Conservation Conservation GeneticsGenetics

By:By:Capaccio, Rose Capaccio, Rose Foschetti, OliviaFoschetti, OliviaHowland, YvetteHowland, Yvette

Shahmehri, NadiaShahmehri, NadiaStrazzera, JosephineStrazzera, JosephineYounus, MuhammadYounus, Muhammad

Conservation Biology + Genetics = Conservation Biology + Genetics = Conservation GeneticsConservation Genetics

Conservation biology is the study of individual species Conservation biology is the study of individual species and populations that have been impacted by various and populations that have been impacted by various human behaviors such as habitat loss and exploitation human behaviors such as habitat loss and exploitation and/or environmental changes and/or environmental changes (learn.genetics.utah.edu) and finding ways to maintain (learn.genetics.utah.edu) and finding ways to maintain and restoreand restore biodiversity biodiversity..

Conservation genetics is a mixture of ecology, Conservation genetics is a mixture of ecology, molecular biology, population genetics, mathematical molecular biology, population genetics, mathematical modeling and evolutionary systematics modeling and evolutionary systematics (learn.genetics.utah.edu). (learn.genetics.utah.edu).

Once scientists understand the genetic relationships of Once scientists understand the genetic relationships of an organism, they may proceed with an appropriate an organism, they may proceed with an appropriate management technique to preserve the biological and management technique to preserve the biological and genetic diversity of a species.genetic diversity of a species.

http://learn.genetics.utah.edu/archive/conservation/index.html

Conservation GeneticsConservation GeneticsFrankham et al. 2002. Introduction to Conservation Genetics. Frankham et al. 2002. Introduction to Conservation Genetics. Cambridge Univ. PressCambridge Univ. Press

Conservation genetics is the application of genetics to Conservation genetics is the application of genetics to preserve species as dynamic entities capable of coping preserve species as dynamic entities capable of coping with environmental changewith environmental change Genetic management of small populationsGenetic management of small populations Resolution of taxonomic uncertaintiesResolution of taxonomic uncertainties Identifying and defining units of conservation within Identifying and defining units of conservation within

and between speciesand between species Use of genetic information for wildlife forensicsUse of genetic information for wildlife forensics

Address genetic factors that affect extinction risk and Address genetic factors that affect extinction risk and genetic management to minimize or mitigate those risksgenetic management to minimize or mitigate those risks

Importance / Goals of Importance / Goals of Conservation GeneticsConservation Genetics

Genetics is a valuable resource towards conservation Genetics is a valuable resource towards conservation by reducing the amount of time spent of conserving the by reducing the amount of time spent of conserving the wrong population or on a population that may not be wrong population or on a population that may not be endangered (learn.genetics.utah.edu). endangered (learn.genetics.utah.edu).

Conservation genetics provides new information about Conservation genetics provides new information about the diversity among the individuals in a population.the diversity among the individuals in a population.

It is a tool to help maintain and restore population It is a tool to help maintain and restore population variability.variability.

Without Without genetic diversitygenetic diversity, biodiversity may be lost., biodiversity may be lost.

5 broad categories of conservation genetics publications5 broad categories of conservation genetics publications(Allendorf and Luikart)(Allendorf and Luikart)

Management and reintroduction of captive populations, Management and reintroduction of captive populations, and the restoration of biological communitiesand the restoration of biological communities

Description and identification of individuals, genetic Description and identification of individuals, genetic population structure, kin relationships, and taxonomic population structure, kin relationships, and taxonomic relationshipsrelationships

Detection and prediction of the effects of habitat loss, Detection and prediction of the effects of habitat loss, fragmentation and isolationfragmentation and isolation

Detection and prediction of the effects of hybridization Detection and prediction of the effects of hybridization and introgressionand introgression

Understanding the relationships between adaptation or Understanding the relationships between adaptation or fitness and the genetic characters of individuals or fitness and the genetic characters of individuals or populationspopulations

Conservation Genetics

Evolutionary genetics Taxonomic uncertainties

Introgression

Population structure & fragmentation

OutbreedingSmall populations

Forensics

Understanding species biology

Loss of genetic diversity Mutational accumulationInbreeding

Reproductive fitness

Identify mgmt units

Reintroduction

Adaptation to captivityWild Captive

Genetic managementExtinction

Use of Conservation Use of Conservation GeneticsGenetics

1. 1. Habitat DestructionHabitat Destruction A population is targeted by conservation A population is targeted by conservation

managers when their habitat is or may be managers when their habitat is or may be destroyed by human interference such as destroyed by human interference such as building homes or natural phenomena such building homes or natural phenomena such as hurricanes.as hurricanes.

2. 2. Change in Population SizeChange in Population Size When a population is reduced in size, genetic When a population is reduced in size, genetic

diversity may be adversely affected. The diversity may be adversely affected. The smaller the population, the more likely to be smaller the population, the more likely to be susceptible to random or unexpected events.susceptible to random or unexpected events.

http://learn.genetics.utah.edu/archive/conservation/when.html

11 major genetic issues in conservation biology11 major genetic issues in conservation biology(Frankham et al.)(Frankham et al.)

Inbreeding and inbreeding Inbreeding and inbreeding depressiondepression

Loss of genetic diversity and Loss of genetic diversity and adaptive potentialadaptive potential

Population fragmentation and Population fragmentation and loss of gene flowloss of gene flow

Genetic drift becomes more Genetic drift becomes more important than natural important than natural selection as main evolutionary selection as main evolutionary forceforce

Accumulation of deleterious Accumulation of deleterious mutations (lethal equivalents)mutations (lethal equivalents)

Adaptation to captivity and Adaptation to captivity and consequences for captive consequences for captive breeding and reintroductionsbreeding and reintroductions

Taxonomic uncertainties Taxonomic uncertainties masking true biodiversity or masking true biodiversity or creating false biodiversitycreating false biodiversity

Defining ESUs and Defining ESUs and management units within management units within speciesspecies

Forensic analysesForensic analyses Understand species biologyUnderstand species biology Outbreeding depressionOutbreeding depression

ToolsTools1. 1. Protein Protein

ElectrophoresisElectrophoresis It compares the similar It compares the similar

proteins between proteins between species found in a species found in a portion of the DNA portion of the DNA sequence.sequence.

2. 2. Chromosome AnalysisChromosome Analysis It shows the differences It shows the differences

in the number of in the number of chromosomes between chromosomes between closely related species.closely related species.

http://learn.genetics.utah.edu/archive/conservation/tools/index.html

Reduction in Gene Flow/Reduction in Gene Flow/MetapopulationMetapopulation

Gene flowGene flow is the gradual exchange is the gradual exchange of alleles between populations with of alleles between populations with the dispersal of gametes or the the dispersal of gametes or the migration of individuals.  Migration is migration of individuals.  Migration is the main route for gene flow in the main route for gene flow in animals and cross pollination and animals and cross pollination and seed dispersion in plants.seed dispersion in plants.

  

Habitat fragmentationHabitat fragmentation has also led to a decline in gene has also led to a decline in gene flow among populations of threatened or endangered flow among populations of threatened or endangered species due to the small separate colonies in which they species due to the small separate colonies in which they exhist and their connection to their remaining habitat.  exhist and their connection to their remaining habitat.  Habitat fragmentation by isolated population of species, Habitat fragmentation by isolated population of species, affects the gene flow because surviving population do affects the gene flow because surviving population do not have movement between the populations to not have movement between the populations to encourage gene flow. encourage gene flow. MetapopulationMetapopulation describes the describes the occurrence of spatially separated subpopulations with occurrence of spatially separated subpopulations with limited gene flow that results in extinction or limited gene flow that results in extinction or replacements over time.replacements over time. (W.Klug, M. Cummings, C. (W.Klug, M. Cummings, C. Spencer, M. Palladino; Spencer, M. Palladino; Essentials of Genetics; Seventh Essentials of Genetics; Seventh Edition; Edition;  Pearsom Education, Inc. 2010; pp. 514-515) Pearsom Education, Inc. 2010; pp. 514-515)

Many studies of current gene Many studies of current gene flow are aimed at understanding flow are aimed at understanding gene movement on a regional or gene movement on a regional or landscape scale. As continuous landscape scale. As continuous populations become populations become fragmented, they may assume fragmented, they may assume metapopulation dynamics, metapopulation dynamics, through extinction and through extinction and recolonization events of the recolonization events of the different fragments.  Populations different fragments.  Populations implicated in the metapopulation implicated in the metapopulation suffer genetic diversity and suffer genetic diversity and result in inbreeding depression.  result in inbreeding depression.  It is not clear whether recent It is not clear whether recent modeling approaches in modeling approaches in metapopulation biology and metapopulation biology and landscape ecology offer viable landscape ecology offer viable insight on gene movement.  insight on gene movement.  (http://www.nceas.ucsb.edu/nce(http://www.nceas.ucsb.edu/nceas-web/projects/2057/nceas-as-web/projects/2057/nceas-paper3/data/Gfpart1.html).paper3/data/Gfpart1.html).

References: (W.Klug, M. Cummings, C. Spencer, M. Palladino; Essentials of Genetics; Seventh Edition;  Pearsom Education, Inc. 2010; pp. 514-515)http://www.amjbot.org/cgi/content/full/94/1/128http://www.nceas.ucsb.edu/nceas-web/projects/2057/nceas-paper3/data/Gfpart1.html

DNA Sequence EvolutionDNA Sequence Evolution

AAGACTT -3O,OOO yrs

-20,000 yrs

-10,000 yrs

today

AGGACTC

AGGGCTCAGGATTC

AGGACTTAAGATTT

AAGATTC

AGGATTCGAGATTC

AAGGTTT

AAAGTTT

AGGACTTAAGATTT

AAGATTC AGGACTCAAGGTTT

AAAGTTT AGGGCTCAGGATTCGAGATTC AGGATTC

GlossaryGlossary

biodiversitybiodiversity – the biological variation – the biological variation represented by different plants and represented by different plants and animals animals

genetic diversitygenetic diversity – a measure of the – a measure of the possible choices of information provided possible choices of information provided by a gene by a gene

Back to slide

Back to slide

AAAGTTT AGGGCTCAGGATTCGAGATTC AGGATTC

DNA Sequence EvolutionDNA Sequence Evolution

AAGACTT

AGGACTC

AGGGCTCAGGATTC

AGGACTTAAGATTT

AAGATTC

AGGATTCGAGATTC

AAGGTTT

AAAGTTT

AGGACTTAAGATTT

AAGATTC AGGACTCAAGGTTT

AAAGTTT AGGGCTCAGGATTCGAGATTC AGGATTC

Homoplasy

Seeds of rare crop varieties, cryogenically preserved at Seeds of rare crop varieties, cryogenically preserved at the US Department of Agriculture National Seed Storage the US Department of Agriculture National Seed Storage LaboratoryLaboratory

Growth in human population over the past 2000 years Growth in human population over the past 2000 years and projected through 2100and projected through 2100

A coastal marsh in North Carolina exemplifies an A coastal marsh in North Carolina exemplifies an ecosystem with low interspecific diversityecosystem with low interspecific diversity

Phenotypic variation in seed color and markings in the Phenotypic variation in seed color and markings in the common bean (Phaseolus vulgaris) reveals high levels of common bean (Phaseolus vulgaris) reveals high levels of intraspecific diversityintraspecific diversity

The cheetah (Acinonyx jubatus)The cheetah (Acinonyx jubatus)

Change in frequencies over ten generations for two sets Change in frequencies over ten generations for two sets of alleles, A/a and B/b, in a theoretical population of alleles, A/a and B/b, in a theoretical population subject to genetic driftsubject to genetic drift

Increase in inbreeding coefficient (F) in theoretical Increase in inbreeding coefficient (F) in theoretical populations as the population size (N) decreases populations as the population size (N) decreases

The Isle Royale gray wolf (Canis lupus)The Isle Royale gray wolf (Canis lupus)

The red-cockaded woodpecker (Picoides borealis)The red-cockaded woodpecker (Picoides borealis)

Effects of bottlenecks in various populations on Effects of bottlenecks in various populations on evolutionary potential in Drosophila, as shown by evolutionary potential in Drosophila, as shown by distributions of NaCl {Table Salt} concentrations at distributions of NaCl {Table Salt} concentrations at extinctionextinction

Effect of captive-population founder number on the Effect of captive-population founder number on the probability of maintaining both A1 and A2 alleles at a probability of maintaining both A1 and A2 alleles at a locuslocus

The black-footed ferret (Mustela nigripes)The black-footed ferret (Mustela nigripes)

The Florida panther (Puma concolor coryi)The Florida panther (Puma concolor coryi)

BibliographyBibliography1. The following article is a review of conservation of genetics.1. The following article is a review of conservation of genetics.http://www.sciencedirect.com.library.esc.edu/science?_ob=MImg&_imagekey=B6TCY-4YKKK22-1-http://www.sciencedirect.com.library.esc.edu/science?_ob=MImg&_imagekey=B6TCY-4YKKK22-1-

5&_cdi=5183&_user=683075&_pii=S016895251000003X&_origin=search&_zone=rslt_list_item&_5&_cdi=5183&_user=683075&_pii=S016895251000003X&_origin=search&_zone=rslt_list_item&_coverDate=04%2F30%2F2010&_sk=999739995&wchp=dGLzVlb-coverDate=04%2F30%2F2010&_sk=999739995&wchp=dGLzVlb-zSkWb&md5=9d5e6caeb47dee13e1b235a80583303a&ie=/sdarticle.pdfzSkWb&md5=9d5e6caeb47dee13e1b235a80583303a&ie=/sdarticle.pdf

Ouborg, N., Pertoldi, C., Loeschcke, V., Bijlsma, R., & Hedrick, P. (2010). Conservation genetics in Ouborg, N., Pertoldi, C., Loeschcke, V., Bijlsma, R., & Hedrick, P. (2010). Conservation genetics in transition to conservation genomics . transition to conservation genomics . Trends in GeneticsTrends in Genetics, , 2626(4), 177-187.(4), 177-187.

  2. This article is a review of  the challenges and opportunities faced in conservation genetics from 2. This article is a review of  the challenges and opportunities faced in conservation genetics from

management to breeding systems.management to breeding systems.http://www.sciencedirect.com.library.esc.edu/science?_ob=MImg&_imagekey=B6V5X-508FKVH-1-http://www.sciencedirect.com.library.esc.edu/science?_ob=MImg&_imagekey=B6V5X-508FKVH-1-

2&_cdi=5798&_user=683075&_pii=S000632071000234X&_origin=search&_zone=rslt_list_item&_2&_cdi=5798&_user=683075&_pii=S000632071000234X&_origin=search&_zone=rslt_list_item&_coverDate=09%2F30%2F2010&_sk=998569990&wchp=dGLzVlb-coverDate=09%2F30%2F2010&_sk=998569990&wchp=dGLzVlb-zSkWb&md5=3b982b4fc9aa31d0367f2aadc8d457c5&ie=/sdarticle.pdfzSkWb&md5=3b982b4fc9aa31d0367f2aadc8d457c5&ie=/sdarticle.pdf

Frankham, R. (2010). Challenges and opportunities of genetic approaches to biological conservation. Frankham, R. (2010). Challenges and opportunities of genetic approaches to biological conservation. Biological ConservationBiological Conservation, , 143143(9), 1919-1927.(9), 1919-1927.

    3. The following website  is about “The AMNH Center for Conservation Genetics (ConGen) employs 3. The following website  is about “The AMNH Center for Conservation Genetics (ConGen) employs

cutting-edge techniques in genetics, molecular biology, population biology, molecular ecology, and cutting-edge techniques in genetics, molecular biology, population biology, molecular ecology, and forensics to identify and ameliorate genetic threats to endangered species and to develop and forensics to identify and ameliorate genetic threats to endangered species and to develop and support conservation strategies for retaining genetic diversity.”support conservation strategies for retaining genetic diversity.”

http://research.amnh.org/genomics/Programs/Conservation-Geneticshttp://research.amnh.org/genomics/Programs/Conservation-Genetics

4. Conservation Genetics By Kris Hundertmark 4. Conservation Genetics By Kris Hundertmark

5. Essentials of Genetics (7th Edition) ISBN: 03216186965. Essentials of Genetics (7th Edition) ISBN: 0321618696