pYVO8-A-0 with integrated pGPS-A-1, wild-type yadA 43pYVO8-YadA-UspA1 pYVO8-A-0 with integrated pGPS-A-YadA-UspA1 This studypYVO8-YadA-UspA1-2 pYVO8-A-0 with integrated pGPS-A-YadA-UspA1-2 This studypYVO8-YadA-UspA1-3 pYVO8-A-0 with integrated pGPS-A-YadA-UspA1-3 This studypYVO8-YadA-EibA pYVO8-A-0 with integrated pGPS-A-YadA-EibA This studypYVO8-YadA(D332L,

H333E)pYVO8-A-0 with integrated pGPS-A-YadA(D332L, H333E) This study

pYVO8-YadA-Hia pYVO8-A-0 with integrated pGPS-A-YadA-Hia This study

a Spcr, spectinomycin resistance; Kmr, kanamycin resistance.

VOL. 190, 2008 YERSINIA YadA HYBRID AUTOTRANSPORTER 5033


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

at 37°C for 30 min and subsequently washed three times with PBS. Surface-bound MAb 8D1 was detected with fluorescein isothiocyanate-conjugated anti-mouse immunoglobulin (Sigma-Aldrich, Munich, Germany) diluted 1:50 in PBSas described previously (42). Glass slides were coated with the unfixed bacteria,which were then visualized by fluorescence microscopy.

ELISA. To quantitatively compare the surface expression of YadA and YadAhybrid molecules, an ELISA of whole, unfixed bacteria was performed. Yersiniastrains were grown at 37°C for 6 h, harvested by centrifugation, and diluted to anoptical density at 600 nm (OD600) of 0.2. After two washes with PBS, the bacteriawere incubated with MAb 8D1 (1:1,000 in PBS) at 37°C for 1 h, washed againtwice, and incubated with secondary antibody anti-mouse IgG-peroxidase con-jugate (Sigma-Aldrich) diluted 1:1,000 in PBS at 37°C for 1 h. After two furtherwashing steps, samples were resuspended in 50 �l of PBS and transferred into aMicrolon 600 96-well plate (Greiner, Frickenhausen, Germany). For develop-ment, 50 �l of orthophenylene-diamine (OPD) solution (1 OPD tablet dissolvedin 3 ml of H2O and 1.25 �l of H2O2; Dako, Glostrup, Denmark) was added toeach sample, and the plate was incubated for 15 min at room temperature. Thereaction was stopped with 0.5 N H2SO4, and extinction was measured at OD492.

Immunoblotting. OM preparations of YadA were performed as describedelsewhere (23). OM samples were resuspended in electrophoresis buffer (1%sodium dodecyl sulfate [SDS] and 0.25% 2-mercaptoethanol), either boiled for10 min or incubated at 37°C for 60 min, and separated by discontinuous SDS-polyacrylamide gel electrophoresis (PAGE) using 11% polyacrylamide. To checkfor release of YadA or YadA hybrid protein into the culture broth, supernatants

(100 ml each) from bacterial overnight cultures were collected after centrifuga-tion and sterile filtered through a membrane (pore size, 0.2 um; Millipore,Billerica, MA). After the addition of a 0.1 volume (vol) trichloroacetic acid(Roth, Karlsruhe, Germany), the samples were vortex mixed and incubated onice for 2 h for precipitation, followed by a 30-min centrifugation step (20,800 g, 4°C). The supernatant was discarded, and the precipitate was resuspended in1 ml of PBS. Then, a 0.4 volume of acetone (�20°C; Merck, Darmstadt, Ger-many) was added, followed by a further vortexing and a subsequent 1-h incuba-tion step on ice for acetone precipitation. The samples were centrifuged again(20,800 g, 4°C, 30 min); the pellets were then resuspended in 1 ml of acetone(�20°C) and centrifuged again at 20,800 g at 4°C for 3 min and, after removalof the supernatant, resuspended in 50 mM Tris (pH 8.0) and stored at �20°C.The OM and supernatant samples were then transferred to nitrocellulose sheets(BA85; Whatman, Plc., London, United Kingdom) by electrophoresis andblocked with 3% bovine serum albumin (fraction V) in PBS–0.5% Tween over-night at 4°C. Immunostaining of YadA was done with MAb 8D1. Antigen-antibody complexes were detected with an anti-mouse IgG-alkaline phosphataseconjugate (Sigma-Aldrich) diluted 1:5,000 in PBS–0.5% Tween for the MAb,followed by development with indoxylphosphate-tetrazolium (Sigma-Aldrich) asdescribed previously (43).

Protease accessibility assay. After the stimulation of bacterial YadA produc-tion by growth at 37°C for 6 h in LB medium, 107 bacterial cells were washed withPBS and incubated with protease trypsin (Invitrogen) at various concentrations(ranging in 10-fold increments from 0.25 to 250 �g/ml, diluted in PBS) for 1 h at

FIG. 1. (A) Sequence alignment of the TLD monomers of YadA, EibA, Hia, and UspA1. The TLD monomer consists of two main parts: thelinker domain and the beta-barrel domain. The linker domain can be separated into a proximal �1 domain, which traverses the beta-barrel domain,and a distal hairpin loop, which connects the �1 domain to the beta-barrel domain. The beta-barrel domain consists of four transmembraneantiparallel beta-sheets (�1 to �4). In this study, the YadA TLD (aa 334 to 422) was replaced with either the EibA (aa 306 to 392), Hia (aa 1009to 1098), or UspA1 (aa 742 to 832) TLD region. Arrows mark the replaced amino acids for construction of YadA-UspA1-2 (aa 362 to 422 of YadAreplaced by aa 770 to 832 of UspA1) (from arrow a to arrow c) and YadA-UspA1-3 (aa 369 to 422 of YadA replaced by aa 777 to 832 of UspA1)(from arrow b to arrow c). (B) Crystal structure model of the TLD monomer and trimer, e.g., three YadA monomers build the trimeric YadAprotein (YadA oligomer). Ribbon diagrams were generated with DeepView PDB. (C) Construction scheme of the yadA chimeras. PCR fragmentsI, II, and III were ligated into a ClaI-SphI cut pUC-A-1 vector backbone (see Materials and Methods). SS, signaling sequence. The asterisks referto the corresponding stop codons.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

37°C. After incubation the cells were pelleted, and digestion was stopped byadding 20 �l of electrophoresis buffer (2% SDS, 10% glycerol, 5% 2-mercapto-ethanol, 0.001% bromophenol blue). The samples were incubated at 37°C for 60min and separated by SDS-PAGE as described below. The bacterial cell numberwas verified by counting the CFU of serial dilutions of the samples.

Binding assays and AA. Binding to immobilized collagen and the assay for AAwere done as described previously (43). Briefly, type I collagen (Sigma-Aldrich)was allowed to react with Microlon 600 96-well plates (Greiner) in a 50-�lvolume with concentrations of 2 or 20 �g/ml in PBS for 1 h at 37°C. Nonspecificbinding sites were blocked by incubation with 200 �l of coating buffer (PBS, 0.5%bovine serum albumin) for 1 h at 37°C. After five washes with PBS–0.1% Tween20 the wells were incubated with bacteria (OD600 � 0.5) in PBS–0.1% sodiumazide for 1 h at 37°C. The bacteria were then washed again five times withPBS–0.1% Tween 20. The binding reaction was verified by immunostaining withpolyclonal 1:10,000-diluted rabbit anti-WA-c antiserum overnight at 4°C andincubation with alkaline phosphatase-conjugated goat anti-rabbit IgG (Sigma-Aldrich), as described previously (27). Then, 1 mg of p-nitrophenyl phosphateper ml in H2O was added as a substrate at 37°C. The reaction was stopped with0.5 M H2SO4. The absorbance at 405 nm was determined.

For studying cell adherence, monolayers of HEp-2 cells grown on RPMI 1640

medium were incubated with 5 107 bacteria (OD600 � 0.3) per ml (multiplicityof infection of 100) for 30 min at 37°C in six-well plates for the plating assay. Formicroscopic counting of cell-associated bacteria, monolayers were grown on glassslide insets. To reduce bacterial AA and obtain comparable bacterial inputvalues, bacteria were subjected to shearing forces by pushing them through a27-gauge needle (Braun, Melsungen, Germany) before determination of theOD600. For the removal of loosely attached bacteria, wells were washed threetimes with prewarmed Dulbecco PBS (Invitrogen) after the first 30 min ofincubation. Fresh prewarmed RPMI 1640 medium was then added; plates werereincubated for an additional 30 min and washed again as described above. Forthe plating assay, the cells were removed from the wells with a cell lysis buffer(0.2% Triton X-100, 0.025% trypsin), and serial dilutions of the lysate wereplated out on LB-agar plates for determination of the bacterial CFU. For mi-croscopic counting glass slides were fixed with methanol and stained with Giemsasolution, and cell-associated yersiniae were visualized microscopically. Cell-as-sociated bacteria of 30 randomly selected cells were counted, and the averagenumber per cell � the standard deviation was determined. The statistical signif-icance was determined by using the Student t test. Each experiment was repeatedat least three times.

AA experiments were performed as described previously by Skurnik et al. (47).

TABLE 2. Oligonucleotides used in this study

Primer Description Sequence (5�33�)a

Construction primersPCR-1 PCR-1:5�ClaI-3�SacI fragmentsA-Cla-f Constant forward primer for PCR-1, the start is 167 bp

upstream of yadA start codonTTTTAAAGATCGATTAGTGCTGT

A-993-r Constant reverse primer for PCR-1, the end is at bp 993(T331) of yadA

CACGAGCTCTGTGTATTGATTCGATTCACGG

PCR-2 PCR-2:5�SacI-3�SacI fragmentsA-1000-f Forward primer for the yadA(D332L, H333E) insert, the

start is at bp 1000 (�K334) of yadAGGGGAGCTCAAATTCCATCAACTTGACAACC

A-1269-r Reverse primer for yadA(D332L, H333E)-insert, the end isat bp 1269 (yadA stop codon)

ATTGAGCTCTTACCACTCGATATTAAATGATG

EibA-916-f Forward primer for the eibA insert, the start is at bp 916(L306) of eibA

GTCGAGCTCCTGGACAGCCAGCAGCGCCAG

EibA-1179-r Reverse primer for the eibA insert, the end is at bp 1179(eibA stop codon)

ATTGAGCTCTTAAAACTCGAAGTTCACACCA

UspA1-2224-f Forward primer for the uspA1 insert, the start is at bp2224 (Q742) of uspA1

GACGAGCTCCAGGGTCAGCATTTTAATAATC

UspA1-2499-r Reverse primer for the uspA1 insert, the end is at bp 2499(uspA1 stop codon)

TATGAGCTCTTATTTCCAGCGGTAACTGCCA

Hia-3025-f Forward primer for the hia insert, the start is at bp 3025(Q1009) of hia

AACGAGCTCCAAGTCAATAATCTTGAGGGCAA

Hia-3297-r Reverse primer for the hia insert, the end is at bp 3297(hia stop codon)

ATTGAGCTCTTACCACTGGTAACCAACACC

PCR-3 PCR-3:5�SacI-3�SphI fragmentsA-1270-f Constant forward primer for PCR-2, the start is at bp

1270 of yadA, directly behind the yadA stop codonCGCGAGCTCTATCATTTAGAAGTTAACAA

GTCTA-Sph-r Constant reverse primer for PCR-3, the end is 569 bp

after the yadA stop codon and 30 bp after a SphI siteGTCAATACAGAGATAGAACAGCT

PCR mutagenesisMutagenesis primers

U-2308-f Forward mutagenesis primer, used for yadA-uspA1-2together with the primer A-Sph-r; start: bp 2308 ofuspA1

TTACCATCGCCCAGTAGAGCAGGTGAGCAT

A-U-1083-r Reverse mutagenesis primer, used for yadA-uspA1-2together with the primer A-Cla-f; end: bp 1083 of yadA

TGCTCTACTGGGCGATGGTAAGCTGTTTAAAGC GGCTGAA

A-U-2329-f Forward mutagenesis primer, used for yadA-uspA1-3together with the primer A-Sph-r; start: bp 2329 ofuspA1

TTGTTCCAGCCATATGGTGTGGGTGAGCATCATGTCTTATTTG

A-1104-r Reverse mutagenesis primer, used for yadA-uspA1–2,together with the primer A-Cla-f; end: bp 1104 of yadA

CACACCATATGGCTGGAACA

Standard primersA-Cla-f See PCR-1, here used for yadA-uspA1-2 and yadA-uspA1-3A-Sph-r See PCR-3, here used for yadA-uspA1-2 and yadA-uspA1-3

a Restriction sites are indicated by an underscore. For the mutagenesis primers, the overlapping part is indicated by an underscore.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

Briefly, overnight cultures of yersiniae were diluted to an OD600 of 0.1 in RPMI1640 and grown for 7 h in glass tubes without shaking at 37°C. The AA phenotypewas detected as the sedimentation of bacterial clumps and clearance of themedium.

Serum resistance test. A serum resistance test was performed as describedpreviously (43). Briefly, bacteria were grown overnight in RPMI 1640 medium at37°C, pelleted by centrifugation, washed in PBS-MgCl2 (5 mM), and then incu-bated at 37°C in 50% human serum pooled from healthy blood donors (labora-tory personnel). Surviving bacteria were defined as the CFU determined afterplating out serial dilutions on LB-agar after 0 and 90 min. The CFU counts of thebacterial inputs at time zero were defined as 100% survival. The statisticalsignificance was determined by using the Student t test.

Mouse virulence test. Virulence tests were carried out as described previously(43). Bacteria were grown for 18 h at 27°C and diluted to the appropriateinfectious dose. Groups of five BALB/c mice (6 to 8 weeks old, female) wereinfected with Y. enterocolitica WA derivatives, each harboring the pYV virulenceplasmid with a different yadA hybrid gene. For intravenous or intraperitonealinfection, 5 104 bacteria were injected into the tail vein (intravenously) or intothe abdomen (intraperitoneally), respectively. For peroral infection, 109 bacteriawere administered intragastrically (animal licensing committee permission no.209.1/211-2531-105/03). At the indicated day after infection, mice were sacri-ficed, the small intestine was washed with 5 ml of ice-cold PBS, and the Peyer’spatches, spleens, and livers were homogenized in 1 ml of PBS. The quantity ofyersiniae in the intestinal content and organs was determined by plating out 0.1ml of serial dilutions of the homogenates on LB-agar plates supplemented withthe appropriate antibiotics [nalidixic acid-kanamycin for WA(pYV-O8-A0) andnalidixic acid-spectinomycin for all other strains] and counting the CFU. Fivecolonies from every experiment were tested for the presence of the correspond-ing plasmid.

RESULTS

Construction of yadA hybrid genes in Y. enterocolitica sero-type O:8. The most homologous region between Oca familymembers is localized in their C-terminal TLD, as could beshown by sequence alignment and crystal structure studies forYadA and Hia (26, 56). This TLD can be separated into aproximal linker domain, which consists of three N-terminalheptamer repeats and which forms a left-handed alpha-helicalcoiled-coil, followed by a small C-terminal hairpin-loop, andthe distal beta-barrel domain of four antiparallel transmem-brane beta-sheets (Fig. 1A and B). To replace the codons of

the predicted TLD of the yadA gene (i.e., codons 334 to 422)with the corresponding TLDs of either the uspA1 gene (codons742 to 832), the eibA gene (codons 306 to 392), or the hia gene(codons 1009 to 1098), a PCR-based strategy was used (Fig.1C). The introduction of a SacI-site between the fragmentsPCR-1 and PCR-2 resulted in two codon changes leading totwo amino acid substitutions in YadA(D332L, H333E). There-fore, to rule out an impact of this exchange on YadA functiona corresponding mutant yadA(D332L, H333E) gene was alsoconstructed. For expression studies and further functionalanalysis, the chimeric yadA genes were transferred into Y.enterocolitica WA(pYVO8-A-0), harboring the virulence plas-mid pYVO8-A-0 (deleted yadA gene) and integrated into pYVby using the �pir suicide vector pGP704 (see Table 1).

The YadA passenger domain is translocated across the OMand forms an oligomer on the bacterial surface by UspA1,EibA, and Hia TLDs. Previously, we have shown that the C-terminal 91 aa of YadA (aa 332 to 422), namely, the linker andmembrane anchoring region (comprising the TLD), are in-volved in translocation and oligomerization of its passengerdomain (YadA, aa 26 to 331) (26). To test the hypothesis thatthe homologous TLDs of related Oca family members UspA1,EibA, and Hia are also capable of mediating translocationand oligomerization of the YadA passenger domain, we con-structed YadA-UspA1, YadA-EibA, and YadA-Hia fusionproteins. Production of the YadA hybrid proteins was verifiedin whole-cell lysates of mid-logarithmic-phase cultures byWestern blotting with MAb 8D1 (data not shown).

To test whether these YadA hybrids were also localized onthe bacterial surface in comparable amounts, an IFA, anELISA of whole, unfixed Yersinia cells, and Western blotting ofYersinia OM preparations were performed with MAb 8D1(Fig. 2 and Fig. 3A, IFA results not shown).

The detection of surface exposure of YadA(D332L,H333E), YadA-EibA, and YadA-Hia by IFA and ELISA usingthe respective WA strains as antigen and anti-YadA MAb 8D1

FIG. 2. Comparison of surface expression of wild-type YadA, YadA(D332L, H333E), YadA-EibA, YadA-Hia, and YadA-UspA1 on whole,unfixed Yersinia WA(pYV-O8) cells by an ELISA with MAb 8D1. The asterisk indicates the highly significantly (P � 0.01) diminished surfaceexpression of YadA-UspA1 compared to wild-type YadA. YadA neg., YadA-negative strain WA(pYVO8-A-0); YadA, strain carrying wild-typeYadA WA(pYVO8-A-1).



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

as the primary antibody was positive. However, the WA strainexpressing the yadA-uspA1 gene showed significantly lowerELISA values than did the other strains (Fig. 2), suggesting alower amount of surface exposure of YadA-UspA1. This couldbe confirmed by the immunoblotting of OM preparations usingMAb 8D1 (Fig. 3A). Alternatively, it is also conceivable thatchanges in the YadA stalk structure due to the hybrid anchordomain of UspA1 lead to decreased binding of the MAb 8D1-recognized epitope within the stalk. At 37°C, wild-type YadAcharacteristically forms oligomers in SDS-PAGE, which disin-

tegrate partially to the YadA monomer after the sample isboiled for 10 min at 100°C or completely after treatment with8 M urea. The YadA(D332L, H333E) control constructshowed disintegration behavior identical to that of wild-typeYadA. Interestingly, neither boiling (Fig. 3A) nor treatmentwith 8 M urea (data not shown) led to disintegration of theoligomeric YadA-EibA and YadA-Hia bands, whereas YadA-UspA1 completely disintegrated to its monomeric form at100°C. This implies that the TLDs of UspA1, EibA, and Hiadetermine the oligomeric stability of the YadA hybrid protein.To gain further insights into the structural features and thefolding state of the YadA hybrid proteins, we checked proteaseaccess to YadA hybrids by treatment of yersiniae with trypsin(ranging from 0.25 to 250 �g/ml). A total of 250 �g of tryp-sin/ml resulted in complete proteolysis of the YadA passengerdomain (negative MAb 8D1 immunoblot [data not shown]),whereas 2.5 �g of trypsin/ml led to truncated YadA and YadAhybrid proteins (Fig. 4, see the double bands of monomericYadA and YadA-UspA1 after boiling [Fig. 4B]). This ap-proach demonstrates that, in their oligomeric form, all YadAhybrids showed a major truncation approximately comparableto that of wild-type YadA, although there were slight differ-ences in the trypsin cleavage patterns of YadA-EibA andYadA-Hia and thus in trypsin sensitivity.

In summary, it could be established that the TLDs of EibA,Hia, and UspA1 were capable of translocating efficiently theheterologous passenger domain of YadA to the bacterial sur-face. However, the heat stability of the trimeric form of theYadA hybrids was significantly different, with YadA-EibA andYadA-Hia forming more stable and with YadA-UspA1 form-ing less stable trimers than the wild-type YadA.

Linker and membrane anchor domain of UspA1 form acoherent oligomerizing translocation module. Next, we studiedthe impact of the linker domain and its hairpin-loop region onthe autotransport capacity of the TLD of UspA1 by replacingthese central luminal domains with those of the YadA TLD.YadA-UspA1-3 was constructed by replacing the beta-barreldomain of YadA, i.e., the last 54 aa, with the beta-barreldomain of UspA1. An additional construct YadA-UspA1-2with replaced beta-barrel domain and 7-aa hairpin-loop ofYadA with the corresponding sequence of UspA1 (i.e., the last61 aa of YadA) was also generated to determine whether thecognate proximal UspA1 coiled-coil region of the linker do-main is necessary for the coherence of the UspA1 TLD mod-ule. After these constructs were introduced into Yersinia andtheir expression was induced at 37°C, we could not detectYadA-UspA1-2 or YadA-UspA1-3 in the OM (Fig. 3B). Inaddition, we checked culture supernatants for released YadAor YadA hybrids and could only detect tiny amounts from 100ml of culture broth by immunoblotting in all samples, indicat-ing similar stable membrane insertion (data not shown). Fromthis we conclude that the TLD requires for autotransport func-tion the beta-barrel domain together with its cognate hairpin-loop and coiled-coil linker domain, suggesting a close adaptationof these three domains.

YadA TLD-hybrid proteins show comparable adhesive ca-pability as wild-type YadA. The YadA passenger domain con-tains an N-terminal binding module for ECM proteins, mam-malian cells, and bacterial AA (43, 49, 50). The phenotype AAhas been defined as the formation of bacterial aggregates or

FIG. 3. Expression, OM localization, and stability of high-molecu-lar-weight complexes of controls YadA negative, YadA positive, andYadA(D332L, H333E) and of YadA-hybrid proteins YadA-UspA1,YadA-EibA, and YadA-Hia (A) and of three different YadA-UspA1hybrid proteins: YadA-UspA1, YadA-UspA1-2, and YadA-UspA1-3(B). OM fractions were prepared from Yersinia WA strains harboringthe gene for the corresponding YadA-hybrid protein on their pYVvirulence plasmids. Strains were grown at 37°C for 6 h before OMpreparation, and 8 �g of each sample was solubilized in sample buffereither for 60 min at 37°C or for 10 min at 100°C, separated by SDS-PAGE, transferred to nitrocellulose sheets, and probed with MAb8D1. The positions of molecular size markers are shown on the left inkilodaltons.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

clumps, which are formed by YadA producing yersiniae duringgrowth in cell culture medium at 37°C (47). As shown previ-ously by electron microscopy, this process is mediated by sur-face-exposed YadA molecules, which lead to zipper-like inter-bacterial interactions and require a high YadA surface densityand probably lollipop-like structures (16, 23, 50). The exchangeof only two amino acid residues (H156Y and H159Y) in thismodule could be shown to abolish collagen and epithelial celladherence, which underlines the sensitivity of this module forstructural changes (43). In addition, Cotter et al. recentlyshowed that the adhesive capability of this region requires atrimerized passenger domain (13). Therefore, the AA, colla-gen type I, and HEp-2 cell adherence of Y. enterocolitica WA-314 producing either YadA-UspA1, YadA-EibA, YadA-Hia,YadA(D332L, H333E), or wild-type YadA were compared. Allof these strains showed a highly significantly (P � 0.01) en-hanced binding to immobilized collagen type I or HEp-2 cellscompared to the YadA-negative strain (Fig. 5). Although theseresults suggest an exposed and functional YadA head domain,the AA test showed that the YadA-UspA1-producing strainwas AA negative in contrast to the other strains (data notshown). In summary, the TLD domains do not affect collagenor cell binding of YadA chimera strains. However, these ad-hesive capabilities could be separated from the AA trait, sug-gesting differences in the head structure between YadA-UspA1 and the other chimeric YadAs or wild-type YadA.

The YadA TLD contributes to serum resistance. Anotherimportant virulence-associated function of YadA is its abilityto mediate resistance to the bactericidal activity of humanserum (7, 38, 42). Previously, we could demonstrate that serumresistance is not strictly dependent on the head or neck regionof YadA, since deletions of either or both of these two regionsdid not result in serum-mediated killing of yersiniae. In addi-tion, while the stalk region is thought to be an importantcontributor to serum resistance, it is not essential for this

phenomenon, since an in-frame deletion of the first four 15-mer repeats of the stalk region yielded a serum-resistant phe-notype (42). Therefore, we hypothesized that the TLD ofYadA could contribute significantly to bacterial survival inhuman serum. We therefore tested the Yersinia strains carryingthe different YadA anchor-hybrid genes for survival in 50%human serum. The results show that the exchange of the YadATLD with either that of EibA, Hia, or UspA1 leads to asignificant loss of Yersinia survival in human serum (Table 3).YadA-EibA or YadA-Hia producing yersiniae appeared to bemoderately serum resistant (no significant difference betweenboth strains [P � 0.1]), whereas the YadA-UspA1 Yersiniastrain was as serum sensitive as the YadA minus strain (no sig-nificant difference [P � 0.9]). As expected, the YadA(D332L,H333E) control strain was comparable in serum resistance towild-type YadA strain WA(pYVO8-A-1) (no significant differ-ence [P � 0.6]). These results demonstrated that the TLDs aredirectly or indirectly involved in serum resistance.

The YadA TLD is necessary for Y. enterocolitica virulence inoral, intraperitoneal, and intravenous BALB/c mouse infectionmodels. To elucidate the importance of the YadA TLD to Y.enterocolitica virulence in a BALB/c mouse model, we infectedgroups of five mice orally, intraperitoneally, and intravenouslywith WA-strains producing the different YadA-hybrid proteinsand compared them to WA(pYVO8-A1) and WA(pYVO8-A0) strains. Five days after peroral infection with 109 bacteriaand 2 and 4 days after intraperitoneal and intravenous infec-tion with 5 104 bacteria, respectively, mice were sacrificed,and the numbers of CFU in the organs were determined. Forall three routes of infection, the WA strains producing YadAhybrid proteins showed a highly significant attenuation (Fig. 6).After peroral infection, in comparison to the control WA-(pYVO8-A1) strain, only ca. 0.1% of the WA(pYVO8-YadA-EibA) and WA(pYVO8-YadA-Hia) strains could still be de-tected in the small intestine and Peyer’s patches, whereas

FIG. 4. Protease sensitivity assay of Y. enterocolitica WA-314 strains carrying YadA and YadA hybrid constructs. Strains were grown at 37°Cfor 6 h and 107 bacteria were submitted to a 60 min tryptic digest with 2.5 �g of trypsin/ml, subsequently solubilized in sample buffer for 60 minat 37°C (A) or 100°C (B), separated by SDS-PAGE, and probed with MAb 8D1. YadA neg., YadA-negative strain WA(pYVO8-A-0); YadA pos.,strain carrying wild-type YadA WA(pYVO8-A-1); �, trypsin added; �, no trypsin added. The positions of molecular size markers are shown onthe left in kilodaltons.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

WA(pYVO8-YadA-UspA1) was completely undetectable.With the peroral route of infection almost no yersiniae pro-ducing YadA-hybrid proteins could be detected in the spleenor liver. In the intraperitoneal and intravenous infection ex-

periments WA(pYVO8-A1) efficiently colonized the spleenand liver with a 100-fold increase of CFU from day 2 to day 4,while yersiniae producing YadA-hybrid proteins showed a con-siderably reduced colonization of the spleen and liver at day 2,

FIG. 5. (A) Type I collagen adherence of Y. enterocolitica strains producing YadA or the YadA hybrid proteins as indicated. Collagen coatingconcentrations: f, 20 �g/ml; �, 2 �g/ml. Yersinia adherence was determined by a YadA-specific immunoassay. (B and C) HEp-2 cell adherence of Y.enterocolitica strains producing YadA or the YadA hybrid proteins, determined by CFU per well (values are the averages of triplicate samples, with theranges indicated, and reflect similar results from several experiments) (B) or by microscopic counting of cell-associated yersiniae (average number ofyersiniae per cell obtained from 30 randomly selected cells, with the ranges indicated) (C) (see Materials and Methods). Highly significant differencesin these experiments are indicated by an asterisk for the difference between the YadA negative strain and the YadA wild-type strain, which are alsorepresentative for the differences between the YadA-negative strain and each of the YadA hybrid-producing strains (P � 0.01).



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

which was even more diminished after 4 days, resembling aprogressive clearance of infection. In all infection experimentsthe strain harboring the construct control YadA(D332L,H333E) yielded CFU counts comparable to those obtainedwith strain WA(pYVO8-A1) (data not shown). The presenceof the recombinant plasmids during mouse infection waschecked by PCR. From each strain five colonies were reiso-lated from mouse organs and found to be pYV positive in allcases.

DISCUSSION

Recently, crystallization and X-ray structure determinationexperiments of both the YadA and Hia C-terminal regionsrevealed a trimeric beta-barrel through which the coiled-coillinker region protrudes and could therefore confirm formerbiochemical structure predictions (26, 56). In the presentstudy, we constructed hybrid proteins consisting of differentOca family TLDs (i.e., a linking region and the transmembranebeta-barrel region) and the YadA passenger domain to addresstwo issues. First, we wanted to find proof for our assumptionthat the TLD is an autonomous functional translocator unit byexchanging the YadA TLD with related TLDs of Oca familymembers. Second, we wanted to reveal the contribution of theTLDs to serum resistance and virulence in the mouse.

All three constructed YadA-hybrid proteins were translo-cated across the OM and exposed their trimeric YadA passen-ger domain, as shown by detection with the YadA MAb 8D1.However, the YadA-UspA1 hybrid protein showed ca. 20%less MAb 8D1 reactivity, as demonstrated by ELISA and im-munoblotting data, suggesting less surface exposure in com-parison to wild-type YadA. In spite of this slight difference itcan be concluded that the TLDs of YadA, EibA, Hia, andUspA1 are able to translocate the YadA passenger domain,which means that they can replace each other without a sig-nificant loss of autotransporter function. Upon comparing theamino acid sequence of the TLD regions of EibA, Hia, andUspA1 with that of YadA, we found homologies of only 44, 23,and 18%, respectively. In spite of this low degree of related-ness, YadA passenger domain translocation was efficient, in-dicating that the TLDs had similar structures. This finding is inaccordance with crystal structure studies on the beta-barrels ofmonomeric autotransporters NalP and EspP, which showedalmost superimposable structures by a homology of only 15%(5, 6, 36). Since the two independently analyzed crystallo-graphic structures of YadA and Hia membrane anchors also

showed a high degree of similarity (26, 56), we conclude fromour results that processes of membrane insertion and passen-ger domain translocation should be very similar and conservedin the Oca protein family.

Recently, the involvement of Omp85/YaeT in autotrans-porter assembly in the OM has been described, suggesting thatC-terminal sequences of OM proteins might possess species-specific recognition sites for Omp85/YaeT, an effect that wasobserved when trying to express meningococcal porin PorA inE. coli (41). Considering the involvement of Omp85/YaeT, ourresults with YadA-hybrid proteins are interesting, because wehave not found strong evidence for species specificity in thefunction of trimeric autotransport. Possibly, this species spec-ificity of Omp85/YaeT observed for porin proteins does notapply to Oca family proteins.

To study the promiscuous autotransporter capability of Ocafamily TLDs in more detail, we constructed two additionalYadA-UspA1 hybrids, YadA-UspA1-3 and YadA-UspA1-2,by replacing the entire UspA1 linker region or only its proxi-mal coiled-coil part by the homologous YadA region, respec-tively. In contrast to the functional chimeric YadA-UspA1autotransporter, the YadA-UspA1-3 and YadA-UspA1-2 chi-meras were not detectable on the bacterial surface, in the OMfraction, or in bacterial whole-cell lysates. Previous work hasshown that a full-length YadA with specific deletions of eitherthe proximal coiled-coil or distal hairpin-loop segment of thelinker region is not functionally expressed and cannot be de-tected in the cytosol or the membrane fraction (42). Further-more, the crystallographic structure of the YadA C terminusdisplayed the trimeric alpha-helical coiled-coil traversing thebeta-barrel pore, indicating a structural and functional unit ofthe TLD (56). On the other hand, however, it could also beshown in previous work that the hairpin-loop region of thelinker alone is sufficient to allow oligomerization and OMinsertion of a FLAG-tagged truncated YadA membrane an-chor (42). The results of the three YadA-UspA1 hybrid pro-teins demonstrate that the UspA1 beta-barrel absolutely re-quires its cognate UspA1 linker region for translocation of theYadA passenger domain. This again indicates that the linkerregion and the four transmembrane beta-barrel strands form acoherent autotransporter module, i.e., a functional TLD, withtranslocation competence for foreign passenger proteins. Thisdemonstrates also that the function of TLDs is sensitive tochanges in amino acid sequence, as has also been shown byGrosskinsky et al.; in that study, the exchange of the highlyconserved glycine residue G389 in the YadA TLD led to asevere impairment of YadA translocation (16). Furthermore,Meng et al. could show that amino acid exchanges in thehairpin loop of the Hia TLD led to changes in structuralstability (26).

For Oca family members a temperature-sensitive oligomer-ization stability is known, which can be demonstrated by SDS-PAGE: UspA1 depolymerizes completely after the OM sampleis boiled for 5 min (12), whereas for Hia harsh formic acidpretreatment is required for disintegration of the trimers inSDS-PAGE (13). The EibA oligomer has also been shown toremain completely stable after boiling (46). Interestingly, thisoligomer stability could also be observed for the correspondingYadA chimeras. Although, the YadA oligomer could be sep-arated into trimer and monomer bands after boiling and SDS-

TABLE 3. Survival of WA strains in 50% pooled normal humanserum at 37°C

StrainMean % survival �SD after 90 min of

incubationaP

YadA, negative 3 � 22 �0.9, �0.005, �0.05, �0.2YadA, wild type 229 � 67 �0.6, �0.005YadA(D332L, H333E) 251 � 30 �0.6YadA-EibA 84 � 47 �0.1, �0.05YadA-Hia 28 � 24 �0.1, �0.2YadA-UspA1 1 � 13 �0.9

a A 100% value corresponds to the initial bacterial input determined by CFU.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

PAGE, the YadA-UspA1 hybrid disintegrated completely intoits monomeric form. Strikingly, YadA-EibA and YadA-Hiahybrids completely remained in their oligomeric form afterboiling. Treatment of the samples with 8 M urea disintegratedYadA and YadA-UspA1 completely but not the YadA-EibAand YadA-Hia hybrids (results not shown). From this we con-

clude that the TLDs of these trimeric autotransporters deter-mine the heat stability of the oligomeric form. The oligomersalso remained stable after a mild tryptic digestion, indicatingthat oligomerization is controlled by the TLDs and not by thepassenger domain. Recently, it was demonstrated for Oca fam-ily member Hia that a stably oligomerized passenger domain is

FIG. 6. Virulence of Y. enterocolitica serotype O:8 strains WA(pYVO8-A-0) (YadA-negative virulence plasmid carrying strain), WA(pYVO8-A-1) (YadA wild type), WA(pYVO8-YadA-UspA1), WA(pYVO8-YadA-EibA), and WA(pYVO8-YadA-Hia) in orally (A), intravenously (B),and intraperitoneally (C) infected groups of five BALB/c mice infected with 1 109 CFU (A) or 5 104 CFU (B and C) of bacteria. After 5 days(A) or 2 and 4 days (B and C), the CFU of bacteria in the small intestine (SI), Peyer’s patches (PP), spleen (S), and liver (L) (A) or in the spleen(S) and liver (L) (B and C) were determined. The data are means � the standard deviations. wt, wild type.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

required for cell adhesion (13). Therefore, yersiniae producingYadA chimeras were tested for adherence capability to colla-gen and HEp-2 cells. Interestingly, the YadA hybrids showedno significant differences in the two adherence tests. Theseresults do not exclude that the YadA hybrid proteins mightdiffer in their passenger domain structure (e.g., in their packingdensity). Meng et al. could show that amino acid exchanges inthe hairpin loop of the Hia linker region lead to changes instructural stability of Hia but not in adhesion ability for cells orECM (26). Furthermore, bacterial AA, a YadA-dependentphenotype, could not be observed for the YadA-UspA1 hybridproducing yersiniae. The ELISA data and the immunoblotanalysis indicated slightly reduced surface concentrations ofYadA-UspA1 hybrid protein in the OM. This might suggestan impaired formation or reduced stability of the trimericYadA head structure in YadA-UspA1, which could lead tothe loss of AA.

Another feature of the YadA molecule and several otherOca family members (e.g., UspA1, UspA2, EibA, and DsrA) istheir ability to confer resistance to serum-mediated killing (38,53). However, the exact mechanism of serum resistance medi-ated by Oca family members is still unclear. For example, it waspossible to demonstrate that the passenger domains of UspA1and UspA2 are involved in the binding of complement inhib-itor factors C4BP, C3, and vitronectin, but the physiologicalrelevance of these binding activities still needs to be fully elu-cidated (3, 32, 33). Also, the binding of the complement inhib-itor factor H through YadA has been under debate, but untilnow these findings could not be corroborated (7, 10). In con-trast to EibA, the Hia protein does not confer serum resis-tance. However, a detailed analysis of EibA-mediated serumresistance is lacking. Previously, we could demonstrate that theYadA head-neck region is not necessary for conferring serumresistance, but we were not able to exactly localize it to thestalk or TLD of YadA (42). Therefore, we presumed that theYadA TLD could be important for this process, since beta-barrel pores from other OM proteins have already been shownto be involved in serum resistance, such as, for example, Ail,another Yersinia OM protein, where probably complement in-hibiting factors such as factor H or C4b-binding protein bind tothese loops (27). Interestingly, all strains expressing YadAhybrid genes showed reduced resistance to 50% normal humanserum. This supports our previous conclusion that the TLD ofYadA could contribute to serum resistance. Possibly, the linkerregion of YadA or the surface-exposed loops linking the trans-membrane beta-strands are involved in this phenomenon bybinding a complement inhibitor factor, such as, for example,factor H. Although the surface- exposed loops of the TLD ofthe trimeric autotransporters are shorter than those of Ail orOmpX, the contribution of TLD to serum resistance cannot beexcluded. The YadA stalk region could also be involved in thebinding of factor H or C4BP. Thus, distortion of the coiled-coilstructure of the stalk of YadA due to the fused non-YadATLD may affect the binding of complement inhibitors andfavor complement activation.

Finally, we were interested to find out whether the degree ofYadA hybrid protein-mediated serum resistance correlatedwith the degree of mouse virulence. A comparison of bacterialloads in the Peyer’s patches, spleen, and liver after peroralchallenge and in the spleen and liver after intravenous or

intraperitoneal challenge of BALB/c mice clearly showed ahighly significant attenuation of all YadA-hybrid producingstrains compared to the wild-type YadA producing WA-(pYVO8-A1). Interestingly, the chimeric YadA-UspA1 pro-ducing strain seemed to be even more attenuated than theYadA mutant strain. Although we have no convincing expla-nation for this yet, it is conceivable that chimeric YadA-UspA1transport and insertion into the OM could cause more enve-lope stress than the other YadA chimeras, which might affectthe type 3 protein secretion apparatus in contrast to the YadA-negative mutant.

In summary, nonautologous TLDs fused to the N-terminalYadA might lead to structural changes or distortions of theYadA stalk and head region with concomitant attenuation ofvirulence function. Moreover, serum resistance seems to con-tribute essentially to the virulence function of YadA in themouse model.

ACKNOWLEDGMENTS

Eric J. Hansen of the Southwestern Medical Center (Dallas) isgratefully acknowledged for the gift of the M. catarrhalis strain.

This study was supported by the Deutsche Forschungsgemeinschaft(RO1239/4-2) and the Munich Center for Integrated Protein Science.

REFERENCES

1. Abdallah, A. M., N. C. Gey van Pittius, P. A. Champion, J. Cox, J. Luirink,C. M. Vandenbroucke-Grauls, B. J. Appelmelk, and W. Bitter. 2007. TypeVII secretion: mycobacteria show the way. Nat. Rev. Microbiol. 5:883–891.

2. Aebi, C., I. Maciver, J. L. Latimer, L. D. Cope, M. K. Stevens, S. E. Thomas,G. H. McCracken, Jr., and E. J. Hansen. 1997. A protective epitope ofMoraxella catarrhalis is encoded by two different genes. Infect. Immun. 65:4367–4377.

3. Attia, A. S., S. Ram, P. A. Rice, and E. J. Hansen. 2006. Binding of vitro-nectin by the Moraxella catarrhalis UspA2 protein interferes with late stagesof the complement cascade. Infect. Immun. 74:1597–1611.

4. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A.Smith, and K. Struhl. 1989. Current protocols in molecular biology. JohnWiley & Sons, Inc., New York, NY.

5. Barnard, T. J., N. Dautin, P. Lukacik, H. D. Bernstein, and S. K. Buchanan.2007. Autotransporter structure reveals intra-barrel cleavage followed byconformational changes. Nat. Struct. Mol. Biol. 14:1214–1220.

6. Bernstein, H. D. 2007. Are bacterial “autotransporters” really transporters?Trends Microbiol. 15:441–447.

7. Biedzka-Sarek, M., R. Venho, and M. Skurnik. 2005. Role of YadA, Ail, andlipopolysaccharide in serum resistance of Yersinia enterocolitica serotype O:3.Infect. Immun. 73:2232–2244.

8. Capecchi, B., J. Adu-Bobie, F. Di Marcello, L. Ciucchi, V. Masignani, A.Taddei, R. Rappuoli, M. Pizza, and B. Arico. 2005. Neisseria meningitidisNadA is a new invasin which promotes bacterial adhesion to and penetrationinto human epithelial cells. Mol. Microbiol. 55:687–698.

9. Cascales, E., and P. J. Christie. 2003. The versatile bacterial type IV secre-tion systems. Nat. Rev. Microbiol. 1:137–149.

10. China, B., M. P. Sory, B. T. N�Guyen, M. de Bruyere, and G. R. Cornelis.1993. Role of the YadA protein in prevention of opsonization of Yersiniaenterocolitica by C3b molecules. Infect. Immun. 61:3129–3136.

11. Cianciotto, N. P. 2005. Type II secretion: a protein secretion system for allseasons. Trends Microbiol. 13:581–588.

12. Cope, L. D., E. R. Lafontaine, C. A. Slaughter, C. A. Hasemann, Jr., C. Aebi,F. W. Henderson, G. H. McCracken, Jr., and E. J. Hansen. 1999. Charac-terization of the Moraxella catarrhalis uspA1 and uspA2 genes and theirencoded products. J. Bacteriol. 181:4026–4034.

13. Cotter, S. E., N. K. Surana, S. Grass, and J. W. St Geme. 2006. Trimericautotransporters require trimerization of the passenger domain for stabilityand adhesive activity. J. Bacteriol. 188:5400–5407.

14. Cotter, S. E., N. K. Surana, and J. W. St. Geme. 2005. Trimeric autotrans-porters: a distinct subfamily of autotransporter proteins. Trends Microbiol.13:199–205.

15. Cotter, S. E., H. J. Yeo, T. Juehne, and J. W. St. Geme. 2005. Architectureand adhesive activity of the Haemophilus influenzae Hsf adhesin. J. Bacteriol.187:4656–4664.

16. Grosskinsky, U., M. Schutz, M. Fritz, Y. Schmid, M. C. Lamparter, P.Szczesny, A. N. Lupas, I. B. Autenrieth, and D. Linke. 2007. A conservedglycine residue of trimeric autotransporter domains plays a key role inYersinia adhesin A autotransport. J. Bacteriol. 189:9011–9019.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

17. Hanahan, D. 1983. Studies on transformation of Escherichia coli with plas-mids. J. Mol. Biol. 166:557–580.

18. Heesemann, J., C. Keller, R. Morawa, N. Schmidt, H. J. Siemens, and R.Laufs. 1983. Plasmids of human strains of Yersinia enterocolitica: molecularrelatedness and possible importance for pathogenesis. J. Infect. Dis. 147:107–115.

19. Heise, T., and P. Dersch. 2006. Identification of a domain in Yersinia viru-lence factor YadA that is crucial for extracellular matrix-specific cell adhe-sion and uptake. Proc. Natl. Acad. Sci. USA 103:3375–3380.

20. Henderson, I. R., F. Navarro-Garcia, M. Desvaux, R. C. Fernandez, and D.a’Aldeen. 2004. Type V protein secretion pathway: the autotransporter story.Microbiol. Mol. Biol. Rev. 68:692–744.

21. Henderson, I. R., F. Navarro-Garcia, and J. P. Nataro. 1998. The greatescape: structure and function of the autotransporter proteins. Trends Mi-crobiol. 6:370–378.

22. Ho, S. N., H. D. Hunt, R. M. Horton, J. K. Pullen, and L. R. Pease. 1989.Site-directed mutagenesis by overlap extension using the polymerase chainreaction. Gene 77:51–59.

23. Hoiczyk, E., A. Roggenkamp, M. Reichenbecher, A. Lupas, and J. Heese-mann. 2000. Structure and sequence analysis of Yersinia YadA and MoraxellaUspAs reveal a novel class of adhesins. EMBO J. 19:5989–5999.

24. Koretke, K. K., P. Szczesny, M. Gruber, and A. N. Lupas. 2006. Modelstructure of the prototypical non-fimbrial adhesin YadA of Yersinia entero-colitica. J. Struct. Biol. 155:154–161.

25. Koronakis, V., A. Sharff, E. Koronakis, B. Luisi, and C. Hughes. 2000.Crystal structure of the bacterial membrane protein TolC central to multi-drug efflux and protein export. Nature 405:914–919.

26. Meng, G., N. K. Surana, J. W. St. Geme, and G. Waksman. 2006. Structureof the outer membrane translocator domain of the Haemophilus influenzaeHia trimeric autotransporter. EMBO J. 25:2297–2304.

27. Miller, V. L., K. B. Beer, G. Heusipp, B. M. Young, and M. R. Wachtel. 2001.Identification of regions of Ail required for the invasion and serum resis-tance phenotypes. Mol. Microbiol. 41:1053–1062.

28. Miller, V. L., and J. J. Mekalanos. 1988. A novel suicide vector and its usein construction of insertion mutations: osmoregulation of outer membraneproteins and virulence determinants in Vibrio cholerae requires toxR. J.Bacteriol. 170:2575–2583.

29. Mota, L. J., and G. R. Cornelis. 2005. The bacterial injection kit: type IIIsecretion systems. Ann. Med. 37:234–249.

30. Mota, L. J., L. Journet, I. Sorg, C. Agrain, and G. R. Cornelis. 2005.Bacterial injectisomes: needle length does matter. Science 307:1278.

31. Mougous, J. D., M. E. Cuff, S. Raunser, A. Shen, M. Zhou, C. A. Gifford,A. L. Goodman, G. Joachimiak, C. L. Ordonez, S. Lory, T. Walz, A.Joachimiak, and J. J. Mekalanos. 2006. A virulence locus of Pseudomonasaeruginosa encodes a protein secretion apparatus. Science 312:1526–1530.

32. Nordstrom, T., A. M. Blom, A. Forsgren, and K. Riesbeck. 2004. The emerg-ing pathogen Moraxella catarrhalis interacts with complement inhibitor C4bbinding protein through ubiquitous surface proteins A1 and A2. J. Immunol.173:4598–4606.

33. Nordstrom, T., A. M. Blom, T. T. Tan, A. Forsgren, and K. Riesbeck. 2005.Ionic binding of C3 to the human pathogen Moraxella catarrhalis is a uniquemechanism for combating innate immunity. J. Immunol. 175:3628–3636.

34. Nummelin, H., M. C. Merckel, J. C. Leo, H. Lankinen, M. Skurnik, and A.Goldman. 2004. The Yersinia adhesin YadA collagen-binding domain struc-ture is a novel left-handed parallel beta-roll. EMBO J. 23:701–711.

35. Ochman, H., and R. K. Selander. 1984. Standard reference strains of Esch-erichia coli from natural populations. J. Bacteriol. 157:690–693.

36. Oomen, C. J., P. van Ulsen, P. Van Gelder, M. Feijen, J. Tommassen, and P.Gros. 2004. Structure of the translocator domain of a bacterial autotrans-porter. EMBO J. 23:1257–1266.

37. Pallen, M. J., R. R. Chaudhuri, and I. R. Henderson. 2003. Genomic analysisof secretion systems. Curr. Opin. Microbiol. 6:519–527.

38. Pilz, D., T. Vocke, J. Heesemann, and V. Brade. 1992. Mechanism of YadA-

mediated serum resistance of Yersinia enterocolitica serotype O3. Infect.Immun. 60:189–195.

39. Pohlner, J., R. Halter, K. Beyreuther, and T. F. Meyer. 1987. Gene structureand extracellular secretion of Neisseria gonorrhoeae IgA protease. Nature325:458–462.

40. Pukatzki, S., A. T. Ma, D. Sturtevant, B. Krastins, D. Sarracino, W. C.Nelson, J. F. Heidelberg, and J. J. Mekalanos. 2006. Identification of aconserved bacterial protein secretion system in Vibrio cholerae using theDictyostelium host model system. Proc. Natl. Acad. Sci. USA 103:1528–1533.

41. Robert, V., E. B. Volokhina, F. Senf, M. P. Bos, P. Van Gelder, and J.Tommassen. 2006. Assembly factor Omp85 recognizes its outer membraneprotein substrates by a species-specific C-terminal motif. PLoS. Biol. 4:e377.

42. Roggenkamp, A., N. Ackermann, C. A. Jacobi, K. Truelzsch, H. Hoffmann,and J. Heesemann. 2003. Molecular analysis of transport and oligomeriza-tion of the Yersinia enterocolitica adhesin YadA. J. Bacteriol. 185:3735–3744.

43. Roggenkamp, A., H. R. Neuberger, A. Flugel, T. Schmoll, and J. Heesemann.1995. Substitution of two histidine residues in YadA protein of Yersiniaenterocolitica abrogates collagen binding, cell adherence, and mouse viru-lence. Mol. Microbiol. 16:1207–1219.

44. Roggenkamp, A., K. Ruckdeschel, L. Leitritz, R. Schmitt, and J. Heesemann.1996. Deletion of amino acids 29 to 81 in adhesion protein YadA of Yersiniaenterocolitica serotype O:8 results in selective abrogation of adherence toneutrophils. Infect. Immun. 64:2506–2514.

45. Sandt, C. H., and C. W. Hill. 2000. Four different genes responsible fornonimmune immunoglobulin-binding activities within a single strain of Esch-erichia coli. Infect. Immun. 68:2205–2214.

46. Sandt, C. H., and C. W. Hill. 2001. Nonimmune binding of human immu-noglobulin A (IgA) and IgG Fc by distinct sequence segments of the EibFcell surface protein of Escherichia coli. Infect. Immun. 69:7293–7303.

47. Skurnik, M., I. Bolin, H. Heikkinen, S. Piha, and H. Wolf-Watz. 1984.Virulence plasmid-associated autoagglutination in Yersinia spp. J. Bacteriol.158:1033–1036.

48. Surana, N. K., D. Cutter, S. J. Barenkamp, and J. W. St Geme. 2004. TheHaemophilus influenzae Hia autotransporter contains an unusually shorttrimeric translocator domain. J. Biol. Chem. 279:14679–14685.

49. Tahir, Y. E., P. Kuusela, and M. Skurnik. 2000. Functional mapping of theYersinia enterocolitica adhesin YadA: identification of eight NSVAIG-S mo-tifs in the amino-terminal half of the protein involved in collagen binding.Mol. Microbiol. 37:192–206.

50. Tamm, A., A. M. Tarkkanen, T. K. Korhonen, P. Kuusela, P. Toivanen, andM. Skurnik. 1993. Hydrophobic domains affect the collagen-binding speci-ficity and surface polymerization as well as the virulence potential of theYadA protein of Yersinia enterocolitica. Mol. Microbiol. 10:995–1011.

51. Thanabalu, T., E. Koronakis, C. Hughes, and V. Koronakis. 1998. Substrate-induced assembly of a contiguous channel for protein export from Esche-richia coli: reversible bridging of an inner-membrane translocase to an outermembrane exit pore. EMBO J. 17:6487–6496.

52. Veiga, E., E. Sugawara, H. Nikaido, V. de Lorenzo, and L. A. Fernandez.2002. Export of autotransported proteins proceeds through an oligomericring shaped by C-terminal domains. EMBO J. 21:2122–2131.

53. Visser, L. G., P. S. Hiemstra, M. T. van den Barselaar, P. A. Ballieux, andR. van Furth. 1996. Role of YadA in resistance to killing of Yersinia entero-colitica by antimicrobial polypeptides of human granulocytes. Infect. Immun.64:1653–1658.

54. Voulhoux, R., M. P. Bos, J. Geurtsen, M. Mols, and J. Tommassen. 2003.Role of a highly conserved bacterial protein in outer membrane proteinassembly. Science 299:262–265.

55. Voulhoux, R., and J. Tommassen. 2004. Omp85, an evolutionarily conservedbacterial protein involved in outer-membrane-protein assembly. Res. Micro-biol. 155:129–135.

56. Wollmann, P., K. Zeth, A. N. Lupas, and D. Linke. 2006. Purification of theYadA membrane anchor for secondary structure analysis and crystallization.Int. J. Biol. Macromol. 39:3–9.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

contribution of trimeric autotransporter c-terminal domains of … · yada-passenger domain (bp 1...

Documents