cloning and sequence analysis of putative type ii fatty

Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L. 227

J. Biosci. 34(2), June 2009

1. Introduction

Oils are glycerol triesters of fatty acids and are mainly

derived from plant sources. Peanut is widely grown and ranks

fi fth among the world oil crops (Moretzsohn et al. 2004). It

is of great importance to study the fatty acid biosynthesis

pathway for improving oil quality and increasing oil content

of peanut through biotechnology-based approaches.

Fatty acid biosynthesis is catalysed by two types of fatty

acid synthase (FAS). Type I FAS, as found in vertebrates,

yeast and some bacteria, contains all the active sites on

one or two multidomain polypeptides. In type II FAS of

many bacteria, plant plastids and mitochondria, the active

centres reside in discrete gene products. E. coli serves as the

paradigm for the type II FAS system. Acyl carrier protein

(ACP) functions to sequester the growing acyl chain attached

to the prosthetic phosphopantetheine group from solvent as

it shuttles the intermediates between type II FAS enzymes

(Zhang et al. 2003b). The condensation of malonyl-ACP

with acyl-ACP to form β-ketoacyl-ACP is catalysed by small

β-ketoacyl-ACP synthase (KAS) family enzymes. FabH

(β-ketoacyl-ACP synthase III, KASIII) condenses acetyl-

CoA with malonyl-ACP to form 4:0-ACP, FabB (KAS I)

is responsible for the elongation of 4:0-ACP to 16:0-ACP,

and FabF (KAS II) mediates the elongation of 16:0-ACP

to 18:0-ACP. The formation of malonyl-ACP is catalysed

http://www.ias.ac.in/jbiosci J. Biosci. 34(2), June 2009, 227–238, © Indian Academy of Sciences 227

Cloning and sequence analysis of putative type II fatty acid synthase

genes from Arachis hypogaea L.

MENG-JUN LI, AI-QIN LI, HAN XIA, CHUAN-ZHI ZHAO, CHANG-SHENG LI, SHU-BO WAN,

YU-PING BI and XING-JUN WANG*

High-Tech Research Center, Shandong Academy of Agricultural Sciences, Key Laboratory for Genetic Improvement of

Crop, Animal and Poultry of Shandong Province, Key Laboratory of Crop Genetic Improvement and Biotechnology,

Huanghuaihai, Ministry of Agriculture, Ji’nan 250100, China

*Corresponding author (Email, [email protected])

The cultivated peanut is a valuable source of dietary oil and ranks fi fth among the world oil crops. Plant fatty

acid biosynthesis is catalysed by type II fatty acid synthase (FAS) in plastids and mitochondria. By constructing

a full-length cDNA library derived from immature peanut seeds and homology-based cloning, candidate genes of

acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, β-ketoacyl-ACP synthase (I, II, III), β-ketoacyl-ACP

reductase, β-hydroxyacyl-ACP dehydrase and enoyl-ACP reductase were isolated. Sequence alignments revealed that

primary structures of type II FAS enzymes were highly conserved in higher plants and the catalytic residues were

strictly conserved in Escherichia coli and higher plants. Homologue numbers of each type II FAS gene expressing

in developing peanut seeds varied from 1 in KASII, KASIII and HD to 5 in ENR. The number of single-nucleotide

polymorphisms (SNPs) was quite different in each gene. Peanut type II FAS genes were predicted to target plastids

except ACP2 and ACP3. The results suggested that peanut may contain two type II FAS systems in plastids and

mitochondria. The type II FAS enzymes in higher plants may have similar functions as those in E. coli.

[Li M-J, Li A-Q, Xia H, Zhao C-Z, Li C-S, Wan S-B, Bi Y-P and Wang X-J 2009 Cloning and sequence analysis of putative type II fatty acid

synthase genes from Arachis hypogaea L.; J. Biosci. 34 227–238]

Keywords. Arachis hypogaea L.; EST sequencing; gene cloning; type II FAS

Abbreviations used: ACAT, acetyl CoA:ACP transacylase; ACP, acyl carrier protein; DAP, days after pegging; ENR, enoyl-ACP

reductase; EST, expressed sequence tag; FAS, fatty acid synthase; HD, β-hydroxyacyl-ACP dehydrase; KAS, β-ketoacyl-ACP synthase;

KR, β-ketoacyl-ACP reductase; MCAT, malonyl-CoA:ACP transacylase; NCBI, National Center for Biotechnology; ORF, open reading

frame; PCR, polymerase chain reaction; RACE, rapid amplifi cation of cDNA ends; SNP, single-nucleotide polymorphism

Meng-Jun Li et al228


by acetyl-CoA carboxylase and FabD (malonyl-CoA:ACP

transacylase, MCAT). The reduction of β-ketoacyl-ACP to

β-hydroxyacyl-ACP by FabG (β-ketoacyl-ACP reductase,

KR) is the fi rst reductive step. Two isozymes, FabA and

FabZ (β-hydroxyacyl-ACP dehydratases, HD), catalyse the

dehydration of β-hydroxyacyl-ACP to trans-2-acyl-ACP.

FabA is a bifunctional enzyme involved in the introduction

of a cis-double bond into the growing acyl chain (Heath and

Rock 1996). The last reduction in each elongation cycle is

catalysed by FabI (enoyl-ACP reductase, ENR).

The isolation and cloning of cDNAs encoding plant

plastid type II FAS genes have been reported in Arabidopsis

thaliana (Post-Beittenmiller et al. 1989; Lamppa and

Jacks 1991; Hlousek-Radojcic et al. 1992; Tai et al. 1994;

Carlsson et al. 2002), Brassica napus (Kater et al. 1991;

Simon and Slabas 1998), Cuphea sp (Klein et al. 1992;

Voetz et al. 1994; Slabaugh et al. 1995), Spinacia oleracea

(Scherer and Knauf 1987; Schmid and Ohlrogge 1990; Tai

and Jaworski 1993), Hordeum vulgare (Hansen and von

Wettstein-Knowles 1991; Hansen and Kauppinen 1991),

Coriandrum sativum (Mekhedov et al. 2001), and Allium

ampeloprasum (Chen and Post-Beittenmiller 1996). The

crystal structure determination of E. coli type II FAS

enzymes has been completed (White et al. 2005), but

only the crystal structure of B. napus KR and ENR has

been determined in higher plants (Rafferty et al. 1995;

Fisher et al. 2000). Most of the work with plant plastid

type II FAS is focused on ACP (Hlousek-Radojcic et al.

1992; Kopka et al. 1993; Suh et al. 1999; Bonaventure

and Ohlrogge 2002) and KAS (Clough et al. 1992; Olsen

et al. 1999; Abbadi et al. 2000; Dehesh et al. 2001; Pidkowich

et al. 2007). Plant ACPs are encoded by a multigene

family which expresses in a constitutive manner (Hlousek-

Radojcic et al. 1992) or in a tissue-specifi c manner

(Bonaventure and Ohlrogge 2002). The altered expression

levels of KASII and KASIII lead to a change in oil content

and qualities in A. thaliana (Abbadi et al. 2000; Dehesh

et al. 2001; Pidkowich et al. 2007). In contrast to the

well-studied E. coli type II FAS system, plant type II FAS

enzymes located in plastids are largely uncharacterised

except in A. thaliana.

Plant mitochondrial fatty acid synthesis is also catalysed

by the type II FAS system (Olsen et al. 2004), in which only

ACP from Pisum sativum (Wada et al. 1997) and A. thaliana

(Shintani and Ohlrogge 1994), and KAS from A. thaliana

(Yasuno et al. 2004) have been characterised. The crystal

structure of mitochondrial KAS has been determined (Olsen

et al. 2004). Mitochondrial ACP functions as an essential

cofactor in lipoic acid synthesis (Shintani and Ohlrogge

1994; Wada et al. 1997). Mitochondrial KAS with its broad

chain length specifi city accomplishes all condensation steps

in mitochondrial fatty acid synthesis (Yasuno et al. 2004).

The role of the mitochondrial fatty acid synthetic pathway

is unclear because mitochondrial membrane fatty acids are

believed to originate outside mitochondria (Wada et al.

1997).

In this study, we report the cloning of A. hypogaea type

II FAS genes in plastids and two ACPs in mitochondria

by expressed sequence tag (EST) sequencing of a full-

length cDNA library and homology-based cloning

from immature peanut seeds. The primary structures of

plant type II FAS enzymes were analysed by sequence

alignments, and compared with that of E. coli. Furthermore,

homologues of each peanut type II gene in developing

seeds were investigated by cloning and sequencing. The

goal of our study was to provide a basis for elucidating the

molecular mechanism of fatty acid synthesis in peanut seed

development.

2. Materials and methods

2.1 RNA isolation and cDNA library construction

Peanut (A. hypogaea cultivar luhua-14) was grown in

the farm and gynophores were labelled. The immature

peanut seeds from 20 to 60 days after pegging (DAP) were

collected, frozen in liquid N2 immediately and stored in a

freezer at –80ºC. Total RNA was extracted from the seeds by

the RNAgent kit (Promega, Madison, WI, USA). Messenger

RNA was isolated and purifi ed from total RNA (Promega).

Directional cDNA synthesis (using adapters of EcoRI,

XhoI restriction sites) and library construction followed

the protocol of Stratagene s pBluescript II cDNA library

construction kit.

2.2 Analysis of ESTs

Each sequence obtained was edited using the Lasergene

SeqMan II Module (DNAStar) (http:/www.DNAStar.com).

Comparison of peanut ESTs with non-redundant protein

sequence databases (tBLASTx) at the National Center for

Biotechnology (NCBI) was performed to determine the

open reading frame (ORF) of the cDNA and probably gene

function.

2.3 Gene cloning

The full-length cDNAs of ACP, HD, ENR were identifi ed

from our EST contigs. The 3′-end MCAT was cloned by

3′-rapid amplifi cation of cDNA ends (3′-RACE). The KR,

KASI, KASII and KASIII genes were isolated by homology-

based cloning. Primers were designed based on the homology

of KAS sequences from the NCBI. Fragments of KAS genes

were amplifi ed by polymerase chain reaction (PCR) using

One-Shot LA PCRTM Mix (TaKaRa, Dalian, China). The



5′-RACE and 3′-RACE (5′/3′ RACE Kit, 2nd Generation,

Roche) primers were constructed based on known sequences

of KAS genes. PCR products were cloned into the pMD18-T

vector (TaKaRa).

2.4 Homologue analysis of type II FAS genes

Total RNA was isolated at six different seed development

stages (stage 1, 15 DAP; stage 2, 20 DAP; stage 3, 25 DAP;

stage 4, 35 DAP; stage 5, 45 DAP; stage 6, 70 DAP) using

RNAiso Reagent (TaKaRa) as described by the manufacturer.

Five microgram of RNA was reverse transcribed using a

PrimerScriptTM 1st Strand cDNA Synthesis Kit (TaKaRa)

with oligo (dT) as the primer according to the protocol

provided by the supplier. The resulting cDNA was mixed

and diluted 10-fold and 1 μl was used as a template for

PCR amplifi cation using 2×pfu PCR MasterMix (Tiangen

Biotech, Beijing, China) with the specifi c primers of each

type II FAS gene. The PCR products were cloned into the

pMD18-T vector (TaKaRa). Primers applied in homologue

analysis are available in supplementary materials.

Plasmid DNA was prepared using the EZNA Plasmid

Minipreps DNA Purifi cation System (Omega Bio-Tek,

USA). Purifi ed plasmid DNA was sequenced to obtain

the 5′- and 3′-end with BigDyeR Terminator v3.1 Cycle

Sequencing Kit (ABI) on an ABI 3730XL DNA Analyzer.

Nucleotide sequence assembly and homology searches

were performed using the tBLASTx tool online. Sequence

reassembly and coding region prediction were performed

using the Lasergene SeqMan II Module (DNAStar) (http:

//www.DNAStar.com). Multiple sequence alignments

were analysed using the ClustalW1.83 software (http:

//www.ch.embnet.org/software/ClustalW.html). Sequences

were shaded using the BoxShade program (http://

www.ch.embnet.org/software/BOX_form.html).

3. Results

3.1 Cloning and sequence analysis of AhACP

Forty-three ACP cDNA clones were identifi ed from ESTs

derived from the full-length cDNA library; these could be

divided into three groups: AhACP1 (36 clones), AhACP2

(6 clones) and AhACP3 (1clone) based on their amino acid

similarity. Twenty-seven ACPs from 6 plant species revealed

primary structure conservation among plant ACPs (fi gure 1).

Plant ACPs can clearly be divided into two types, which are

located in plastids (fi gure 1A) and mitochondria (fi gure 1B).

The central region encompassing the phosphopantetheine

attachment site consists of a serine residue within a DSL

motif recognised by members of the phosphopantetheinyl

transferase family (Mofi d et al. 2002). The prosthetic

group forms a thioester bond with fatty acids resulting in

activation of the carboxyl carbon of the acyl group (Suh et

al. 1999). Helix II was the most conserved in plant ACP 4

α helices. Helix II plays a dominant role in the interaction

with type II FAS partner enzymes in plastids and has been

termed the ‘recognition helix’ of ACP (Zhang et al. 2003a).

Three other α helices, helix I, helix III and helix IV, were the

main distinguishing features of plant ACPs in plastids and

mitochondria (fi gure 1).

A CT-rich sequence and the motif CTCCGCC and its

derivative are conserved in the 5′-leader region of 18 plastid

ACP cDNA (Bonaventure and Ohlrogge 2002). Site-directed

mutagenesis of the CT-rich sequence, TTCTCTCTCCT,

resulted in a three-fold reduction in transcription of the

AtpC::uidA gene fusion (Bolle et al. 1996). The motif

CTCCGTC and two CT-rich sequences were identifi ed in

the 5′-leader region of AhACP1 but not in AhACP2 and

AhACP3 (table 1). Lack of these two motifs may lead to

a difference in expression between AhACP1 and AhACP2,

AhACP3 in developing peanut seeds.

3.2 Cloning and sequence analysis of AhMCAT

In Sreptomyces coelicolor, MCAT is a key enzyme in both

fatty acid and polyketide synthesis (Keatinge-Clay et al.

2003). A MCAT cDNA clone was obtained from the peanut

cDNA library. AhMCAT contained a 1158 bp ORF, encoding

a protein of 385 amino acids with a predicted molecular

weight of 40.9 kD and a pI of 7.793. The deduced AhMCAT

sequence shared 32.7% sequence identity with E. coli FabD

(Serre et al. 1995).

In EcFabD, the active site, Ser92, is hydrogen-bonded

to His201. Gln250 serves as an H-bond acceptor during

interaction with His201. Arg117 might play a role in binding

the free carboxyl group. Gln11 can serve as an H-bond

donor (Serre et al. 1995). The residues of AhMCAT, Gln89,

Ser174, Arg199, His287 and Gln336, equivalent to EcFabD

Gln11, Ser92, Arg117, His201 and Gln250, were strictly

conserved in higher plants (fi gure 2). The GLSLGEY motif

containing the catalytic residue (serine174 in AhMCAT)

was completely conserved in higher plants, compared with

the E. coli GHSLGEY motif (fi gure 2). The G(H/L)SLG

pentapeptide belongs to the GXSXG motif (where x is any

residue) prevalent in α/β hydrolases (Keatinge-Clay et al.

2003), which is conserved in all bacterial species (Simon

and Slabas 1998).

3.3 Cloning and sequence analysis of AhKAS

In higher plants, fi ve types of KAS have been reported;

namely, KASI, KASII, KASIII, KASIV and mitochondrial

KAS, but there were no KAS ESTs in our peanut full-length

cDNA library. We cloned three members of the KAS family

by a homology-based approach using KAS sequences of

Glycine, Medicago and peanut ESTs in GenBank. The

peanut AhKASI, AhKASII and AhKASIII contained a 1413

bp, 1647 bp and 1206 bp ORF, encoding for a protein of 470,

548 and 401 amino acids with a predicted molecular mass

of 50.0, 58.7, 42.5 kDa and a pI of 8.192, 8.090 and 6.940,

respectively. AhKASI shared 51.5% sequence identity with



Figure 1. Multiple sequence alignment of selected acyl carrier protein (ACP) homologues. Protein sequences were aligned using the

CLUSTALW alignment algorithm and shaded using BoxShade. Identical and conserved residues are shaded black and grey, respectively.

The 4 α helices are indicated. Plant ACP Ser, corresponding to E. coli prosthetic group attachment site (Ser36), is marked with a triangle.

GenBank accession numbers are as follows : Ah1, EE127470; Ah2, EG373603; Ah3, EU823319; At1, NP_187153; At2, NP_175860;

At3, NP_564663; At4, NP_194235; At5, NP_198072; At6, NM_130026; At7, NP_176708; At8, NP_199574; Cl1, CAA54714; Cl2,

CAA54715; Cl3, CAA54716; Cl4, CAA64542; So1, CAA36288; So2, P07854; Os1, NP_001050125; Os2, NP_001051948; Os3, NP_

001055387; Os4, NP_001059204; Os5, NP_001062441; Os6, NP_001066930; Os7, NP_001067983; Hv1, AAA32920; Hv2, AAA32921

Hv3, AAA32922; Ec, AAB27925. Abbreviations: Ah, A. hypogaea; At, A. thaliana; Cl, Cuphea lanceolata; So, S. oleracea; Os, Oryza

sativa; Hv, Hordeum vulgare; Ec, E. coli.

Table 1. Proximal upstream sequence of acyl carrier protein (ACP) genes in peanut

ACP isoform Sequence*

AhACP1 gcattctcattaccacaaacactcttctcgtgctCTCCGTCcaaatctcagatctctctctctgtgaaa atg

AhACP2 gagctaaagagagaagaactgagaagtgagaaccgagaatagagaagaagcaaagaagggttttaggtttttgtgtagatcgattttgca atg

AhACP3 gacactcactcattcattcttcaaagaagaagaa atg

*The motif CTCCGTC is indicated in upper case. The CT-rich sequences are underlined. The ATG start codon is separated by one

space at the right end of the sequences.

AhKASII and only 6.5% with AhKASIII. EcFabF shared

43.8% and 45.3% identity with AhKASI and AhKASII,

whereas EcFabB shared 33.7% and 31.8% identity, which

is consistent with results in Arabidopsis (von Wettstein-

Knowles et al. 2000). EcFabF was more closely related to

peanut plastid KASI and KASII than EcFabB.

The active site triads, Cys22–His36–His397 of AhKASI

and Cys299–His439–His475 of AhKAS II, were revealed

by sequence alignments. The Cys–His–His active site triad

was strictly conserved in KASI and KASII of higher plants

(fi gure 3).

The greatest distinction between the active-site

architecture of KASI, KASII and KASIII is the presence of

two histidines in KASI and KASII and a histidine plus an

asparagine in KASIII (von Wettstein-Knowles et al. 2000).

AhKASIII shared 41% sequence identity with EcFabH and

also had a Cys–His–Asn active site triad (Cys177, His327,

Asn357), corresponding to EcFabH Cys112, His244,

Asn274 (Qiu et al. 1999). The Cys–His–Asn active site triad

and the motif GNTSAAS were strictly conserved in higher

plants with the exception of Elaeis oleifera KASIII (Cys→

Tyr) (fi gure 4). Deletion of the tetrapeptide of GNTS led to a

change in secondary structure and complete loss of AtKASIII

condensing activity. The motif GNTSAAS was proposed to

be responsible for the binding of acyl-ACPs (Abbadi et al.

2000). The Arg332 of AhKASIII, corresponding to Arg249

of EcFabH, a critical residue in the interaction between

EcFabH and ACP (Zhang et al. 2001), was also strictly

conserved in higher plants (fi gure4).

3.4 Cloning and sequence analysis of AhKR

No KR clone was identifi ed in our sequenced ESTs. By

searching public databases, we found two AhKR ESTs

(GenBank accession no. EG029580, ES715710) and the

two sequences were used for primer design. The cDNAs of

AhKR were cloned, which contained a 972 bp ORF encoding

a protein of 323 amino acids with a predicted molecular

mass of 33.8 kDa and a pI of 9.004. The deduced amino

acid sequence of AhKR was 69.7% and 49.6% identical to

B. napus KR (Fisher et al. 2000) and E. coli FabG (Price et

al. 2001).

On comparing BnKR with EcFabG, three active

site residues – Ser217, Tyr230 and Lys234 of AhKR

– corresponding to Ser138, Tyr151 and Lys155 of EcFabG,

were found. The Ser–Tyr–Lys catalytic triad was completely

conserved in higher plants (fi gure 5). The tyrosine and

lysine residues are involved in actual catalysis, whereas

serine participates in substrate binding and alignment

(Price et al. 2001). Lys208 (Arg in BnKR) and Arg251 of

AhKR, corresponding to Arg129 and Arg172 of EcFabG,

made a signifi cant contribution to ACP docking and were

strictly conserved in higher plants (Zhang et al. 2003b). The

catalytic YX3K motif conserved in FabG was also highly

conserved in higher plants.

3.5 Cloning and sequence analysis of AhHD

One full-length cDNA of HD was identifi ed in the peanut

cDNA library, which contained a 663 bp ORF encoding a

protein of 220 amino acids with a predicted molecular mass

of 24.0 kDa and a pI of 9.069. The deduced amino acid

sequence shared 43.1% and 13.4% identity with EcFabZ

and EcFabA, respectively.

The two genes, FabA and FabZ, encoding β-hydroxyacyl-

ACP dehydratases have been well studied in E. coli. The

catalytically important active site residues are His70 and

Asp84′ in EcFabA (Leesong et al. 1996) and His54 and



Figure 2. Multiple sequence alignment of selected malonyl-CoA:ACP transacylase (MCAT) homologues. Protein sequences

were aligned using the CLUSTALW alignment algorithm. The fi ve conserved residues of A. hypogaea MCAT corresponding

to E.coli FabD Gln11, Ser92, Arg117, His201 and Gln250 are shaded black and position numbers are indicated. The motif

G(L/H)SLG is boxed. GenBank accession numbers are as follows: Ah, EU823322; Gm, ABB85235; At1, AAM14913; At2,

AAM64515; Bn, CAB45522; Pf, AAG43518; Ca, ACF17665; Os, ABF95452, Ec, 1MLA. Abbreviations: Ah, A. hypogaea;

Gm, Glycine max; At, A. thaliana; Bn, B. napus; Pf, Perilla frutescens; Ca, Capsicum annuum; Os, O. sativa; Ec, E. coli.



Glu68′ in EcFabZ (Kimber et al. 2004). In AhHD, the

His/Glu catalytic dyad, His121 and Glu135′, and the motif

LPHRFPFLLVDRV were completely conserved in plant HD

and EcFabZ (fi gure 6), which suggested that plant HD may

function, like EcFabZ, in the metabolism of both saturated

and unsaturated long chain acyl-ACPs (Kimber et al. 2004).

3.6 Cloning and sequence analysis of AhENR

One ENR homologue was isolated from the peanut cDNA

library. It contained a 1170 bp ORF encoding a protein of

389 amino acids with a predicted molecular mass of 41.4

kDa and a pI of 8.571. The predicted protein sequence

showed 29.0% identity with EcFabI and 84.3% identity with

BnFabI (Rafferty et al. 1995). AhFabI had 15.5% sequence

identity with AhKR, similar to that of BnFabI and BnKR

(Fisher et al. 2000).

The Tyr–Tyr–Lys active site triad is characteristic of FabI

homologues. The fi rst tyrosine hydroxyl is directly involved

in catalysis (Rafi et al. 2006). The second tyrosine might

donate a proton to the enolate anion and lysine might act

to stabilise the negatively charged transition state (Rafferty

et al. 1995). In AhENR, the catalytic triad Tyr260–Tyr270–

Lys278 and the motif YGGGMSSAK, corresponding to the

YX6K motif in EcFabI, were completely conserved in higher

plants (fi gure 7).

Figure 3. Multiple sequence alignment of selected β-ketoacyl-ACP synthase I (KASI) (A) and KASII (B) homologues. Protein sequences

were aligned using the CLUSTALW alignment algorithm. (A) The three conserved residues of A. hypogaea KASI corresponding to E.coli

FabB Cys163, His298 and His333 are shaded black and position numbers are indicated. GenBank accession numbers are as follows:

Ah1, EU823325; Gm11, AAF61730; Gm12, AAF61731; At11, AAC49118; At12, AAM65396; Pf1, AAC04691; Rc1, AAA33873; Jc1,

ABJ90468; Os1, BAD35225; Hv1, AAA32968; Ec1, AAC67304. (B) The three conserved residues of A. hypogaea KASII corresponding

to E. coli FabF Cys164, His304 and His341 are shaded black and position numbers are indicated. GenBank accession numbers are as

follows: Ah2, EU823327; Gm21, AAW88762; Gm22, AAW88763; Gm23, AAF61737; At21, AAK69603; At22, AAL91174; Pf2,

AAC04692; Rc2, AAA33872; Jc2, ABJ90469; Os2, BAC79989; Hv21, CAA84022; Hv22, CAA84023; Ec2, CAA84431. Abbreviations:

Ah, A. hypogaea; Gm, G. max; At, A. thaliana; Pf, P. frutescens; Rc, Ricinus communis; Jc, Jatropha curcas; Os, O. sativa; Hv, H. vulgare;

Ec, E. coli.



Figure 4. Multiple sequence alignment of selected β-ketoacyl-ACP synthase III (KASIII) homologues. Protein sequences were aligned

using the CLUSTALW alignment algorithm. The four conserved residues of A. hypogaea KASIII corresponding to E. coli FabH Cys112,

His244, Arg249 and Asn274 are shaded black and position numbers are indicated. The motif GNTSAAS is boxed. GenBank accession

numbers are as follows: Ah, EU823328; Gm, AAF70509; At1, AAA61348; At2, CAA72385; Ca1, ACF17661; Ca2, ACF17662; Cw1,

AAA97533; Cw2, AAA97534; Ch1, AAF61398; Ch2, AAF61399; Pf1, AAC04693; Pf2, AAC04694; Aa, AAB61310; Ps, CAC08184;

Rc, ABR12417; Jc, ABJ90470; So, CAA80452; Ha, ABP93352; Eg, ABE73469; Eo, ABE73470; Ec, AAA23749. Abbreviations: Ah, A.

hypogaea; Gm, G. max; At, A. thaliana; Ca, C. annuum; Cw, C. wrightii; Ch, C. hookeriana; Pf, P. frutescens; Aa, A. ampeloprasum; Ps,

Pisum sativum; Rc, R. communis; Jc, J. curcas; So, S. oleracea; Ha, Helianthus annuus; Eg, Elaeis guineensis; Eo, E. oleifera; Ec, E. coli.

Figure 5. Multiple sequence alignment of selected β-ketoacyl-ACP reductase (KR) homologues. Protein sequences were aligned using the

CLUSTALW alignment algorithm. The fi ve conserved residues of A. hypogaea KR corresponding to E. coli FabG Arg129, Ser138, Tyr151,

Lys155 and Arg172 are shaded black and position numbers are indicated. The motif YX3K is boxed. GenBank accession numbers are as

follows: Ah, EU823329; At1, AAG40337; At2, CAA45794; Bn1, CAC41362; Bn2, CAC41363; Bn3, CAC41364; Bn4, CAC41365; Bn5,

CAC41370; Ca, ACF17653; Cl, CAA45866; Os1, ABA97197; Os2, BAD22913; Ec, ACF17653. Abbreviations: Ah, A. hypogaea; At, A.

thaliana; Bn, B. napus; Ca, C. annuum; Cl, C. lanceolata; Os, O. sativa; Ec, E. coli.



3.7 Homologue of type II FAS genes and subcellular

target prediction

Homologues of type II FAS genes were cloned by RT-PCR

using total RNA from a peanut immature seed mixture by

gene-specifi c primers. More than six clones of each gene were

picked randomly and sequenced. Homologue numbers of

each type II FAS gene expressing in peanut seed development

varied from 5 in ENR to only 1 in KASII, KASIII and HD.

The number of single-nucleotide polymorphisms (SNPs) was

Figure 6. Multiple sequence alignment of selected β-hydroxyacyl-ACP dehydrase (HD) homologues. Protein sequences were aligned

using the CLUSTALW alignment algorithm. The catalytic dyad of A. hypogaea HD corresponding to E. coli FabZ His54, Glu68 and E.

coli FabA His70, Asp84 is shaded black and position numbers are indicated. The conserved domain in HD is boxed. GenBank accession

numbers are as follows: Ah, EU823332; At1, AAD23619; At2, AAM64548; At3, AAO24548; Bn, AAK60545; Ca, ACF17652; Os,

AAT58880; Pm1, ABA25920; Pm2, ABA25921; Ec1, AAC36917; Ec2, 1MKB_A. Abbreviations: Ah, A. hypogaea; At, A. thaliana; Bn,

B. napus; Ca, C. annuum; Os, O. sativa; Pm, Picea mariana; Ec, E. coli.

Figure 7. Multiple sequence alignment of selected enoyl-ACP reductase (ENR) homologues. Protein sequences were aligned using the

CLUSTALW alignment algorithm. The three conserved residues of A. hypogaea ENR corresponding to E. coli FabI Tyr146, Tyr156 and

Lys163 are shaded black and position numbers are indicated. GenBank accession numbers are as follows: Ah, EU823333; At1, AAF37208;

At2, AAM45010; At3, CAA74175; Bn1, AAB20114; Bn2, CAA64729; Bn3, CAC41366; Bn4, CAC41367; Bn5, CAC41368; Bn6,

CAC41369; Oe, AAL93621; Ca1, ACF17650; Ca2, ACF17651; Nt1, CAA74176; Nt2, CAA74177; Os1, BAD03622; Os2, BAD26009;

Os3, CAA05816; Ec, P29132. Abbreviations: Ah, A. hypogaea; At, A. thaliana; Bn, B. napus; Oe, Olea europaea; Ca, C. annuum; Nt,

Nicotiana tabacum; Os, O. sativa; Ec, E. coli.



quite different in each gene. The most were identifi ed in KASI

and ENR, while no SNP was identifi ed in KASII, KASIII, HD.

Indel was only found in MCAT (table 2). The percentage of

transition was more than that of transversion in the identifi ed

SNPs. The results indicated that most type II FAS genes had

more than two homologues expressing in developing peanut

seeds.

To clarify the possible subcellular compartment of peanut

type II FAS genes, amino acid sequences were used for

targeting prediction by the TargetP1.1 Server. Results clearly

indicated that ACP1, MCAT, KASI, KASII, KASIII, KR,

HD and ENR all targeted chloroplast, while ACP2 and ACP3

were confi dently predicted to target mitochondria (table 3).

4. Discussion

Fatty acid biosynthesis in higher plants is carried out by type

II FAS, which has been most extensively studied in E. coli.

The crystal structural determination of E. coli FAS enzymes

has been completed (White et al. 2005). Here, we report the

cloning of type II FAS genes from A. hypogaea for the fi rst

time including MCAT, KASI, KASII, KASIII, KR, HD, ENR

and ACP.

FabF has acetyl CoA:ACP transacylase (ACAT)

activity and seems able to initiate fatty acid synthesis, but

it may not play this role when FabH is functional (Lai and

Cronan 2003). The ACAT activities of E. coli, spinach and

Streptomyces glaucescens FabH are approximately 0.5%,

1% and 12% of the KAS activities (Tsay et al. 1992; Olsen

et al. 1999; Han et al. 1998). In avocado, KAS III and ACAT

activities have been separated from each other and the native

molecular mass of KAS III is 69 kDa and that of ACAT is

18.5 kDa (Gulliver and Slabas 1994), which indicates that

there is a separate ACAT enzyme in avocado. However, in

higher plants, it is still uncertain whether ACAT is a separate

enzyme or a partial reaction of a condensing enzyme. No

ACAT cDNA has been reported in E. coli and higher plants.

Table 2. Homologues of each type II FAS gene in peanut

Gene Accession number Clone numbers Protein ORF (bp) SNP InDel

ACP1 EG374024* 0 ACP1-1 423 4 0

EE127470 4 ACP1-2 423

EE124662 2 ACP1-2 423

EU823318 1 ACP1-2 423

ACP2 EE127527 3 ACP2-1 393 4 0

EG373603 3 ACP2-2 393

ACP3 EU823319 2 ACP3-1 375 3 0

EU823320 1 ACP3-2 375

EU823321 4 ACP3-3 375

MCAT EU823322 1 MCAT1 1158 7 1

EU823323 4 MCAT2 1158

EU823324 3 MCAT3 1161

KASI EU823325 4 KASI-1 1413 20 0

EU823326 2 KASI-2 1413

KASII EU823327 10 KASII 1647 0 0

KASIII EU823328 7 KASIII 1206 0 0

KR EU823329 4 KR1 972 3 0

EU823330 3 KR2 972

EU823331 1 KR3 972

HD EU823332 7 HD-1 663 0 0

ENR EU823333 1 ENR1 1170 18 0

EU823334 3 ENR2 1170

EU823335 2 ENR3 1170

EU823336 1 ENR3 1170

EU823337 1 ENR3 1170

* EG374024 was found in the peanut full-length cDNA library but we did not fi nd it on PCR-based homologue searching.



Sequence comparisons revealed that the primary structure

of plant plastid type II FAS enzymes was strictly conserved,

especially the catalytic residues, which suggested that

these enzymes may have similar functions in higher

plants as those in E. coli. The helix II of plant ACPs

was highly conserved, but plastid ACP and mitochondrial

ACP can be distinguished by three other α helices. E. coli

FabB and FabF shared 35.2%, 49.9% identity with A.

thaliana mitochondrial KAS, and 33.7%, 46.0% with plastid

KASI, KASII, respectively. These observations suggested

that two type II FAS systems in higher plants originated

from E. coli type II FAS. Plant type II FAS in mitochondria

was more closely related to E. coli type II FAS than that in

plastids.

Homologue numbers of each type II FAS gene expressing

in developing peanut seeds varied from 5 to 1. The number

of SNPs was also quite different in each gene. The result

was consistent with that in peanut acyl-ACP thioesterase

(GenBank accession no, EF117305-EF117309). We cloned

genomic DNAs of peanut ACP1, ACP2 and ACP3 by

PCR using gene-specifi c primers (data not shown).

More cDNAs of ACP1 and ACP3 could be deduced

from genomic DNA clones. The cDNAs not identifi ed

in developing seeds may be silent or may be expressed

in other tissues. More than two types of the 5′-terminal

of KAS cDNA were cloned by 5′-RACE. Based on these

results, we have reason to propose that more than two

homologues of most type II FAS genes exist in the peanut

genome although RT-PCR has its disadvantages in gene

cloning. Gene redundancy was widespread in the peanut

fatty acid synthesis pathway, which made this process more

sophisticated. The fi ndings obtained in this study provide the

basis for future investigation of peanut FAS genes in terms

of regulation, expression pattern analysis, evolution and

gene engineering study.

Acknowledgements

This work was supported by grants from the National High

Technology Research and Development Program of China

(2006AA10A114), Shandong Academy of Agricultural

Sciences Foundation (2006YCX030), (2007YCX001)

and Postdoctoral Foundation of Shandong Province

(200701004).

References

Abbadi A, Brummel M and Spener F 2000 Knockout of the

regulatory site of 3-ketoacyl-ACP synthase III enhances short-

and medium-chain acyl-ACP synthesis; Plant J. 24 1–9

Bolle C, Herrmann R G and Oelmuller R 1996 Different sequences

for 5′-untranslated leaders of nuclear genes for plastid proteins

affect the expression of the beta-glucuronidase gene; Plant Mol.

Biol. 32 861–868

Bonaventure G and Ohlrogge J B 2002 Differential regulation of

mRNA levels of acyl carrier protein isoforms in Arabidopsis;

Plant Physiol. 128 223–235

Carlsson A S, LaBrie S T, Kinney A J, von Wettstein-Knowles P and

Browse J 2002 A KAS2 cDNA complements the phenotypes of

the Arabidopsis fab1 mutant that differs in a single residue

bordering the substrate binding pocket; Plant J. 29 761–770

Chen J and Post-Beittenmiller D 1996 Molecular cloning of a

cDNA encoding 3-ketoacyl-acyl carrier protein synthase III

from leek; Gene 182 45–52

Clough R C, Matthis A L, Barnum S R and Jaworski J G 1992

Purifi cation and characterization of 3-ketoacyl-acyl carrier protein

synthase III from spinach; J. Biol. Chem. 267 20992–20998

Dehesh K, Tai H, Edwards P, Byrne J and Jaworski J G 2001

Overexpression of 3-ketoacyl-acyl-carrier protein synthase IIIs

in plants reduces the rate of lipid synthesis; Plant Physiol. 125

1103–1114

Fisher M, Kroon J T M, Martindale W, Stuitje A R, Slabas A R and

Rafferty J B 2000 The X-ray structure of Brassica napus β-keto

Table 3. Subcellular compartment of peanut type II FAS enzymes predicted by the TargetP1.1 Server

Protein Accession Len cTP mTP Localisation RC TPlen

ACP1 EE127470 140 0.938 0.016 Chloroplast 1 55

ACP2 EE127527 130 0.109 0.878 Mitochondria 2 40

ACP3 EU823319 124 0.082 0.923 Mitochondria 1 36

MCAT EU823322 385 0.968 0.080 Chloroplast 1 60

KI EU823325 470 0.910 0.104 Chloroplast 1 48

KII EU823327 548 0.624 0.007 Chloroplast 3 39

KIII EU823328 401 0.527 0.071 Chloroplast 5 72

KR EU823329 323 0.618 0.022 Chloroplast 3 73

HD EU823332 220 0.917 0.050 Chloroplast 1 41

ENR EU823333 389 0.937 0.143 Chloroplast 2 70

*Len, sequence length; cTP, chloroplast transit peptide; mTP, mitochondrial targeting peptide; RC, reliability class, from 1 to 5, where

1 indicates the strongest prediction; TPlen, presequence length



acyl carrier protein reductase and its implications for substrate

binding and catalysis; Structure 8 339–347

Gulliver B S and Slabas A R 1994 Acetoacyl-acyl carrier protein

synthase from avocado: its purifi cation, characterisation and

clear resolution from acetyl CoA:ACP transacylase; Plant Mol.

Biol. 25 179–191

Han L, Lobo S and Reynold K A 1998 Characterization of β-

ketoacyl-acyl carrier protein synthase III from Streptomyces

glaucescens and its role in initiation of fatty acid biosynthesis;

J. Bacteriol. 180 4481–4486

Hansen L and Kauppinen S 1991 Barley acyl carrier protein II:

nucleotide sequence of cDNA clones and chromosomal location

of the Acl2 gene; Plant Physiol. 97 472–474

Hansen and, von Wettstein-Knowles P 1991 The barley genes Acl1

and Acl3 encoding acyl carrier proteins I and III are located on

different chromosomes; Mol. Gen. Genet. 229 467–478

Heath R J and Rock C O 1996 Roles of the FabA and FabZ β-

hydroxyacyl-acyl carrier protein dehydratases in Escherichia

coli fatty acid biosynthesis; J. Biol. Chem. 271 27795–27801

Hlousek-Radojcic A, Post-Beittenmiller D and Ohlrogge JB 1992

Expression of constitutive and tissue-specifi c acyl carrier

protein isoforms in Arabidopsis; Plant Physiol. 98 206–214

Kater M M, Koningstein G M, Nijkamp H J and Stuitje A R 1991

cDNA cloning and expression of Brassica napus enoyl-acyl

carrier protein reductase in Escherichia coli; Plant Mol. Biol.

17 895–909

Keatinge-Clay A T, Shelat A A, Savage D F, Tsai S C, Miercke L

J, O’Connell J D, Khosla C and Stroud R M 2003 Catalysis,

specifi city, and ACP docking site of Streptomyces coelicolor

malonyl-CoA:ACP transacylase; Structure 11 147–154

Kimber M S, Martin F, Lu Y J, Houston S, Vedadi M,

Dharamsi A, Fiebig K M, Schmid M and Rock C O 2004 The

structure of (3R)-hydroxyacyl-acyl carrier protein dehydratase

(FabZ) from Pseudomonas aeruginosa; J. Biol. Chem. 2792

52593–52602

Klein B, Pawlowski K, Horicke-Grandpierre C, Schell J and Topfer

R 1992 Isolation and characterization of a cDNA from Cuphea

lanceolata encoding a beta-ketoacyl-ACP reductase; Mol. Gen.

Genet. 233 122–128

Kopka J, Robers M, Schuch R and Spener F 1993 Acyl carrier

proteins from developing seeds of Cuphea lanceolata Ait;

Planta 191 102–111

Lai C Y and Cronan J E 2003 β-ketoacyl-acyl carrier protein

synthase III (FabH) is essential for bacterial fatty acid synthesis;

J. Biol. Chem. 278 51494–51503

Lamppa G and Jacks C 1991 Analysis of two linked genes coding

for the acyl carrier protein (ACP) from Arabidopsis thaliana

(columbia); Plant Mol. Biol. 16 469–474

Leesong M, Henderson B S, Gillig J R, Schwab J M and Smith J

L 1996 Structure of a dehydratase-isomerase from the bacterial

pathway for biosynthesis of unsaturated fatty acids: two catalytic

activities in one active site; Structure 4 253–264

Mekhedov S, Cahoon E B and Ohlrogge J 2001 An unusual

seed-specifi c 3-ketoacyl-ACP synthase associated with the

biosynthesis of petroselinic acid in coriander; Plant Mol. Biol.

47 507–518

Mofi d M R, Finking R and Marahiel M A 2002 Recognition

of hybrid peptidyl carrier proteins/acyl carrier proteins in

nonribosomal peptide synthetase modules by the 4'-phos-

phopan tetheinyl transferases AcpS and Sfp; J. Biol. Chem. 277

17023–17031

Moretzsohn M C, Hopkins M S, Mitchell S E, Kresovich S, Valls J

F M and Ferreira M E 2004 Genetic diversity of peanut (Arachis

hypogaea L.) and its wild relatives based on the analysis of

hypervariable regions of the genome; BMC Plant Biol. 4 11

Olsen J G, Kadziola A, von Wettstein-Knowles P, Siggaard-

Andersen M, Lindquist Y and Larsen S 1999 The X-ray crystal

structure of beta-ketoacyl [acyl carrier protein] synthase I;

FEBS Lett. 460 46–52

Olsen J G, Rasmussen A V, von Wettstein-Knowles P and

Henriksen A 2004 Structure of the mitochondrial beta-ketoacyl-

[acyl carrier protein] synthase from Arabidopsis and its role in

fatty acid synthesis; FEBS Lett. 577 170–174

Pidkowich M S, Nguyen H T, Heilmann I, Ischebeck T and

Shanklin J 2007 Modulating seed beta-ketoacyl-acyl carrier

protein synthase II level converts the composition of a temperate

seed oil to that of a palm-like tropical oil;. Proc. Natl. Acad. Sci

USA 104 4742–4747

Post-Beittenmiller M A, Hlousek-Radojcic A and Ohlrogge

J B 1989 DNA sequence of a genomic clone encoding an

Arabidopsis acyl carrier protein (ACP); Nucleic Acids Res. 17

1777

Price A C, Zhang Y M, Rock C O and White S W 2001 Structure

of β-ketoacyl-[acyl carrier protein] reductase from Escherichia

coli: negative cooperativity and its structural basis; Biochemistry

40 12772–12781

Qiu X, Janson C A, Konstantinidis A K, Nwagwu S, Silverman

C, Smith W W, Khandekar S, Lonsdale J and Abdel-Meguid

S S 1999 Crystal structure of beta-ketoacyl-acyl carrier protein

synthase III. A key condensing enzyme in bacterial fatty acid

biosynthesis; J. Biol. Chem. 274 36465–36471

Rafferty J B, Simon J W, Baldock C, Artymiuk P J, Baker P J,

Stuitje A R, Slabas A R and Rice D W 1995 Common themes in

redox chemistry emerge from the X-ray structure of oilseed rape

(Brassica napus) enoyl acyl carrier protein reductase; Structure

3 927–938

Rafi S, Novichenok P, Kolappan S, Zhang X, Stratton C F, Rawat

R, Kisker C, Simmerling C and Tonge P J 2006 Structure of acyl

carrier protein bound to FabI, the FASII enoyl reductase from

Escherichia coli; J. Biol. Chem. 281 39285–39293

Scherer D E and Knauf V C 1987 Isolation of a cDNA clone for the

acyl carrier protein-I of spinach; Plant Mol. Biol. 9 127–134

Schmid K M and Ohlrogge J B 1990 A root acyl carrier protein-II

from spinach is also expressed in leaves and seeds; Plant Mol.

Biol. 15 765–778

Serre L, Verbree E C, Dauter Z, Stuitje A R and Derewenda Z S

1995 The Escherichia coli malonyl-CoA:acyl carrier protein

transacylase at 1.5-A resolution. Crystal structure of a fatty acid

synthase component; J. Biol. Chem. 270 12961–12964

Shintani D K and Ohlrogge J B 1994 The characterization of

a mitochondrial acyl carrier protein isoform isolated from

Arabidopsis thaliana; Plant Physiol. 104 1221–1229

Simon J W and Slabas A R 1998 cDNA cloning of Brassica

napus malonyl-CoA:ACP transacylase (MCAT) (fabD) and

complementation of an E. coli MCAT mutant; FEBS Lett. 435

204–206



Slabaugh M B, Tai H, Jaworski J and Knapp S J 1995 cDNA clones

encoding beta-ketoacyl-acyl carrier protein synthase III from

Cuphea wrightii; Plant Physiol. 108 443–444

Suh M C, Schultz D J and Ohlrogge J B 1999 Isoforms of acyl

carrier protein involved in seed-specifi c fatty acid synthesis;

Plant J. 17 679–688

Tai H and Jaworski J G 1993 3-Ketoacyl-acyl carrier protein

synthase III from spinach (Spinacia oleracea) is not similar to

other condensing enzymes of fatty acid synthase; Plant Physiol.

103 1361–1367

Tai H, Post-Beittenmiller D and Jaworski J G 1994 Cloning of a

cDNA encoding 3-ketoacyl-acyl carrier protein synthase III

from Arabidopsis; Plant Physiol. 106 801–802

Tsay J T, Oh W, Larson T J, Jackowski S and Rock C O 1992

Isolation and characterization of the β-ketoacyl-acyl carrier

protein synthase III gene (fabH) from Escherichia coli K-12; J.

Biol. Chem. 267 6807–6814

Voetz M, Klein B, Schell J and Topfer R 1994 Three different

cDNAs encoding acyl carrier proteins from Cuphea lanceolata;

Plant Physiol. 106 785–786

von Wettstein-Knowles P, Olsen J G, McGuire K A and Larsen S

2000 Molecular aspects of β-ketoacyl synthase (KAS) catalysis;

Biochem. Soc. Trans. 28 601–607

Wada H, Shintani D K and Ohlrogge J B 1997 Why do mitochondria

synthesize fatty acids? Evidence for involvement in lipoic acid

production; Proc. Natl. Acad. Sci. USA 94 1591–1596

White S W, Zheng J, Zhang Y M and Rock C O 2005 The structural

biology of type II fatty acid biosynthesis; Annu. Rev. Biochem.

74 791–831

Yasuno R, von Wettstein-Knowles P and Wada H 2004 Iden-

tifi cation and molecular characterization of the beta-ketoacyl-

[acyl carrier protein] synthase component of the Arabidopsis

mitochondrial fatty acid synthase; J. Biol. Chem. 279

8242–8251

Zhang Y M, Marrakchi H, White S W and Rock C O 2003a The

application of computational methods to explore the diversity

and structure of bacterial fatty acid synthase; J. Lipid Res. 44

1–10

Zhang Y M, Rao M S, Heath R J, Price A C, Olson A J, Rock C

O and White S W 2001 Identifi cation and analysis of the acyl

carrier protein (ACP) docking site on β-ketoacyl-ACP synthase

III; J. Biol. Chem. 276 8231–8238

Zhang Y M, Wu B, Zheng J and Rock C O 2003b Key residues

responsible for acyl carrier protein and β-ketoacyl-acyl carrier

protein reductase (FabG) interaction; J. Biol. Chem. 278

52935–52943

MS received 30 September 2008; accepted 2 February 2009

ePublication: 21 March 2009

Corresponding editor: VIDYANAND NANJUNDIAH

cloning and sequence analysis of putative type ii fatty

Documents