Journal of Virological Methods 117 (2004) 75–80

Comparison of porcine circovirus type 2 load in serum quantified by a realtime PCR in postweaning multisystemic wasting syndrome and porcine

dermatitis and nephropathy syndrome naturally affected pigs

Alex Olveraa, Marina Sibilaa, Maria Calsamigliaa,∗, Joaquim Segalésa,b, Mariano Domingoa,b

a Centre de Recerca en Sanitat Animal, Campus Universitari de Bellaterra, Universitat Autònoma de Barcelona, 08193 Bellaterra, Spainb Departament de Sanitat i d’Anatomia Animals, Facultat de Veterinaria, Universitat Autònoma de Barcelona, 08193 Bellaterra, Spain

Received 10 September 2003; received in revised form 3 December 2003; accepted 4 December 2003

Abstract

Postweaning multisystemic wasting syndrome (PMWS) diagnosis is based on the presence of characteristic histopathological lymphoidlesions and porcine circovirus type 2 (PCV2) within these lesions. Previous studies indicate that PCV2 load is higher in PMWS affected thanin PCV2 infected, healthy pigs. On the other hand, PCV2 has been suggested to play a role in porcine dermatitis and nephropathy syndrome(PDNS) pathogenesis. This study describes a new TaqMan© real time PCR assay and its use to quantify viral load in serum samples. Serumviral loads were related with different degrees of PMWS characteristic lesions and PDNS cases. DNA extracted from serum samples from75 animals with mild, moderate and severe PMWS lesions and 12 animals with PDNS was used as template. PCV2 DNA was quantifiedin 69 of 75 PMWS cases and in 11 of 12 PDNS cases. Significant differences in PCV2 load were observed between animals with severe,moderate and mild PMWS lesions, although variability within each group was high, probably due to heterogeneity in disease progression.These results suggest that high viral load is a major feature of PMWS affected pigs. PDNS affected animals had lower PCV2 loads. Nosignificant differences in viral load were found between animals suffering from PDNS and animals with mild PMWS characteristic lesions,which were unaffected clinically.© 2004 Elsevier B.V. All rights reserved.

Keywords:PCV2; PMWS; PDNS; Real time PCR; Histopathological lesions; Viral load

1. Introduction

Porcine circovirus type 2 (PCV2) is a ubiquitous virus,member of the Circoviridae family. This un-enveloped,single-stranded circular DNA virus is considered the eti-ological agent of postweaning multisystemic wasting syn-drome (PMWS) of pigs (Allan et al., 1999; Rosell et al.,1999). The presence of compatible clinical signs, character-istic histopathological lesions in lymphoid tissues, togetherwith the detection of PCV2 within these lesions are the cri-teria to establish a PMWS diagnosis (Segalés and Domingo,2002).

PCV2 infection is widespread and may occur subclini-cally. There is a high percentage of PCV2 seropositive pigsin the swine population (Rodriguez-Arrioja et al., 2000)

∗ Corresponding author. Tel.:+34-93-581-3145;fax: +34-93-581-3142.

E-mail address:maria.calsamiglia@uab.es (M. Calsamiglia).

and viral DNA has been detected in pigs from PMWS af-fected and non-affected farms (Calsamiglia et al., 2002;Larochelle et al., 2003; Sibila et al., 2004). Therefore, the de-tection of PCV2 antibodies or viral DNA in serum samplesis non-diagnostic of PMWS, and only indicates infection.However, several studies have shown that PCV2 DNA levelsin serum are higher in PMWS affected pigs than in healthypigs (Rosell et al., 1999; Liu et al., 2000; Meehan et al., 2001;Quintana et al., 2001; Ladekjær-Mikkelsen et al., 2002;Rovira et al., 2002), suggesting that viral quantitation couldbe indicative of clinical disease. PCV2 has also been sug-gested to play a role in the pathogenesis of porcine dermati-tis and nephropathy syndrome (PDNS) (Rosell et al., 2000;Choi and Chae, 2001). The most characteristic PDNS micro-scopic lesions are a systemic necrotising vasculitis and fibri-nous glomerulitis (Segalés et al., 1998; Drolet et al., 1999),and a systemic type III hypersensitivity has been sugg-ested as the mechanism of lesion development (Helie et al.,1995). PCV2 DNA and PMWS-like microscopic lesions

0166-0934/$ – see front matter © 2004 Elsevier B.V. All rights reserved.doi:10.1016/j.jviromet.2003.12.007

76 A. Olvera et al. / Journal of Virological Methods 117 (2004) 75–80

have also been found in animals affected of PDNS (Rosellet al., 2000).

PCV2 DNA detection from serum samples is carried outwith end-point PCR techniques (Larochelle et al., 1999;Fenaux et al., 2000; Hamel et al., 2000; Mankertz et al.,2000; Kim and Chae, 2001), and viral load has been mea-sured using a competitive PCR (Liu et al., 2000) and realtime PCR (Ladekjær-Mikkelsen et al., 2002; Rovira et al.,2002). Real time PCR has the advantage over competitivePCR to be faster, more sensitive and more robust againstcontamination due to the minimal sample manipulation inclosed-tube assays.

Monitoring of viral load is an indicator of active infection,virus–host interaction, and a good marker of disease pro-gression (Mackay et al., 2002), and would provide criticalinformation on the clinical and epidemiological relevance ofPCV2 infection. Moreover, use of serum samples to monitorviral load would allow the use of the assay in live animals.

The aims of the present paper are: (1) to develop a realtime PCR that offers two advantages over quantitative PCRmethods described previously; it works under universal con-ditions (ABI Prism 7000 User’s Guide, Applied Biosystems,Foster City, CA, USA); it includes an internal amplificationcontrol to detect false negative results due to the presence ofPCR inhibitors, and (2) to use the assay to quantify serumviral loads from pigs with several degrees of PMWS char-acteristic lymphoid lesions and PDNS cases, and correlateviral load with lesions.

2. Materials and methods

2.1. Animals

Eighty-seven conventional pigs submitted to the Veteri-nary Pathology Diagnostic Service at the Veterinary Schoolof Barcelona from 1997 to 2002 were used in the study. An-imals ranging from 1 to 5 months of age were selected basedon the presence of different degrees of PMWS microscopiclesions in lymphoid tissues, PCV2 detection by in situ hy-bridisation (Rosell et al., 1999) and PDNS cases.

PMWS affected animals were divided into three cate-gories of lesion severity: mild (n = 27), moderate (n =24) and severe (n = 24). Twelve animals diagnosed asPDNS cases (Rosell et al., 2000) were also included. Of thePDNS affected animals two had no PMWS characteristiclesions, seven had mild PMWS lesions and three had mod-erate PMWS lesions.

Table 1Sequence, localisation and properties of primers and probe designed for the PCV2 real time PCR by primer express

Oligo Tm (◦C) %GC bp Sequences (5′ → 3′) Location in PCV2 genome

PCV2F 60 63 19 CCAGGAGGGCGTTGTGACT 1535→ 1553PCV2R 59 55 20 CGCTACCGTTGGAGAAGGAA 1633→ 1614PCV2S 68 52 25 AATGGCATCTTCAACACCCGCCTCT 1612→ 1592

Tm is calculated by the neighbour joining method (Primer Express v.1.5 software).

2.2. Quantitative real time PCR

2.2.1. Primer and probe designGenBank entry AF465211 was used for primer and probe

design. The Cap gene region (corresponding to nucleotides1033–1734 bp of the whole PCV2 genome) (Nawagitgulet al., 2000; Mankertz and Hillenbrand, 2001; Cheung,2003) was chosen for primer and probe design, since it hasa lower nucleotide homology with porcine circovirus type1 (PCV1) than ORF1 (∼65%) (Liu et al., 2001). Primerforward (PCV2F), reverse (PCV2R) and probe (PCV2S)(Table 1) were designed using Primer Express v.1.5 soft-ware (ABI Prism 7000 User’s Guide, Applied Biosystems,Foster City, CA, USA). Primers and probe were selectedto work under Universal conditions (ABI Prism 7000User’s Guide, Applied Biosystems, Foster City, CA, USA).Probe, located 1 bp from PCV2R, was labelled at 5′ withFAMTM (6-carboxyfluorescein) and at 3′ with TAMRATM

(6-carboxytetramethylrhodamine).As endogenous internal control (IC), pre-optimised 18S

rDNA primers and probe were used (ABI Prism 7000User’s Guide, Applied Biosystems, Foster City, CA, USA).The probe was labelled 5′ with VICTM and 3′ with MGBTM

(Minor Groove Binder). FAMTM and VICTM have differ-ent fluorescence emission wavelengths (518 and 552 nm,respectively) allowing the performance of the two amplifi-cations in multiplex PCR reaction.

2.2.2. PCV2 TaqMan real time PCR standardA PCV2 genome cloned in pCR2.1 plasmid (Invitrogen,

Carlsbad, CA, USA) and transformed inEscherichia colicompetent cells (kindly provided by Dr. Annette Mankertz)was used as a quantitation standard. The plasmid was pu-rified using a commercial kit (Qiaprep Spin Miniprep Kit,Qiagen, Valencia, CA, USA), and quantified by spectropho-tometry. PCV2 plasmid was mixed with swine DNA ex-tracted from a PCV2 PCR negative blood sample (Quintanaet al., 2001), and both DNAs brought to a final concentra-tion of 1011 plasmid copies/ml and 20�g/ml, respectively.Ten-fold dilutions of this mixture (from 109 to 104 PCV2plasmid copies/ml) were used as standard for PCV2 quanti-tation of diagnostic samples.

2.2.3. PCV2 TaqMan real time PCR reactionsReal time PCR reactions were optimised based on primer

and probe concentration selection criteria, and IC primerlimiting criteria (ABI Prism 7000 User’s Manual, AppliedBiosystems). The optimised reaction contained 900 nM of

A. Olvera et al. / Journal of Virological Methods 117 (2004) 75–80 77

each primer, 150 nM of PCV2S, 0.4�l of IC kit, 12.5�lof TaqMan Universal Master Mix (which includes amplitaqgold DNA polymerase, dNTP’s with UTP, MgCl2, ROX,Amperase UNG and buffers) and 2.5�l of template. Auto-claved nanopure water was added to bring the final volumeto 25�l. Amplification was carried out under Universal Cy-cling conditions (10 min at 95◦C, 2 min at 50◦C and 40cycles of 15 s at 95◦C, 1 min at 60◦C).

2.2.4. Sensitivity testsPCV2 real time PCR sensitivity was tested with quadru-

plicates of different templates in three different assays: (1)10-fold dilutions of the PCV2 plasmid used as standardfrom 1010 to 102 copies/ml, (2) 10-fold dilutions of PCV2cultured in PK15 cells free of PCV1 (104.4 TCID50/ml)until a dilution of 10−5.4 TCID50/ml, (3) PCV2 plasmidmixed with exogenous DNA in 10-fold dilutions. As exoge-nous DNA, calf thymus DNA (1�g/ml) and swine DNA(20�g/ml) were used. DNA from PCV2 culture in PK15cells was extracted using a commercial kit (Nucleospin®

Blood, Macherey-Nagel GmbH & Co., KG Düren, Ger-many) following manufacturer’s indications.

2.2.5. Specificity testTo test the technique’s specificity, DNA from several bac-

teria and virus isolated frequently from pigs and two porcinecell lines (Table 2) was extracted with a commercial kit(Nucleospin® Blood, Macherey-Nagel GmbH & Co., KGDüren, Germany) following manufacturer’s protocol, andused as template in quadruplicates.

2.2.6. Diagnostic samplesDNA was extracted from the selected swine sera using

a commercial kit (Nucleospin® Blood, Macherey-NagelGmbH & Co., KG Düren, Germany), and PCV2 DNA quan-tified with the previously optimised method. Reactions werecarried out in 96-well plates including sample and standardtriplicates (from 109 to 104 PCV2 plasmid copies/ml andfrom 20�g swine DNA/�l to 20× 10−6 �g/�l). A negative

Table 2List of microorganisms used to test the specificity of the real time PCR

BacteriaActinobacillus pleuropneumoniaeMycoplasma hyorhinisHaemophilus parasuis

VirusAujeszky’s disease virusPorcine parvovirusTransmissible gastroenteritis virusPorcine respiratory and reproductive syndrome virusPorcine circovirus type 1

Porcine cell linesBC21MIIVI

control was added every four samples, using autoclavednanopure water as template.

2.3. Data analyses

The ABI Prism 7000 Detection software created a stan-dard curve with the threshold cycle (Ct) values of the 10-folddilutions PCV2 plasmid (from 109 to 104 copies/ml). Thedetection software also calculated the correlation coefficient(R2) of the standard curve, standard deviations of triplicates,and the PCV2 copy number of the samples based on thestandard curve.

The reproducibility of the assay was calculated using Ctvalues of the standard curve of five runs of diagnostic sam-ples. Reproducibility was calculated as the mean coefficientof variation (CV) for Ct of the PCV2 standard inside runs (in-trassay) and between (interassay) runs (Martell et al., 1999).The method’s accuracy was measured calculating the meanR2 between runs.

PCV2 loads were log10 transformed and an ANOVA test(SAS software, SAS Institute Inc., Cary, NC, USA) wasused to correlate PDNS and PMWS lesion levels and PCV2genome quantification.

3. Results

3.1. Real time TaqMan PCR development

3.1.1. Reaction analysisAfter optimisation, only reactions accomplishing the fol-

lowing criteria (ABI Prism 7000 User’s Guide, AppliedBiosystems) were accepted: (1) standard deviation of sam-ple triplicates should be under 0.38, (2) standards curveswith an accuracy ofR2 > 0.97, (3) the reaction efficiency,measured as the slope of the standard curve, between 3.2and 3.7. Also, if any of the negative controls was positivethe run was repeated.

3.1.2. Method sensitivity and specificityThe quantitation range of the method was between 109 and

104 PCV2 plasmid copies/ml. At lower and higher dilutions,quantitation was not always reproducible.

Using 10-fold dilutions of DNA extracted from PCV2culture (104.4 TCID50/ml), the assay sensitivity was 10−4.4

TCID50/ml.None of the bacteria, virus (other than PCV2) and porcine

cell lines tested (Table 2) gave any amplification signal. Thepresence of exogenous DNA had no detectable effect on thereaction signal.

3.1.3. Reproducibility and accuracyMethod reproducibility (Martell et al., 1999) was estab-

lished by calculating the CV values with the Ct values ofeach PCV2 standard dilution (from 109 to 104 copies ofPCV2 plasmid copies/ml) of five different runs. The average

78 A. Olvera et al. / Journal of Virological Methods 117 (2004) 75–80

2.E+05 3.E+05

9.E+06

5.E+08

1.E+00

1.E+01

1.E+02

1.E+03

1.E+04

1.E+05

1.E+06

1.E+07

1.E+08

1.E+09

1.E+10

1.E+11

1.E+12

1.E+13

Type of affection

PC

V2

gen

om

es/m

L

C

B

A A

12

PDNS27

mild24

moderate24

severeN

Fig. 1. PCV2 load (�) and PCV2 mean load ( ) in PDNS and PMWS affected pigs. PCV2 load in serum is low in individuals with PDNS or mildPMWS lesions with no statistical difference (P > 0.05) between them (A). PCV2 load increases in animals with moderate and severe lesions, beingstatistical different (P < 0.05) from PDNS or mild PMWS affected pigs and between them (B and C).

CV of the technique was of 1.3% intrassay (within runs) andof 4.2% interassay (between runs). Average between runsaccuracy (R2) was 0.987.

3.2. Diagnostic samples

PCV2 DNA was detected in all samples tested with a widerange of PCV2 load, which was related with the differentPMWS lesion categories (Fig. 1). PCV2 load was signifi-cantly higher (P < 0.05) in pigs with severe lesions (rangingfrom 3.9× 105 to 1.8× 1012 PCV2 genomes/ml) comparedto the group with moderate lesions (ranging from 2× 103

to 9.8 × 108 PCV2 genomes/ml). Besides, both groups hada significantly higher (P < 0.05) viral load in serum thanthe groups with PDNS or mild PMWS lesions. On the otherhand, no significant differences (P > 0.05) in viral load be-tween pigs with mild PMWS lesions and PDNS lesions werefound (with viral loads ranging from 2× 103 to 8.1 × 107

PCV2 genomes/ml and from 2× 103 to 3.9 × 106 PCV2genomes/ml, respectively).

Seven samples (8%) had<104 PCV2 genomes/ml and fivesamples (5%) gave readings of >109 PCV2 genomes/ml. Theseven samples showing<104 PCV2 genomes/ml were fromthe following categories: PDNS (one animal), mild PMWSlesions (five animals) and moderate PMWS lesions (one an-imal). The five samples showing >109 PCV2 genomes/mlwere from the severe PMWS lesion category. These lattervalues were out of the standard range of viral load meaningthey were extrapolations to the standard curve, being there-fore less reliable.

The animals from the PDNS group were also classifiedregarding PMWS microscopic lymphoid lesions.Table 3shows PCV2 viral loads in serum found in the animals of

Table 3PDNS affected animals histopathological lesions severity, in situ hybridi-sation (ISH) and PCV2 load results

PCV2 ISH PMWS-likelymphoid lesionsseverity

PCV2 loadPCV2genomes/ml

Number ofpositive pigs

Number ofnegative pigs

5 Mild <104 to 106

3 Moderate <104 to 106

2 Mild <104 to 106

2 None <105 to 106

this group according to the PMWS-like lesions and PCV2in situ hybridisation result.

4. Discussion

This study describes a new real time PCR for PCV2 and itsevaluation as a diagnostic tool for PMWS. PCR techniquesare sensitive, specific and can be performed in poor qualitysamples with no recoverable virus (Klein, 2002). Real timePCR allows the quantitation of the amount of virus presentin a sample, being this technique a useful tool in virology(Mackay et al., 2002). The TaqMan© real time PCR for de-tection of PCV2 genome is as sensitive as end-point PCR butoffers several other advantages over end-point PCR meth-ods: (1) the use of two different fluorescent probes giveshigher specificity and allows the development of multiplexreactions (Klein, 2002), (2) a wide dynamic range of de-tection (5 logarithmic decades) with high precision (Klein,2002), (3) it is carried out in a close tube being, not onlymore robust against contamination, but also faster and lesslabour intensive since no post-PCR steps are required, (4)

A. Olvera et al. / Journal of Virological Methods 117 (2004) 75–80 79

amperase UNG and AmpliTaq Gold DNA polymerase avoidamplicon contamination and minimise unspecific amplifi-cations, respectively, and (5) the use of an internal controlmakes the method more robust, detecting false negative re-sults due to the presence of PCR inhibitors in the samples.The 18S rRNA gene (the target gene of the IC kit) is ahigh copy number housekeeping gene in eukaryotes (sev-eral hundreds in mammals) (Lewin, 1994) and can be usedas IC without adding artificial mimics to the samples andminimising sample manipulation.

PCV2 viral load has been shown to be higher in clinicallyaffected animals than in animals infected subclinically (Liuet al., 2000; Rovira et al., 2002; Ladekjær-Mikkelsen et al.,2002; Quintana et al., 2001; Meehan et al., 2001; Rosellet al., 2000). Our study further supports this observation:PCV2 viral load increases with the severity of PMWS mi-croscopic lesions in lymphoid tissue. Although viral loadwas significantly different in the three PMWS lesion cate-gories, a high variability within each category existed. Thedynamics of viral infection, related with lesion developmentand recovery overtime is still unknown. It is possible thatrecovering pigs still have PMWS lesions and decreasing vi-ral loads, and this would explain those cases found in thisstudy (8 of 48 animals) with moderate to severe lesions andlow viral loads (under 106 PCV2 genomes/ml). On the otherhand, the critical viral load to elicit PMWS characteristic le-sions is not known. The latter point explains the finding ofanimals infected asymptomatically with relatively high viralloads, still insufficient to cause lesions.

Several experimental challenges with a longitudinal mon-itoring of viral load in serum have been made (Liu et al.,2000; Ladekjær-Mikkelsen et al., 2002; Rovira et al., 2002).In the first study, animals with PMWS had PCV2 mean vi-ral loads of 4.6 × 106 PCV2 genomes/ml of serum (n =25). In the second study, all infected animals (n = 10) de-veloping the disease reached PCV2 loads up to 107 PCV2genomes/ml of serum 10 days after inoculation. In our study,clinical PMWS correlated with the moderate and severePMWS-characteristic lymphoid microscopic lesions cate-gories. The fact that animals in the moderate lesion cate-gory had mean PCV2 loads of 9× 106 PCV2 genomes/mlserum, and that other studies have also found viral loads inthe range of 106–107 PCV2 genomes/ml in PMWS affectedpigs, 107 PCV2 genomes/ml of serum could be proposed asthe threshold for PMWS diagnosis.

The results obtained in this study indicate that PCV2load in serum could be used for differentiating PMWS fromPCV2 subclinical infection. However, two points need to beconsidered: (1) there is a high variability in viral load withinthe different lesion groups, although statistically significantdifferences exist between them, and (2) in a group of pigs,animals at different stages of the disease might coexist. An-imals in the initial phases of the disease show more severelesions, and presumably higher viral loads, than animals inthe late stage of the disease (Quintana et al., 2001). There-fore, both the number and the selected animals to be used

for PMWS diagnosis in a farm are critical. Diagnosis us-ing TaqMan PCR should be made from serum samples fromseveral animals showing initial signs of wasting.

PDNS affected pigs showing mild to moderate micro-scopic PMWS-like lesions had low viral loads in concor-dance with what has been found in PMWS mild lesionscategory. This fact suggests that, although PCV2 may play arole in PDNS pathogenesis, viral load is not a decisive factorfor developing PDNS. In fact, PCV2 DNA has not been de-tected, or detected in low amounts in the most characteristicPDNS lesions: systemic necrotising vasculitis and fibrinousglomerulitis (Rosell et al., 2000; Choi and Chae, 2001). Onthe other hand, PCV2 low viral load is not incompatiblewith PCV2 having a role in PDNS. PDNS has been pro-posed to be a type III hypersensitivity, where low amountsof antigen can elicit this type of immune response and le-sions. However, it cannot be ignored that PCV2 infection inPDNS would be a mere coincidence. The fact of having thesame viral load than pigs with mild PMWS lesions, couldalso suggest that PDNS affected animals are subclinicallyinfected with PCV2 as a high number of pigs of the sameage worldwide (Larochelle et al., 2003; Sibila et al., 2004).

In conclusion, real time PCR can be a useful tool to diag-nose PMWS outbreaks without having to sacrifice animals.The presence in a sample of animals of high PCV2 loads(>107 PCV2 genomes/ml of serum) is suggested as indicat-ing the presence of PMWS lesions. However, a larger num-ber of animals should be analysed to confirm the PCV2 loadnecessary to diagnose PMWS in a group of animals.

Acknowledgements

This work was partially funded by the Project QLRT-PL-199900307 from Fifth Framework Programme 1998–2002of the European Commission. We would like to thankDr. Annette Mankertz, Fort Dodge Verterinaria Spain andApplied Biosystems technical support for their help, andMerche Mora and Eva Huerta for technical support.

References

Allan, G.M., McNeilly, F., Meehan, B.M., Kennedy, S., Mackie, D.P.,Ellis, J.A., Clark, E.G., Espuna, E., Saubi, N., Riera, P., Botner, A.,Charreyre, C.E., 1999. Isolation and characterisation of circovirusesfrom pigs with wasting syndromes in Spain, Denmark and NorthernIreland. Vet. Microbiol. 66, 115–123.

Calsamiglia, M., Segalés, J., Quintana, J., Rosell, C., Domingo, M., 2002.Detection of porcine circovirus types 1 and 2 in serum and tissuesamples of pigs with and without postweaning multisystemic wastingsyndrome. J. Clin. Microbiol. 40, 1848–1850.

Cheung, A.K., 2003. Transcriptional analysis of porcine circovirus type2. Virology 305, 168–180.

Choi, C., Chae, C., 2001. Colocalitzation of porcine reproductive andrespiratory syndrome virus and porcine circovirus 2 in porcine der-matitis and nephropathy syndrome by double-labeling technique. Vet.Pathol. 38, 441–463.

80 A. Olvera et al. / Journal of Virological Methods 117 (2004) 75–80

Drolet, R., Thibault, S., D’Aillaire, S., Thomson, J., Done, S., 1999.Porcine dermatitis and nephropathy syndrome (PDNS): an overviewof the disease. Swine Health Prod. 7, 283–285.

Fenaux, M., Halbur, P.G., Gill, M., Toth, T.E., Meng, X.J., 2000. Geneticcharacterization of type 2 porcine circovirus (PCV2) from pigs withpostweaning multisystemic wasting syndrome in different geographicregions of North America and development of a differential PCR re-striction fragment length polymorphism assay to detect and differenti-ate between infections with PCV1 and PCV2. J. Clin. Microbiol. 38,2494–2503.

Hamel, A.L., Lin, L.L., Sachvie, C., Grudeski, E., Nayar, G.P., 2000.PCR detection and characterization of type 2 porcine circovirus. Can.J. Vet. Res. 64, 44–52.

Helie, P., Drolet, R., Germain, M.C., Bourgault, A., 1995. Systemic necro-tizing vasculitis and glomerulonephritis in grower pigs in southwesternQuebec. Can. Vet. J. 36, 150–154.

Kim, J., Chae, C., 2001. Optimised protocols for the detection of porcinecircovirus 2 DNA from formalin-fixed paraffin-embedded tissues usingnested polymerase chain reaction and comparison of nested PCR within situ hybridisation. J. Virol. Methods 92, 105–111.

Klein, D., 2002. Quantification using real-time PCR technology: applica-tions and limitations. Trends Mol. Med. 8, 257–260.

Ladekjær-Mikkelsen, A.S., Nielsen, J., Stadejek, T., Storgaad, T.,Krakowka, S., Ellis, J., McNeilly, F., Allan, G., Bøtner, A., 2002. Re-production of postweaning multisystemic wasting syndrome (PMWS)in immunostimulated and non-immunostimulated 3-week-old pigletsexperimentally infected with porcine circovirus type 2 (PCV2). Vet.Microbiol. 89, 97–114.

Larochelle, R., Morin, M., Antaya, M., Magar, R., 1999. Identificationand incidence of porcine circovirus in routine field cases in Quebecas determined by PCR. Vet. Rec. 145, 140–142.

Larochelle, R., Magar, R., D’Allaire, S., 2003. Comparative serologicand virologic study of commercial swine herds with and withoutpostweaning multisystemic wasting syndrome. Can. J. Vet. Res. 67,114–120.

Lewin, B., 1994. Genes V. Oxford University Press, USA, p. 723.Liu, Q., Wang, L., Willson, P., Babiuk, A., 2000. Quantitative, competitive

PCR analysis of porcine circovirus DNA in serum from pigs withpostweaning multisystemic wasting syndrome. J. Clin. Microbiol. 38,3474–3477.

Liu, Q., Tikoo, S.K., Babiuk, L.A., 2001. Nuclear localitzation of theORF2 protein encoded by porcine circovirus type 2. Virology 285,91–99.

Mackay, I.M., Arden, K.E., Nitsche, A., 2002. Real-time PCR in virology.Nucl. Acc. Res. 30, 1292–1305.

Mankertz, A., Domingo, M., Folch, J.M., LeCann, P., Jestin, A., Segales,J., Chmielewicz, B., Plana-Duran, J., Soike, D., 2000. Characterizationof PCV2 isolates from Spain, Germany and France. Virus Res. 66,65–77.

Mankertz, A., Hillenbrand, B., 2001. Replication of porcine circovirustype 1 requires two proteins encoded by the viral rep gene. Virology279, 429–438.

Martell, M., Gómez, J., Esteban, J.I., Sauleda, S., Quer, J., Cabot, B.,Esteban, R., Guardia, J., 1999. High-throughput real-time reversetranscription-PCR quantitation of hepatitis C virus RNA. J. Clin. Mi-crobiol. 37, 327–332.

Meehan, B.M., Gilpin, D.F., Krakowka, S., Ellis, J.A., McNeilly, F.,Allan, G.M., 2001. In vivo quantification analyses of PCV2 DNAs:correlation of virus load measurements with disease reproduction. In:Proceedings of the European Society Veterinary Virology, PMWS,p. 101.

Nawagitgul, P., Morozov, I., Bolin, S.R., Harms, P.A., Sorden, S.D., Paul,P.S., 2000. Open reading frame 2 of porcine type 2 encodes a majorcapsid protein. J. Gen. Virol. 81, 2281–2287.

Quintana, J., Segales, J., Rosell, C., Calsamiglia, M., Rodriguez-Arrioja,G.M., Chianini, F., Folch, J.M., Maldonado, J., Canal, M.,Plana-Duran, J., Domingo, M., 2001. Clinical and pathological obser-vations on pigs with postweaning multisystemic wasting syndrome.Vet. Rec. 149, 357–361.

Rodriguez-Arrioja, G.M., Segalés, J., Balasch, M., Rosell, C., Quintana,J., Folch, J.M., Plana-Duran, J., Mankerttz, A., Domingo, M., 2000.Serum antibodies to porcine circovirus type 1 (PCV1) and type 2(PCV2) in pigs with and without postweaning multisystemic wastingsyndrome (PMWS). Vet. Rec. 146, 762–764.

Rosell, C., Segalés, J., Plana-Duran, J., Balasch, M., Rodriguez-Arrioja,G.M., Kennedy, S., Allan, G.M., McNeilly, F., Latimer, K.S., Domingo,M., 1999. Pathological, immunohistochemical, and in-situ hybridiza-tion studies of natural cases of postweaning multisystemic wastingsyndrome (PMWS) in pigs. J. Comp. Pathol. 120, 59–78.

Rosell, C., Segales, J., Ramos-Vara, J.A., Folch, J.M., Rodriguez-Arrioja,G.M., Duran, C.O., Balasch, M., Plana-Duran, J., Domingo, M.,2000. Identification of porcine circovirus in tissues of pigs withporcine dermatitis and nephropathy syndrome. Vet. Rec. 146, 40–43.

Rovira, A., Balasch, M., Segalés J., Garcı́a, L., Plana-Duran, J., Rosell,C., Ellerbrok, H., Mankertz, A., Domingo, M., 2002. Experimentalinoculation of convention pigs with porcine reproductive and respira-tory syndrome virus and porcine circovirus 2. J. Virol., 3232–3239.

Segalés, J., Piella, J., Marco, E., Mateu-de-Antonio, E.M., Espuna, E.,Domingo, M., 1998. Porcine dermatitis and nephropathy syndrome inSpain. Vet. Rec. 142, 483–486.

Segalés, J., Domingo, M., 2002. Postweaning multisystemic wasting syn-drome (PMWS) in pigs. A review. Vet. Q. 24, 109–124.

Sibila, M., Calsamiglia, M., Segales, J., Blanchard, P., Badiella, L., LeDimna, M., Jestin, A., Domingo, M., 2004. Use of a polymerasechain reaction assay and an ELISA to monitor porcine circovirustype 2 infection in pigs from farms with and without postweaningmultisystemic wasting syndrome. Am. J. Vet. Res. 65, 88–92.