Sto

HKSa

Fb

c

d

e

a

ARR2AA

KSOOEB

1

tV

COP

t

h0

Colloids and Surfaces B: Biointerfaces 139 (2016) 68–78

Contents lists available at ScienceDirect

Colloids and Surfaces B: Biointerfaces

journa l homepage: www.e lsev ier .com/ locate /co lsur fb

ynergistic interaction of platelet derived growth factor (PDGF) withhe surface of PLLA/Col/HA and PLLA/HA scaffolds produces rapidsteogenic differentiation

anumantha Rao Balaji Raghavendran a,∗,1, Saktiswaren Mohan a,1,rishnamurithy Genasan a,d,1, Malliga Raman Murali a, Sangeetha Vasudevaraj Naveen a,epehr Talebian e, Robert McKean b, Tunku Kamarul a,c,∗

Tissue Engineering Group (TEG), National Orthopaedic Centre of Excellence in Research and Learning (NOCERAL), Department of Orthopaedic Surgery,aculty of Medicine, University of Malaya, Kuala Lumpur, MalaysiaThe Electrospinning Company Ltd., Rutherford Appleton Laboratory, Harwell Oxford Didcot, Oxfordshire OX11 0QX, UKClinical Investigation Centre, Faculty of Medicine, University of Malaya Medical Center, Kuala Lumpur, MalaysiaInstitute of Translational Medicine, University of Liverpool, Liverpool L69 3GE, UKDepartment of Mechanical engineering, Engineering Faculty, University of Malaya, 50603 Kuala Lumpur, Malaysia

r t i c l e i n f o

rticle history:eceived 14 May 2015eceived in revised form3 November 2015ccepted 26 November 2015vailable online 28 November 2015

eywords:caffoldsteocalcinsteoblastlectrospinningone marrow

a b s t r a c t

Scaffolds with structural features similar to the extracellular matrix stimulate rapid osteogenic differ-entiation in favorable microenvironment and with growth factor supplementation. In this study, theosteogenic potential of electrospun poly-l-lactide/hydroxyapatite/collagen (PLLA/Col/HA, PLLA/HA andPLLA/Col) scaffolds were tested in vitro with the supplementation of platelet derived growth factor-BB(PDGF-BB). Cell attachment and topography, mineralization, extracellular matrix protein localization,and gene expression of the human mesenchymal stromal cells were compared between the fibrousscaffolds PLLA/Col/HA, PLLA/Col, and PLLA/HA. The levels of osteocalcin, calcium, and mineralizationwere significantly greater in the PLLA/Col/HA and PLLA/HA compared with PLLA/Col. High expression offibronectin, intracellular adhesion molecule, cadherin, and collagen 1 (Col1) suggests that PLLA/Col/HAand PLLA/HA scaffolds had superior osteoinductivity than PLLA/Col. Additionally, osteopontin, osteo-calcin, osterix, Runt-related transcription factor 2 (Runx2), and bone morphogenic protein (BMP2)expression were higher in PLLA/Col/HA and PLLA/HA compared with PLLA/Col. In comparison withPLLA/Col, the PLLA/Col/HA and PLLA/HA scaffolds presented a significant upregulation of the genes

Runx2, Col 1, Integrin, osteonectin (ON), bone gamma-carboxyglutamic acid-containing protein (BGALP),osteopontin (OPN), and BMP2. The upregulation of these genes was further increased with PDGF-BB sup-plementation. These results show that PDGF-BB acts synergistically with PLLA/Col/HA and PLLA/HA toenhance the osteogenic differentiation potential. Therefore, this combination can be used for the rapid

w str

expansion of bone marro

. Introduction

Scaffolds provide biological substitutes for tissue engineeringhat improve the functions of damaged bone and cartilage [1].arious natural and synthetic materials have been used for the

∗ Corresponding author at: Tissue Engineering Group (TEG), National Orthopaedicentre of Excellence in Research and Learning (N◦CERAL), Department ofrthopaedic Surgery, Faculty of Medicine, University of Malaya, 50603 Lembahantai, Kuala Lumpur, Malaysia. Fax: +60 379494642.

E-mail addresses: hbr bala@yahoo.com (H.R.B. Raghavendran),kzrea@um.edu.my (T. Kamarul).

1 These authors equally contributed toward the work.

ttp://dx.doi.org/10.1016/j.colsurfb.2015.11.053927-7765/© 2015 Elsevier B.V. All rights reserved.

omal cells into bone-forming cells for tissue engineering.© 2015 Elsevier B.V. All rights reserved.

transplantation of stem cells in defective areas to allow the differ-entiation of these cells into osteogenic or chondrogenic cells. Theuse of scaffolds for stem cell transplantation requires the additionof multiple growth factors or commercially available osteogenicmedia for early differentiation [2]. The use of these growth fac-tors is expensive. Many studies, therefore, have explored the use ofbiomaterials with the addition of a single growth factor [3].

Mesenchymal stromal cells (MSCs) are used for tissue regener-ation due to their ability to replicate and differentiate into various

mesenchymal lineages, including chondrocytes, osteoblasts, andadipocytes. Substantial advancements have been made to the MSC-based strategies for bone repair and regeneration [4]. Althoughthe use of in vitro 2D culture flasks has traditionally been advo-

d Surfa

cb(ooeptirtsgat[siapscfdesdhoe

lHoaAistomacrOsicwdoc[swtfe

2

2

l

H.R.B. Raghavendran et al. / Colloids an

ated, the use of fibrous scaffolds has now become more commonecause of their similarity to the intrinsic extracellular matrixECM) of bone and cartilage. However, many aspects of the usef fibrous scaffolds remain unclear, including compatibility, choicef growth factor, material composition, and degradation rate. Forxample, an alloplastic material under mechanical strain may noterform in a manner similar to that of the neighboring host boneissues and may lead to structural defects at the implant site ornflammatory responses [5]. However, in the nano-fibrous envi-onment, the cell-to-cell interactions, transfer of nutrients andhe presence of components like Col and HA provide suitableurfaces for cell attachment and enhanced mineralization withrowth factor supplementation. The differentiation of MSCs inton osteogenic lineage is improved by the synergistic actions ofhe growth factors, scaffold, and extracellular matrix components6]. Numerous soluble and insoluble agents, including dexametha-one [7], BMP 2 [8], and Col 1 [9], encourage MSC differentiationnto osteogenic cells. The MSCs express osteoblast-related genesnd differentiate into osteogenic cells in response to the ECMroteins, collagen I [10], and HA [11] incorporated scaffolds. Thisuggests that the ECM plays a vital role in the differentiation pro-ess. Human fetal osteoblast cells supplemented with osteogenicactors incorporated into the fibrous scaffold can induce osteogenicifferentiation in approximately three weeks [12]. Similarly, thelectrospun poly-l-lactide/hydroxyapatite/collagen (PLLA/Col/HA)caffolds using 293 T cells and rabbit bone marrow stem cells pro-uce similar results [13]. Scaffolds using BMP2 stimulation alsoave osteoinduction properties. Similarly, the deposition of n-HAn the PLLA/Col nano-fibers has been reported as a promising strat-gy for early cell capture [14].

Platelet derived growth factor-BB (PDGF-BB) induces the pro-iferation, migration, and differentiation of stromal cells [15].owever, there is some controversy regarding the different typesf PDGF, with reports suggesting that some isoforms may hampernd others may enhance differentiation [16]. PDGF also inhibitsLP, OC, and type I collagen marker protein of mature osteoblasts

n pre-osteocytic cell lines [17]. Conversely, some studies havehown no effect of PDGF-BB on the marker activity and mineraliza-ion in human stromal cells. Imatinib mesylate-induced blockadef the PDGFR-beta reduces the differentiation of bone marrow stro-al cells [18]. On the other hand, the combination of PDGF-BB

nd peptides increases the proliferation, differentiation, and earlyalcification of the osteoblasts [19]. A few previous studies haveeported the use of different combinations of PLLA with Col and HA.ne study showed that the encapsulation of PDGF-BB into a micro-

phere enhances tissue regeneration in vitro and wound healingn vivo [20]. Although this method has several advantages, someoncerns need to be addressed, such as the initial burst releaseithin a short time and the deposition of the growth factor on the

egraded microsphere. These concerns limit the use of such meth-ds for routine tissue engineering. Additionally, high calcium (Ca)ontent hinders the cellular osteogenic activities of fetal osteoblasts21]. To overcome these limitations, a biocomposite nanofibrouscaffold using 12% nano-HA was fabricated with 8% Col, and blendedith high-molecular–molecular weight PLLA. We hypothesized

hat this artificial ECM environment supplemented with the growthactor PDGF-BB will accelerate mineralization for the rapid differ-ntiation of human bone marrow stromal cells in vitro .

. Materials and methods

.1. Fabrication of electrospun scaffolds

Electrospun scaffold sheets were prepared using high molecu-ar weight poly(L-lactide) (PL18, Purac, The Netherlands) solutions

ces B: Biointerfaces 139 (2016) 68–78 69

containing HA nanoparticles (Sigma–Aldrich, USA) and/or bovineCol (Type I) (Sigma–Aldrich, USA), with an average fiber diameterof 200–950 nm. The procedure used has been described elsewhere[10].

2.2. Bone marrow stromal cell culture

Human bone marrow stromal cells were isolated using ourstandard laboratory protocol. The isolated cells were cultured inthe DMEM medium (Invitrogen, Carlsbad, CA, USA) supplementedwith 10% stem cell specified fetal bovine serum (FBS, Invitrogen),100 U/ml penicillin (Sigma–Aldrich, USA), and 100 mg/ml strepto-mycin (Sigma–Aldrich). The cells were cultivated in tissue cultureflasks at 37 ◦C in a humidified atmosphere of 5% CO2. Once thecells achieved 80% confluence, they were detached using Versene®

for two minutes followed by Trypsin (Cell Applications, San Diego,CA, USA) and then passaged. The cells used in this study wereobtained from a control donor (28- to 40-year age group) and wereplaced in continuous cultures without re-cryopreservation untilthey reached the predetermined passages.

2.3. Cell seeding

Prior to the cell seeding, the scaffolds were sterilized using 70%ethanol for 20–30 min, and rinsed thrice in a phosphate bufferedsaline (PBS) and twice in the growth medium. Subsequently, thehuman mesenchymal stromal cells were detached until passage3 and seeded onto the scaffolds in 6-well plates with a cell den-sity of 104 or 105/cm2, respectively. The medium was changed atpredetermined points in time (0, 4, 8, and 12 days). The sampleswere collected and the cells were treated with PDGF-BB in varyingconcentrations (25, 50, and 100 ng/ml), as well as one minimal opti-mal concentration (50 ng/ml), which induced a significant releaseof osteogenic markers.

2.4. Alizarin red staining

Alizarin red (AR) staining was used to monitor the degree ofmineralization. Scaffolds loaded with the cells were fixed with 95%ethanol for 10 min, washed with sterile water, and incubated with0.1% AR stain and Tris–HCl solution at 37 ◦C for 30 min. Randomvisual fields were selected for data analysis.

2.5. Osteocalcin assay

Osteocalcin (OC) assay was performed using a commercial ELISAkit (IBL International, Germany). The assay method used a mono-clonal antibody directed against the epitopes of human OC. Thecalibrators and samples reacted with the captured monoclonal anti-body coated onto the microtiter well. Using a monoclonal antibody,OC was labeled with horse radish peroxidase (HRP). After the incu-bation period was over and the sandwich had been formed, theplates were washed and plates were incubated with the chro-mogenic solution (TMB substrate). The reaction was stopped usingthe stop solution provided in the kit, and the substrate turnoverwas read at 450 nm using a 96-well plate reader (BioTek, USA).

2.6. Fluorescence microscopy

The scaffolds seeded with bone marrow stromal cells werestained with Hoechst 33,342 blue (Invitrogen, USA) and analyzedwith a fluorescence microscope (Nikon C-HGFI, Japan) after 10 minof incubation at room temperature.

70 H.R.B. Raghavendran et al. / Colloids and Surf

Table 1Forward and reverse primers of genes.

Name Sequence Length

Col 1 F CCCGCAGGCTCCTCCCAG 18Col 1 R AAGCCCGGATCTGCCCTATTTAT 23OPN F CAGCCAGGACTCCATTGACTCGA 23OPN R CCACACTATCACCTCGGCCATCA 23BGLAP F GGAGGGCAGCGAGGTAGTGAAGA 23BGLAP R GCCTCCTGAAAGCCGATGTGGT 22RUNX2 F CCGCCATGCACCACCACCT 19RUNX2 R CTGGGCCACTGCTGAGGAATTT 22BMP2 F TGGCCCACTTGGAGGAGAAACA 22BMP2 R CGCTGTTTGTGTTTGGCTTGACG 23Integrin F TGGGCGCTACTGTCATTTGGG 21Integrin R CTGGCATCGGGTAGCTAGAGGC 22Osteonectin F TTGCAATGGGCCACATACCT 20Osteonectin R GGGCCAATCTCTCCTACTGC 20

2

w10acfTTucht(1alitwJi

2

ftTiGRiwStftbpicga

that the combined action of PDGF-BB and scaffold material inducesearly differentiation of the stromal cells into osteogenic-like cells.

.7. Immunocytochemistry

For immunofluorescence staining, the cells on each substrateere fixed with 4% (w/v) paraformaldehyde (PFA) (Sigma) in

× PBS for 15 min at room temperature. To permeabilize the cells,.1% (v/v) Triton-X 100 (Sigma) in 1 × PBS was added for 5 minnd washed thrice with the PBS. To block nonspecific binding, theells were incubated with 2% (v/v) goat serum (Sigma) in 1 × PBSor 30 min at room temperature and washed thrice with the PBS.he cells were incubated with primary antibodies at 4 ◦C for 3 h.he following primary antibodies (anti-FN antibody [IST-9]) weresed for incubation (1:1000; Abcam, England): Fibronectin (FN),ollagen 1 (Col 1), intrcellular adhesion molecules (ICAM−1), Cad-erin, osteopontin (OPN), osteocalcin (OC), Osterix, Runt-relatedranscription factor 2 (Runx2), and bone morphogenetic proteinBMP2). After the incubation, the cells were washed thrice with

× PBS for 5 min each. Chicken polyclonal secondary antibody wasdded to Anti-Mouse IgG H&L (FITC) (ab6810) (1:500; Abcam, Eng-and), and 1 × PBS was added for double-staining. These cells werencubated for 1 h at room temperature. The cell nuclei were coun-erstained using Hoechst dye. The fluorescence and confocal signalsere observed under a fluorescence microscope (Nikon C-HGFI,

apan), and the images were analyzed with the NIS-elemental imag-ng software.

.8. Real-time PCR

The degree of gene expression and the total RNA extractedrom the hMSCs cultured on the substrates (n = 8) were quan-ified with the RNeasy Mini Kit (Qiagen, Chatsworth, CA, USA).he concentration of RNA harvested was determined by measur-

ng the absorbance at 260 nm using a NanoPhotometerTM (Implen,ermany). The first-strand cDNA was synthesized with 25 ng pureNA, using the SuperScript® III First Strand Synthesis Kit accord-

ng to the manufacturer’s instructions. Osteogenic differentiationas evaluated with quantitative real-time PCR (qRT-PCR) using a

tepOnePlusTM Real-Time PCR System (Applied Biosystems, Fos-er City, CA, USA) with SYBR® green qPCR gene expression assaysor the osteogenic genes. The relative expression levels of thearget genes were determined using the comparative Ct methody normalization to the endogenous reference (glyceraldehyde 3-hosphate dehydrogenase). The relative gene expression involved

n the osteogenic and chondrogenic differentiation of the hMSCsultured on each substrate was normalized to the markers of osteo-

enesis in the hMSCs cultured on the control substrate. The forwardnd reverse primers used for this experiment are shown in Table 1.

aces B: Biointerfaces 139 (2016) 68–78

2.9. Statistical analysis

The values obtained were expressed as the mean and standarddeviation (SD). Statistical differences were determined using anal-ysis of variance (ANOVA) and least significant difference (LSD). SPSSversion 10 was used for analyzing the data. The differences wereconsidered statistically significant if the value of p was <0.05.

3. Results and discussion

Bone marrow stromal cells play a key role in bone homeo-stasis by proliferating, migrating, and differentiating in responseto stimuli [1]. These cells may potentially be used to treat sev-eral bone disorders [22]. PDGF-BB-one of the many stimulants forbone marrow stromal cells—is a potent mitogen that induces theproliferation and migration of cells. In contrast to the effect of PDGF-BB on bone marrow stromal cells, previous studies have showndecreased expression of alkaline phosphatase and OC with PDGF-BB [17]. PDGF-BB does not suppress alkaline phosphatase in theosteogenic differentiation medium in the PDGF receptor deletedpre-clinical model [23]. In this study, we tested whether the incor-poration of PDGF-BB into the nano-fibrous scaffold culture systeminduces differentiation of the human bone marrow stromal cellsto osteogenic-like cells. The fluorescence microscopy images of thebone marrow stromal cells cultured on fabricated scaffolds supple-mented with PDGF-BB are shown in Fig. 1a. After 12 days in theculture, Hoechst staining for DNA revealed cells adhering to thescaffold. This suggests that the composition of scaffolds allowedattachment of cells and PDGF-BB did not affect the viability of thesecells. A previous study showed increased hydrophilicity with Col,and enhanced cell attachment and proliferation with HA [24]. Theseresults confirm that bone marrow stromal cells can proliferate onthe composite scaffolds better compared with cells on the PLLAscaffolds with either Col or HA with growth factor supplements.Previous studies have shown that PLGA nano-fibers fabricated withthe HA particles induce bone mineralization better than PLGAwithout HA [25]. Therefore, the incorporation of the HA particlesinto the PLLA nano-fibers increases their physical and biologicalperformance. These results support our findings that PLLA/HA sup-plemented with growth factor increases the differentiation of cells.Similarly, the combination of HA and Col accelerates osteogenesis,which is in agreement with our findings that the combination ofPLLA with HA and Col with PDGF-BB enhances the expression ofthe osteogenic markers in vitro. Compared with the use of the Colscaffold alone, the combination of Col with HA using human fetalosteoblast cells has been reported to enhance the proliferation andmineralization of cells [5].

In the PLLA/Col/HA scaffold, Ca deposition increased gradu-ally. Although some increase in Ca deposition was noted in thePLLA/Col and PLLA/HA scaffolds, the increase was relatively lowerthan that observed on the PLLA/Col/HA scaffold (Fig. 1b). In thisstudy, scanning electron microscopy showed the following: mor-phology of cells in the differentiation phase; mineralization seen asCa deposits (Fig. 2a) on the scaffold surface; and cell spreading onthe fibrous region with characteristics such as pseudopodia. Miner-alization indicated that supplementation with PDGF-BB enhancedthe differentiation of human bone marrow stromal cells in 12 daysin PLLA/Col/HA compared with PLLA using Col alone. Greater cellspreading was observed on the PLLA/Col/HA scaffold comparedwith PLLA using Col alone, and different scaffolds showed the min-eral deposition on the surface of the material. This data indicate

Recent cell-based bioengineering trials have reinforced the ben-efits of stromal cells for the treatment of large bone defects, and

H.R.B. Raghavendran et al. / Colloids and Surfaces B: Biointerfaces 139 (2016) 68–78 71

Fig. 1. (a) Fluorescence microscopy of the cells attached to the scaffold on Day 12. The PLLA/Col/HA, PLLA/HA and PLLA/Col scaffold were washed with ice-cold PBS twiceand fixed with 4% formalin. The post-fixed samples were stained with Hoechst blue and viewed under the fluorescence microscope. The blue dots indicate the DNA of livecells stained with Hoechst blue. (b) The conditioned medium was collected at different points in time, and calcium quantification was performed using the Quantichrom TMcalcium assay kit. A calibration curve was obtained by reading the 96-well plates at 612 nm. The data were represented as means ± Standard deviation (SD). The statisticals tion (c erenca

sswfugfPrPt

awawuiwwwdmb

emaaf

ignificant was set at level P < .05, post-hoc followed by the least significant deviaompared with the PLLA/Col at different time points. (For interpretation of the refrticle.)

teroid-induced osteonecrosis of the femoral head. Reports havehown that the application of PDGF-BB enhances bone formation,hereas one report has shown that it does not play a role in bone

ormation [26–28]. The role of PDGF-BB in bone formation is stillnclear with conflicting reports in vitro and in vivo . The hMSCsrown on different scaffolds showed mineral deposition on the sur-ace after 12 days. More deposits were seen on the PLLA/Col/HA andLLA/HA scaffolds compared with the PLLA/Col scaffold. The cur-ent evidence suggests that the osteogenic potential of electrospunLLA/Col/HA nano-fibrous scaffolds is enhanced by the incorpora-ion of PDGF-BB.

Mineralization is a cell-mediated extracellular deposition of Cand phosphorus salts, in which the anionic matrix molecules bindith Ca2+ and PO4

3− ions, and thereafter serve as sites of nucleationnd growth [29]. Mineral nodules in the cultures of the scaffoldsere examined at different time points (4, 8, and 12 days) by

sing the AR dye (Fig. 2b) . The images showed positive AR stain-ng that suggests the differentiation of hMSCs into osteogenic cells

ith mineral deposition. The scores of the intensity of AR stainingere higher in the PLLA/Col/HA and PLLA/HA scaffold comparedith PLLA/Col (p < 0.05). The fabricated scaffold also induced Ca

eposition, which indicates osteogenic differentiation of the bonearrow stromal cells. This suggests that rapid mineralization can

e induced with PDGF-BB supplementation.Osteonectin (ON) plays a significant role in modulating min-

ralization of marrow stem cells to osteogenic-like cells [30]. As

easured in the supernatant, the ON levels increased (p < 0.05)

pproximately 1.5–2-fold in the cells grown on the PLLA/Col/HAnd PLLA/HA compared with those grown on the PLLA/Col scaf-old on days 4, 8, and 12 (Fig. 2c). However, the expression of ON

LSD) which was performed using SPSS version 10. * Represents the PLLA/Col/HAes to colour in this figure legend, the reader is referred to the web version of this

was slower in these cells than for cells grown on the PLLA/Col scaf-fold. These findings indicate that the differentiation of cells in thescaffold environment occurs more rapidly with PDGF-BB supple-mentation compared with PLLA scaffold using Col alone.

3.1. In vitro cell differentiation

Fibronectin mediates ECM interactions and accelerates the dif-ferentiation of stromal cells into other cell lineages. The increasedintensity of fluorescence in this study indicates ECM formationduring the differentiation of bone marrow stromal cells intoosteogenic-like cells [31]. Although this was observed in all thethree scaffolds, the percentage of fluorescein isothiocyanate (FITC)positive cells in PLLA/Col/HA and PLLA/HA was higher comparedwith that of PLLA/Col (Figs. 3 a and 7). FN is a major compo-nent of ECM that is essential for the assembly and integrity of thematrix. The physiology of bone marrow stromal cells and FN is com-plex. Most evidence suggests that FN-coated materials promote cellattachment and proliferation, but do not affect osteogenic differen-tiation. Conversely, some studies suggest that FN is an importantfactor for osteogenic differentiation of osteoblast-like cells [32].

Although FN was observed in all scaffolds, it was localized extra-cellularly and associated with the cell outlines in the culturesgrown on the PLLA/Col/HA scaffold. Increased expression of FN wasobserved in the PLLA/Col scaffold, but the increase was not as highas that observed in the PLLA/HA scaffold. This confirms that the

combination of Col and HA with PLLA, and the supplementation ofthe growth factor could be promoted due to the protein-phosphatecomposite layers. In light of this evidence, it is clear that PDGF-BBinduces early osteogenic differentiation, but the scaffold surfaces

72 H.R.B. Raghavendran et al. / Colloids and Surfaces B: Biointerfaces 139 (2016) 68–78

Fig. 2. (a) SEM of the PLLA/Col/HA, PLLA/HA and PLLA/Col scaffold. Mesenchymal stromal cells were cultured on these scaffolds and subjected to the CPD procedure. Followingthe CPD procedure, the samples were viewed under SEM (Phenom G2 Pro equipped with Fiber metric-Pro-Suite application). Arrows indicate the interaction of the hMSCswith the fibrous substrate and calcium-like apatite. (b) Post-fixed scaffold samples from days were fixed with 95% ethanol for 10 min, and subsequently washed with sterilewater and incubated with 0.1% AR stain and Tris–HCl solution at 37 ◦C for 30 min. The data were represented as means ± Standard deviation (SD). The statistical significantwas set at level P < .05, post-hoc followed by the least significant deviation (LSD) which was performed using the SPSS version 10. * Represents the PLLA/Col/HA and PLLA/HAcompared with the PLLA/Col. (c) The OC and Ca levels in the PLLA/Col/HA (a), PLLA/HA (b), and PLLA/Col (c) on days 0, 4, 8, and 12. The OC released at different points intime was quantified using the commercially available ELISA kit. The data were represented as the means ± Standard deviation (SD). The statistical significant was set at levelP < .05, post-hoc followed by the least significant deviation (LSD) which was performed using SPSS version 10. * Represents the PLLA/Col/HA, PLLA/HA compared with thePLLA/Col at day variable points in time.

Fig. 3. (a), (b) The post-fixed scaffold samples were immunostained with primary and secondary antibodies and the fluorescence signals were observed under a fluorescencemicroscope (Nikon C-HGFI, Japan). The image analysis was performed using the NIS-elemental imaging software. Arrows indicate nuclear staining (blue 20×) and FN, Col 1(green) of the ECM-like architecture after 12 days of culture. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version ofthis article.)

d Surfa

bgdstd

bpomfbatocrfivrdfbiivhaoieap

pi(FastsenCoecp

mtsIettocmdl

s

H.R.B. Raghavendran et al. / Colloids an

ehave differently based on their composition. The addition ofrowth factors to cell cultures offers some advantages in inducingifferentiation for future clinical applications. The use of scaffoldsimilar to the ECM would be more advantageous than the conven-ional procedures in terms of cell attachment, proliferation, andifferentiation.

Although complete mineralization cannot be achieved, it maye possible with the scaffold-like PLLA/Col/HA after PDGF-BB sup-lementation. The chemical composition and physical propertiesf the natural ECM has significant effects on the cell morphology,otility, and migration [33]. Similarly, tissue engineering scaf-

olds can influence cell proliferation and differentiation, and theiomaterial and microarchitecture can influence chemo-attraction,dhesion, and migration. This will, in turn, affect the matrix deposi-ion and mineralization. Several factors contribute to the strengthf the Integrin ligand-mediated cell adhesion. These include con-entrations of the adhesive ligands or substrates, number ofeceptors, and the receptor-ligand affinity. A shift in any of theseactors can have a dramatic effect on cell migration [35]. By chang-ng the ligand density, the strength of the cell-substrate interactionsia differential Integrin binding to adhesion ligands is affected. Inecent years, these effects have been translated using 3D scaffoldesign. Changing the composition of biomaterials used in scaffold

abrication can change ligand availability and subsequent Integrininding. Changes in the concentration of collagen have a significant

nfluence on the osteoblast activity, indicating the effect of differ-ng ligand availability [34,36]. The ECM composition and propertiesary with respect to tissues both in vitro and in vivo . Soft tissuesave collagen I and III, and basement membranes have lamininsnd type IV collagen. The rigidity of bones is due to the presencef calcium phosphate within a fibrillar collagen matrix. Stem cells

nteract with the ECM, irrespective of whether the ECM can influ-nce stem cell differentiation. It is apparent that factors such asttachment to ECM, ECM stiffness, topography, and componentslay a significant role.

Collagen is a major organic component of the bone ECM androduced by the osteoblasts. Col was not present in higher amounts

n the PLLA-based scaffolds compared with PLLA/HA and PLLA/ColFigs. 3b and 7). However, the percentage of cells positive forITC in PLLA/Col/HA was significantly higher than in PLLA/HAnd PLLA/Col. In general, collagen type I production involves aeries of closely coordinated physiological processes. Followinghe transcription and translation, the proteins undergo exten-ive posttranslational modifications before being released into thextracellular space [36]. Several factors are known to trigger Col 1,amely, hormones, cytokines, and trace metals [37]. The increase inol 1 after supplementation with PDGF-BB stimulates regenerationf damaged tissues and indicates that the ECM provides a suitablenvironment for the differentiation of the bone marrow stromalells [38]. However, the precise mechanism by which PDGF-BBromotes Col 1 synthesis is unclear.

In addition to the Col 1 and FN expression, a few adhesionolecules like ICAM-1 play important roles in the differentiation of

he bone marrow stem cells into osteogenic cells. The overexpres-ion of ICAM-1 in the MSCs also inhibits osteogenesis [39]. AlthoughCAM-1 enhances proliferation, it also causes loss of stem cell mark-rs. The overexpression of ICAM-1 activates the signaling proteinso suppress the osteogenic differentiation. The AKT pathway par-ially rescues the osteogenic differentiation [40]. In our study, webserved that the expression of ICAM-1 appears to be high in thease of PLLA/Col compared with the other two scaffolds supple-ented with PDGF-BB. This indicates that even though osteogenic

ifferentiation is supported in these cells, but these cells are notikely to get differentiated into other lineages (Figs. 4 & 7).

N-cadherin, a Ca-dependent protein, is expressed in neural tis-ues and other cell types, such as myoblasts and mesenchymal

ces B: Biointerfaces 139 (2016) 68–78 73

stem cells [41]. In this study, N-cadherin was expressed less in thePLLA/Col/HA and PLLA/HA scaffolds supplemented with the PDGFon day 12 compared with the PLLA/Col scaffold (Figs. 4 and 7). Theseresults concur with those of a previous study in which the overex-pression of N-cadherin in the bone morrow stromal cells inhibitedosteogenesis, and osteogenesis was promoted in vitro when N-cadherin was inhibited [42,48]. Although N-cadherin increasesthe migration potential of bone marrow stromal cells, it inhibitsosteogenic differentiation. The process of osteogenic cell–cell andcell-to-matrix interactions is important during osteoblast adhe-sion, signaling, and gene expression. The role of N-cadherin inosteoblast differentiation has conflicting results. It may promoteosteogenesis in the MC3T3E1 pre-osteoblasts or inhibit osteogenicdifferentiation by signaling pathways such as Wnt/beta catenin[43].

Runx2 is expressed throughout the osteogenic differentiationphase [44]. In this study, Runx2 was expressed in undifferentiatedcells, and showed a considerable increase with the kick-start ofa late differentiation phase (Figs. 5 and 7). Osterix is responsiblefor the osteogenic differentiation (Figs 5 and 7). The percentage ofpositive cells was considerably increased in (p < 0.05) PLLA/Col/HAand PLLA/HA compared with PLLA/Col. This indicates that PDGF-BBsupplementation alone did not enhance the differentiation patternand the synergistic action of the ECM is essential for differentiation.We also examined the expression of other osteogenic factors, suchas osteopontin, osteocalcin, and BMP2 in the scaffolds at the day12 using confocal microscopy. The percentage of FITC positive cellsshowed that OPN and BMP2 expressions were significantly greaterin PLLA/Col/HA compared with the other two scaffolds (Figs. 6cand Fig. 7). In contrast, OC was significantly more expressed in thePLLA/Col/HA and PLLA/HA compared with the PLLA/Col.

3.2. In vitro gene expression

PLLA/Col/HA showed an approximately four-fold increase inRunx2 compared with (p < 0.05) PLLA/Col. The increase in thePLLA/HA scaffold was around 0.5-fold compared with the PLLA/Col(Fig. 8a). These data correlated with the confocal data for the Runx2expression. The nano-fibrous environment provides the surface forcell attachment and enhances the proliferation of cells by usingmitogens such as PDGF-BB for rapid differentiation of the stromalcells. The fibrous surface also enhances the cell matrix interac-tions and cell–cell communications, which are important for theoxygen and nutrient exchange between cells [45]. Runx2 is a zincfinger transcription factor, which is essential for osteoblast dif-ferentiation, acting on the downstream Runx2, and modulatingthe expression of important osteoblast proteins such as OPN, ON,bone sialoprotein, and collagen type I. OPN is a phosphoproteincontaining several Ca binding domains expressed in the differ-entiating osteoblasts. It regulates cell adhesion, proliferation, andECM mineralization during bone development [45]. In this study,an approximately 6-fold increase was noted (p < 0.05) in Col inPLLA/Col/HA and a four-fold increase (p < 0.05) in PLLA/HA com-pared with the PLLA/Col scaffold (Fig. 8a). Col is necessary forosteogenesis stimulates the pre-osteoblast cell surface integrinsleading to the activation of other core binding factors, and increasesthe level of surface integrin [46]. The integrin levels also increasesignificantly in PLLA/Col/HA and PLLA/HA scaffold compared withPLLA/Col (Fig. 8a).

Osteonectin is a non-collagenous component of the ECM andis considered bone-specific because of its biochemical properties,such as a marker related to osteoblastic functional differentia-

tion [47]. When PLLA/Col/HA was supplemented with PDGF-BB,it showed increased osteonectin levels (p < 0.05). However, therewas no increase in the osteonectin levels with the other scaf-folds (Fig. 8a). Previous reports have shown that osteonectin is

74 H.R.B. Raghavendran et al. / Colloids and Surfaces B: Biointerfaces 139 (2016) 68–78

Fig. 4. (a), (b) Confocal analysis and ICAM and Cadherin immunostaining (10×) represented by photographs of the PLLA/Col/HA, PLLA/Col and PLLA/HA after 12 days of culture.The post-fixed samples were treated with primary and FITC-labeled secondary antibody and nuclear stain using Hoechst blue and viewed using the confocal microscope.The arrows indicate the green cytoplasm and blue nuclear staining of the differentiated cells. (For interpretation of the references to colour in this figure legend, the readeris referred to the web version of this article.)

Fig. 5. (a) & (b). Confocal analysis of the Runx2 and Osterix immunostaining represented by photographs of the PLLA/Col/HA, PLLA/HA and PLLA/Col after 12 days of culture.T ntibo( fferenr

oopltifwdad

he post-fixed samples were treated with the primary and FITC-labeled secondary a10×). The arrows indicate the green cytoplasm and blue nuclear staining of the dieader is referred to the web version of this article.)

bserved in the petri dish during osteogenic differentiation withr without ECM. When the stromal cells were cultivated in theetri dish without the ECM, the osteonectin level was relatively

ess during the early stages of differentiation, but increased afterhe addition of the osteogenic medium after one week [48]. Thencrease in the osteonectin on day 12 in the PLLA/Col/HA scaf-olds indicates the beginning of differentiation. Supplementation

ith PDGF-BB does not influence the increase in the osteogenic

ifferentiation in the presence of HA and Col alone in the PLLA, but

combination of HA and Col with PLLA improves the osteogenicifferentiation of the stromal cells. Bone gamma-carboxyglutamic

dy and nuclear stain using Hoechst blue and viewed using the confocal microscopetiated cells. (For interpretation of the references to colour in this figure legend, the

acid-containing protein (BGALP) is a post-proliferative osteoblastproducer, enhancing the differentiation progress of the hMSCs onthe electrospun scaffolds (Fig. 8b) [49]. The OC gene expressionis usually related to the early differentiation of the hMSCs scaf-fold culture. We demonstrated that an increase of many-fold in theexpression of OC correlated approximately with a 1.5-fold increasein both the PLLA/Col/HA and PLLA/HA (p < 0.05) compared withPLLA/Col. These results demonstrate that mineralization is a slow

process and adequate time is required for complete mineralization.

Previous studies on the effect of PDGF-BB on the OPN levels showmixed results. One study showed that OPN levels did not increase

H.R.B. Raghavendran et al. / Colloids and Surfaces B: Biointerfaces 139 (2016) 68–78 75

Fig. 6. (a), (b) & (c). Confocal analysis OPN, OC and BMP2 immunostaining represented by photographs of the PLLA/Col/HA, PLLA/HA and PLLA/Col after 12 days of culture.The post-fixed samples were treated with the primary and FITC-labeled secondary antibody and nuclear stain using Hoechst blue and viewed using the confocal microscope(10x). The arrows indicate the green cytoplasm and blue nuclear staining of the differentiated cells. (For interpretation of the references to colour in this figure legend, thereader is referred to the web version of this article.)

F , OC,

e n (SDs sents

wwfwawtentido

ig. 7. Confocal expression of Fibronectin, collagen 1, ICAM, Cadherin, Runx2, OPNach type of scaffold. The data were represented as the means ± Standard deviatioignificant deviation (LSD) which was performed using the SPSS version 10. * Repre

ith the addition of PDGF-BB, but increased when supplementedith TGF-� and PDGF-BB [50]. However, the current study, a one-

old increase was noted in the PLLA/Col/HA scaffold supplementedith PDGF-BB (Fig. 8b). OPN expression has been shown to increase

t the beginning of osteodifferentiation and decline during the feweeks of differentiation [51]. Another study showed a decline in

he OPN gene expression in the hMSCs after one week of differ-ntiation. The gene expression in the hMSCs seeded on to the Colano-fibers was noted to decrease after three weeks. In contrast,

he current study did not show an increase in the scaffolds contain-ng the Col and HA material fabricated with the PLLA even after 12ays. These findings indicate that rapid initiation and terminationf the differentiation process of the hMSCs cultured on the fibrous

BMP2, and Osterix. The scoring percentage was based on the FITC positive cells in). The statistical significant was set at level P < .05, post-hoc followed by the leastthe PLLA/Col/HA, PLLA/HA compared with the PLLA/Col on day 12.

material depends on the composition of the scaffold. The course ofOPN during the differentiation phase with or without extracellularmolecules also correlated with the osteonectin expression [52].

In our previous research, we have shown that fibrous scaffoldscan induce osteogenic differentiation [10]. In this study, we hypoth-esized that the introduction of a single mitogen like PDGF-BB wouldspeed up osteogenic differentiation using stromal cells. Previousstudies have shown that stem cell transplantation with a scaf-fold like HA/Tri calcium phosphate would be more effective than

the cell-free scaffold in animal models [53]. Similarly, a combinedtherapy of BMP2 with bone graft materials promotes bone regen-eration. The production of increased BMP2 considerably enhancesosteogenic differentiation [54]. In the present study, an increase in

76 H.R.B. Raghavendran et al. / Colloids and Surfaces B: Biointerfaces 139 (2016) 68–78

Fig. 8. (a) Quantitative gene expression of the PLLA/Col/HA, PLLA/HA and PLLA/Col during the differentiation process. The gene expression of Runx2, Col1 and Integrin. Thetotal RNA was extracted from hMSCs cultured on the substrates (n = 8) at day 12 using the RNeasy Mini Kit (Qiagen, Chatsworth, CA, USA). Following the cDNA synthesis andqPCR, the relative gene expression was normalized to the GAPDH and baseline expression. The data were represented as the means ± Standard deviation (SD). The statisticalsignificant was set at level P < .05, post-hoc followed by the least significant deviation (LSD) which was performed using the SPSS version 10. * Represents the PLLA/Col/HAcompared with the PLLA/Col on day 12. (b) Quantitative gene expression of the PLLA/Col/HA, PLLA/HA and PLLA/Col during the differentiation process. (a) Gene expressionof the Osteonectin (ON), BGALP (osteocalcin), Osteopontin (OPN) and bone morphogenetic protein 2 (BMP 2). The total RNA was extracted from the hMSCs cultured onthe substrates (n = 8) on the 12th day using the RNeasy Mini Kit (Qiagen, Chatsworth, CA, USA). Following the cDNA synthesis and qPCR, the relative gene expression wasn the mp ing thP

tgoc

nfpcPtsCsp

ormalized to the GAPDH and baseline expression. The data were represented asost-hoc followed by the least significant deviation (LSD) which was performed usLLA/Col on day 12.

he BMP2 was seen in all the three scaffolds (p < 0.05), which sug-ests that the scaffolds can induce stromal cell differentiation intosteogenic-like cells (Fig. 8b). These data correlated well with ouronfocal data with reference to BMP2 expression.

Biomaterials exhibit bone induction through the intramembra-ous ossification process, whereas growth factors induce bone

ormation through endochondral ossification [54]. Although sup-lementation with PDGF-BB induced differentiation of the stromalells in PLLA/Col/HA and PLLA/HA, this effect was not seen inLLA/Col. This could be due to the differences in composition, theechnique used to design the biomimetic nano- or micro-composite

caffolds, or the choice of cell type. In this study, the ratio of HA orol, and cell type in the scaffold is different from that of previoustudies. Therefore, we hypothesize that the scaffold material alsolays an important role in cell differentiation.

eans ± Standard deviation (SD). The statistical significant was set at level P < .05,e SPSS version 10. * Represents the PLLA/Col/HA and PLLA/HA compared with the

In our previous research, a moderate increase was seen in theosteogenic differentiation potential of the PLLA/Col scaffold [10].However, there was no further increase after PDGF-BB supplemen-tation. The reasons underlying these results are unclear, and furtherstudies are warranted to clarify them. One previous report hasstated that the differentiation behavior of the bone marrow stro-mal cells in the PLLA/Col was different from that of the thermalcross-linked fibers [55]. The osteogenic potential of the Col wasobserved in the late stages of the cultivation. The reason for thisis still unclear; however, the researchers anticipated that the com-position of the scaffold could be the reason. This is supported by

our results in which the cell attachment and differentiation pat-tern were not observed during the early points in time despite theaddition of the PDGF-BB; however, in our previous research, it wasmoderately enhanced after three weeks in the culture [10].

d Surfa

rrscsrgsbfsrio1nttoeottsws[tcohtpt

4

aosiPic

C

A

e-sttK

[

[

[

[

[[[[

[

[[[[[

[[

[

[

[

[[[[

[

[[[

[

[[[

[

[[[[

H.R.B. Raghavendran et al. / Colloids an

Studies have shown that the interaction with the cues are recip-ocal, implying that the stem cells are able to remodel the cues inesponse to the signals received. Thus, as a key component of thetem cell niche, the ECM is not just an inert scaffold, but insteadan profoundly influence the cell fate choices [56]. The influence oftiffness on stem cell differentiation has been demonstrated on aange of model substrates, including collagen and hyaluronic acidels, polymer networks, and electrospun nanofibers. The electro-pun fibers with identical microstructures and surface propertiesut different degrees of stiffness have varying effects on MSC dif-erentiation, with the softer fibers promoting chondrogenesis andtiffer fibers promoting osteogenesis. Studies on MSC responses toigid substrates overlaid with soft hydrogels of differing thicknessndicate that the cells can sense the ‘hidden’ substrate at a depthf approximately 5 �m and can deform a substrate to a depth of5 �m [57]. Although there is ample evidence that substrate stiff-ess influences stem cell fate, the specific environmental cues thathe cells sense can vary in different contexts. Recent data indicatehat the human epidermal and mesenchymal stem cells culturedn the ECM-coated hydrogels sense ECM tethering, as hydrogelsxhibit increasing porosity with decreasing stiffness. The stiffnessf the substrate can affect how cells respond to a specific concen-ration of ECM protein attached to the substrate, independent ofethering. A recent study has measured the force that cells apply toingle Integrin ligand bonds during the initial adhesion to the ECM,hich opens up the possibility of determining whether substrate

tiffness influences the ECM interactions at this level of resolution58]. For example, osteogenic differentiation was enhanced on theopographies that restricted the spread but promoted elongatedell morphologies. It would be interesting to explore the effectsf these substrates on other stem cell populations and determineow different cells ‘read’ the same topographical cues: whetherhe degree of Integrin clustering and cytoskeletal rearrangementrovoked by specific topographies is equivalent to specific concen-rations and combinations of the ECM components.

. Conclusions

PDGF-BB enhances the osteogenic potential of PLLA/Col/HAnd PLLA/HA, but there was no effect on the osteogenic potentialf PLLA/Col. Supplementation of PDGF-BB into the nano-fibrouscaffolds increases the osteogenic differentiation potential. Thisncrease probably results from the synergistic actions of theDGF-BB and the scaffold materials. Therefore, composite fibers

ncorporating mitogen-like PDGF-BB may be useful as rapid stemell differentiation tissue for engineering applications.

onflict of interest

The authors declare no competing interests exists.

cknowledgments

This study was supported by a major grant support (Refer-nce number -UM.C/625/1/HIR/MOHE/CHAN/03, account number

A000003-50001), University of Malaya. A part of the research was

upported by BK-035 from the University of Malaya. Special thankso the University of Malaya Bright Sparks for their sponsorship andhe Institute of Post Graduate dual Ph.D. funding for supporting G.rishnamurithy’s research.

[[[[

ces B: Biointerfaces 139 (2016) 68–78 77

Appendix A. Supplementary data

Supplementary data associated with this article can be found, inthe online version, at http://dx.doi.org/10.1016/j.colsurfb.2015.11.053.

References

[1] R. Langer, Acc. Chem. Res. (2000) 94.[2] E.L. Chaikof, H. Matthew, J. Kohn, A.G. Mikos, G.D. Prestwich, C.M. Yip, Ann.

N.Y. Acad. Sci. (2002) 96.[3] S. Kress, A. Neumann, B. Weyan, C. Kasper, Adv. Biochem. Eng. Biotechnol.

(2012) 263.[4] J.M.W. Ambikaipalan Wong, S. Khan, Curr. Stem Cell Res. Ther. (2013) 210.[5] M.S. Kang, J.H. Kim, R.K. Singh, J.H. Jang, H.W. Kim, Acta Biomater. (2015) 103.[6] Z. Liu, Y., Tang, T., Kang, M., Rao, K., Li, Q., Wang, C., Quan, C., Zhang, Q., Jiang,

H. Shen, 2015, 39.[7] X. Ma, X. Zhang, Y. Jia, S. Zu, S. Han, D. Xiao, H. Sun, Y. Wang, Int. Orthop.

(2013) 1399.[8] P. Yilgor, K. Tuzlakoglu, R.L. Reis, N. Hasirci, V. Hasirci, Biomaterials (2009)

3551.[9] M. Mizuno, Y. Kuboki, J. Biochem. (2001) 133.10] H.R. Balaji Raghavendran, S. Puvaneswary, S. Talebian, M. Raman Murali, S.

Vasudevaraj Naveen, G. Krishnamurithy, R. McKean, T.A. Kamarul, PLoS One(2014) e104389.

11] G. Krishnamurithy, M.R. Murali, M. Hamdib, A.A. Abbas, H.B. Raghavendran, T.Kamarul, Cer. Int. (2013) 771.

12] J.L. Venugopal, S. Low, A.T. Choon, A.B. Kumar, S. Ramakrishna, J. Biomed.Mater. Res. A (2008) 408.

13] D. Cao, Y.P. Wu, Z.F. Fu, Y. Tian, C.J. Li, C.Y. Gao, Z.L. Chen, X.Z. Feng, ColloidsSurf. B Biointerfaces (2011) 26–34.

14] X. Niu, Q. Feng, M. Wang, X. Guo, Q. Zheng, J. Control Rel. (2009) 111.15] R. Chung, B.K. Foster, A.C.W. Zannettino, C.J. Xian, Bone (2009) 878.16] X. Yu, S.C. Hsieh, W. Bao, D.T. Graves, Am. J. Physiol. (1997) 1709.17] S.J. Kono, Y. Oshima, K. Hoshi, L.F. Bonewald, H. Oda, K. Nakamura, H.

Kawaguchi, S. Tanaka, Bone (2007) 68.18] S. O’Sullivan, D. Naot, K. Callon, F. Porteous, A. Horne, D. Wattie, M. Watson, J.

Cornish, P. Browett, A. Grey, J. Bone Miner. Res. (2007) 1679.19] E.B. Stephan, R. Renjen, S.E. Lynch, R. Dziak, J. Periodontol. (2000) 1887.20] G. Wei, Q. Jin, W.V. Giannobile, P.X. Ma, J. Control Release (2006) 103.21] S.S. Kim, S.J. Gwak, B.S. Kim, J. Biomed Mat. Res A. (2008) 245.22] U.A. Gurkan, O. Akkus, Ann. Biomed. Eng. (2008) 1978.23] T. Tokunaga, Y. Oya, H. Ishii, C. Motomura, S. Nakamura, T. Ishizawa, Y.

Fujimori, A. Nabeshima, M. Umezawa, T. Kanamori, M. Kimura Sasahara, J.Bone Miner. Res. (2008) 1519.

24] M. Ngiam, S. Liao, A.J. Patil, Z. Cheng, C.K. Chan, Bone (2009) 4.25] C. Gardin, L. Ferroni, L. Favero, E. Stellini, D. Stomaci, S. Sivolella, E. Bressan, B.

Zavan, Int. J. Mol. Sci. (2012) 6452.26] R. Quarto, M. Mastrogiacomo, R. Cancedda, S.M. Kutepov, V. Mukhachev, A.

Lavroukov, E. Kon, M. Marcacci, N. Engl, J. Med. (2001) 385.27] B.H. Mitlak, R.D. Finkelman, E.L. Hill, J. Li, B. Martin, T. Smith, M. D’Andrea,

H.N. Antoniades, S.E. Lynch, J. Bone Miner. Res. (1996) 238.28] T.J. Nash, C.R. Howlett, C. Martin, J. Steele, K.A. Johnson, D.J. Hicklin, Bone

(1994) 203.29] D. Vikjaer, S. Blom, E. Hjørting-Hansen, E.M. Pinholt, Eur. J. Oral Sci. (1997) 59.30] L. Boskey, J. Cell Biochem. (Suppl) (1998) 83.31] J.B. Lian, G.S. Stein, J.L. Stein, A.J. vanWijnen, Biochem Soc. Trans. (1998) 26.32] G. Kim, M.P. Hwang, P. Du, J. Ko, C.W. Ha, S.H. Do, K. Park, Biomaterials. (2015)

75.33] S.G. Kim, D.S. Lee, S. Lee, J. H. Jang. J, Biomed. Mater. Res. A. Biomater. (2015)

75.34] B.P. Kanungo, L.J. Gibson, Acta Biomater. (2010) 102, Tissue Eng A.35] D.A. Lauffenburger, A.F. Horwitz, Cell. (1996) 359.36] C.M. Tierney, M.G. Haugh, J. Liedl, F. Mulcahy, B. Hayes, F.J. O’Brien, J. Mech.

Behav. Biomed. Mater. (2009) 209.37] S.G. Kim, D.S. Lee, S. Lee, J.H. Jang, J. Biomed. Mater. Res. A. Biomater. (2015)

75.38] S. Shi, M. Kirk, A.J. Kahn, J. Bone Miner. Res. (1996) 1139.39] S. Emanuela, K. Vera, M. Gillian, G. Jelena, J. Cell Sci. (2000) 2055.40] F.F. Xu, H. Zhu, X.M. Li, F. Yang, J.D. Chen, B. Tang, H.G. Sun, Y.N. Chu, R.X.

Zheng, Y.L. Liu, L.S. Wang, Y. Zhang, Tissue Eng. Part A (2014) 2768.41] Y. Tanaka, I. Morimoto, Y. Nakano, Y. Okada, S. Hirota, S. Nomura, T.

Nakamura, S. Eto, J. Bone Miner. Res. (1995) 1462.42] P. Hulpiau, F. van Roy, Int. J. Biochem. Cell Biol. (2009) 349.43] R. Guntur, C.J. Rosen, M.C. Naski, Bone. (2011) 54.44] R.T. Franceschi, Crit. Rev. Oral Biol. Med. (1999) 40.45] Z.R. Zhao, M. Zhao, G.Z. Xiao, R.T. Franceschi, Mol. Ther. (2005) 247.

46] M.D. Schaller, J.T. Parsons, Curr. Opin. Cell Biol. (1994) 705.47] C. Chai, K.W. Leong, Mol. Ther. (2007) 467.48] G. Karsenty, Matrix Biol. (2000) 85.49] S.J. Song, O. Jeon, H.S. Yang, D.K. Han, B.S. Kim, J. Microbiol. Biotechnol. (2007)

1113.

7 d Surf

[

[[

[

[

[Greiner, J.R. Paletta, S. Fuchs-Winkelmann, Sci. World J. (2009) 118.

[56] P.A. Hall, F.M. WAtt, Development (1989) 619.[57] C. Franck, S.A. Maskarinec, D.A. Tirrell, G. Ravichandran, PLoS One (2011)

8 H.R.B. Raghavendran et al. / Colloids an

50] W. Liu, J. Lipner, J. Xie, C.N. Manning, S. Thomopoulos, Y. Xia, ACS Appl. Mater.Interfaces (2014) 2842.

51] W.T. Butler, Connect. Tissue Res. (1989) 12336.52] M. Bidder, J.S. Shao, N. Charlton-Kachigian, A.P. Loewy, C.F. Semenkovich, J.

Biol. Chem. (2002) 85.53] L. Jones, R.W. Bucholz, M.J. Bosse, S.K. Mirza, T.R. Lyon, L.X. Webb, A.N. Pollak,

J.D.A. GoldenValentin-Opran, J. Bone Joint Surg. Am. (2006) 1431.54] N.S. Hwang, S. Varghese, H.J. Lee, Z. Zhang, J. Elisseeff Tissue Eng. Part A.

(2013) 1723.

[

aces B: Biointerfaces 139 (2016) 68–78

55] M.D. Schofer, U. Boudriot, I. Leifeld, R.I. Sütterlin, M. Rudisile, J.H. Wendorff, A.

e17833.58] P.Y. Wang, W.B. Tsai, N.H. Voelcker, Acta Biomater. (2012) 519.