Submitted 20 July 2017Accepted 9 September 2017Published 5 October 2017

Corresponding authorKatia Cristina Cruz Capelkatiacapel7gmailcom

Academic editorJames Reimer

Additional Information andDeclarations can be found onpage 13

DOI 107717peerj3873

Copyright2017 Capel et al

Distributed underCreative Commons CC-BY 40

OPEN ACCESS

Clone wars asexual reproductiondominates in the invasive range ofTubastraea spp (Anthozoa Scleractinia)in the South-Atlantic OceanKatia Cristina Cruz Capel123 Robert J Toonen2 Caio TCC Rachid4Joel C Creed35 Marcelo V Kitahara367 Zac Forsman2 and Carla Zilberberg13

1Departamento de Zoologia Universidade Federal do Rio de Janeiro Rio de Janeiro Brazil2 School of Ocean amp Earth Science amp Technology Hawairsquoi Institute of Marine Biology University of Hawairsquoi atManoa Kanersquoohe Hawairsquoi United States of America

3Coral-Sol Research Technological Development and Innovation Network Brazil4 Instituto de Microbiologia Paulo de Goacutees Universidade Federal do Rio de Janeiro Rio de Janeiro Brazil5Departamento de Ecologia Universidade do Estado do Rio de Janeiro Rio de Janeiro Brazil6Departamento de Ciecircncias do Mar Universidade Federal de Satildeo Paulo Santos Brazil7Centro de Biologia Marinha Universidade de Satildeo Paulo Satildeo Sebastiatildeo Brazil

ABSTRACTAlthough the invasive azooxanthellate corals Tubastraea coccinea and T tagusensis arespreading quickly and outcompeting native species in the Atlantic Ocean there is littleinformation regarding the genetic structure and path of introduction for these speciesHere we present the first data on genetic diversity and clonal structure from these twospecies using a new set of microsatellite markers High proportions of clones wereobserved indicating that asexual reproduction has a major role in the local populationdynamics and therefore represents one of the main reasons for the invasion successAlthough no significant population structure was found results suggest the occurrenceof multiple invasions for T coccinea and also that both species are being transportedalong the coast by vectors such as oil platforms and monobouys spreading theseinvasive species In addition to the description of novel microsatellite markers thisstudy sheds new light into the invasive process of Tubastraea

Subjects Biodiversity Conservation Biology Ecology Genetics Marine BiologyKeywords Sun-coral Clone structure Microsatellites Population genetics T coccineaT tagusensis

INTRODUCTIONThe marine environment is continuously subjected to multiple stressors many of whichare associated with human activities (eg over-exploitation of resources pollution climatechange and invasive species) (Halpern et al 2014 Gallardo et al 2016) Among thesestressors invasive species are considered to be a major threat to biodiversity (Molnaret al 2008) with the potential to quickly trigger changes in native communities and theecosystem services and functions which can have wide-ranging negative impacts There arenumerous examples of marine invasions which impact humans or native biota such as intheMediterranean Sea with the invasion of the ctenophoreMnemiopsis leidyi which caused

How to cite this article Capel et al (2017) Clone wars asexual reproduction dominates in the invasive range of Tubastraea spp (Antho-zoa Scleractinia) in the South-Atlantic Ocean PeerJ 5e3873 DOI 107717peerj3873

the collapse of the fishing industry (Shiganova 1998) the algae Womersleyella setacea thatnegatively affected sponge reproduction (Caralt amp Cebrian 2013) and the lionfish Pteroisspp responsible for a reduction in the native fish recruitment in the Atlantic (Albins ampHixon 2008)

Scleractinian corals are known to play a key role in the marine environment by buildingstructurally complex and highly diverse ecosystems (Reaka-Kudla 1997) As ecosystemengineers that are under threat globally (Hoegh-Guldberg 1999 Pandolfi et al 2003)scleractinian corals are rarely seen as an environmental risk However three scleractinianspecies from the genus Tubastraea were introduced and are spreading rapidly throughoutthe Western Atlantic Ocean (De Paula amp Creed 2004 Fenner 2001 Fenner amp Banks2004 Sammarco Atchison amp Boland 2004 Sammarco Porter amp Cairns 2010 Capel 2012Sampaio et al 2012 Costa et al 2014 Silva et al 2014) threatening native and endemicspecies (Mantellato et al 2011 Santos Ribeiro amp Creed 2013 Creed 2006) and foulingman-made structures and vessels

Tubastraea is an azooxanthellate dendrophyllid genus from the Pacific and IndianOceans that was first reported in the Caribbean in 1943 (Vaughan amp Wells 1943) Sincethen three species have been identified in the Western Atlantic Ocean (1) T coccineanow reported along 9000 km of coastline of the Western Atlantic Ocean from Florida(2647primeN 8002primeW) (Fenner amp Banks 2004) to Southern Brazil (2717primeS 4822primeW) (Capel2012) (2) T tagusensis along the Brazilian coast (De Paula amp Creed 2004) and (3)T micranthus in the Gulf of Mexico (Sammarco Porter amp Cairns 2010) All three areconsidered opportunistic species most likely associated with transport on ships andor oilplatforms in the Caribbean Gulf of Mexico and Brazilian coast (Cairns 2000 Castro ampPires 2001 Sammarco Porter amp Cairns 2010)

Once established invasive species can alter the structure of local communities displacingand outcompeting native species (Vitousek 1990Mooney amp Cleland 2001 Lages Fleury ampMenegola 2011 Cure et al 2012 Santos Ribeiro amp Creed 2013 Miranda Cruz amp Barros2016) In contrast to the native range where Tubastraea is largely restricted to shaded ormarginal habitats studies on oil rigs in the Gulf of Mexico have shown that both T coccineaand T micranthus are excellent competitors and can overgrow other species (Hennessey ampSammarco 2014 Sammarco et al 2015) Similarly in Brazil T coccinea and T tagusensiscan cover up to 100 of the available surface in some areas (Mantellato et al 2011) killingnative and endemic coral species upon direct contact (Creed 2006 Santos Ribeiro amp Creed2013Mantellato amp Creed 2014 Miranda Cruz amp Barros 2016)

Fast growth rate rapid range expansion early reproductive age propagule pressure anda wide variety of reproductive and survival strategies are biological characteristics usuallyassociated with invasion success (Sax amp Brown 2000 Sakai et al 2001 Lockwood Casseyamp Blackburn 2005 Sax et al 2007) Tubastraea species possess all of these characteristics(Cairns 1991 Ayre amp Resing 1986 Glynn et al 2008 Harrison 2011 Capel et al 2014De Paula Pires amp Creed 2014) which are enhanced by the fact that within the invadedareas they generally lack natural predators and dominant competitors In addition alarge number of infested vectors (eg oil platforms and monobuoys) have been recorded

Capel et al (2017) PeerJ DOI 107717peerj3873 221

transporting Tubastraea spp along the Brazilian coast leading to rapid range expansionthroughout the Southwestern Atlantic Ocean (Creed et al 2016)

Asexual reproduction improves coral ability to reach high abundance (Ayre amp Miller2004) and may be an important trait of many invasive species mainly in the first stageof invasion (Taylor amp Hastings 2005) When associated with early reproductive ageand high propagule pressure it can rapidly increase abundance Asexual productionof brooded planulae has been reported in several anthozoans including actinarians(Ottaway amp Kirby 1975 Black amp Johnson 1979) octocorals (Brazeau amp Lasker 1989) andscleractinians (Stoddart 1983 Ayre amp Resing 1986) Although T coccinea and T diaphanaappear to reproduce mainly by asexually produced larvae (Ayre amp Resing 1986) there is noinformation for their congeners and the proportion of sexual versus asexual reproductionremains unknown within the genus Furthermore Ayre amp Resing (1986) were able to scoreonly two allozyme loci to infer asexual production of brooded larvae of Tubastraea spp andthe use of a larger number of more polymorphic loci such as microsatellites is desirableto corroborate their findings

Although Tubastraea species are spreading rapidly and changing local benthiccommunities throughout the tropical Western Atlantic information about their geneticdiversity and reproductive strategies are still scarce The study of reproductive strategiesof invasive species is fundamental to understanding the invasion process preventing newinvasions development of effective management strategies and resolving the ecologicaland evolutionary processes involved in their invasion success (Sakai et al 2001 Sax et al2007) However to date there was no molecular marker developed to perform such studieswith Tubastraea Here we report 12 novel microsatellite loci specifically developed forT coccinea and cross-amplified in T tagusensis and investigate the clonal structure andgenetic diversity of populations of these alien invasive corals in the Southwestern AtlanticOcean

MATERIALS AND METHODSSampling and DNA extractionMicrosatellite development was performed using samples of T coccinea collected fromBuacutezios Island (2347primeS 4508primeW 6 m in depth) and also from a monobuoy (IMODCO 4)at the Satildeo Sebastiatildeo channel (2348primeS 4524primeW 5 m of depth) Brazil Additional samplesof T coccinea and T tagusensis collected from Todos-os-Santos Bay (TSB) northeasternBrazil (1249primeS 3846primeW) and Ilha Grande Bay (IGB) (2306primeS 4415prime W) southeasternBrazil (sim24 coloniesspecieslocality) were used to test the markers and evaluate theirgenetic diversity (Fig 1) Samples were preserved in 96 ethanol or CHAOS buffer (Fukamiet al 2004) prior to extraction Total DNA was extracted using the Qiagen DNeasy tissueand blood kit following the manufacturerrsquos instructions or using the PhenolChloroformmethod described by Fukami et al (2004)

Microsatellite development and primer testingTwo genomic libraries were constructed at the National Laboratory for ScientificComputing (LNCC Petroacutepolis Brazil) using the 454 Genome Sequencer FLX platform

Capel et al (2017) PeerJ DOI 107717peerj3873 321

Figure 1 Distributional range and sample localities on Southwestern AtlanticMap showing the dis-tributional range of Tubastraea spp on Southwestern Atlantic with the northern (NL) and southern (SL)limits of the distribution and sampled localities Todos-os-Santos Bay (TSB) and Ilha Grande Bay (IGB)are showed by dark-gray stars light-gray star represent Buacutezios Island and Satildeo Sebastiatildeo channel where ini-tial collections to isolate microsatellite loci were performed Map layout from httpd-mapscomcartephpnum_car=1521amplang=en

(Fernandez-Silva et al 2013) Reads were trimmed for adapters and quality using theFASTX-Toolkit The software Newbler 23 (Roche Basel Switzerland) was used to performthe de novo assembly The programs MSATCOMMANDER 08 (Faircloth 2008) andSSRfinder were used to search for di- tri- tetra- penta- and hexa-nucleotide repetitionsThirty-nine pairs of primers flanking the microsatellite regions were designed usingPrimer3 (httpbioinfouteeprimer3-040) and primer characteristics were checkedusing OligoAnalyzer 31 (httpswwwidtdnacomcalcanalyzer) Forward primers weredesigned with a M13 tail at their 5prime end (TGT AAA ACG ACG GCC AGT) for dye labeled(6-FAM VIC NED or PET) primers annealing to the replicated strand during PCRreactions (Schuelke 2000)

Capel et al (2017) PeerJ DOI 107717peerj3873 421

A total of 47 specimens of T coccinea and 48 T tagusensis were amplified by PolymeraseChain Reactions (PCRs) PCRs were performed in 10 microl reactions including 02 microM offorward primer with M13 tail 04 microM of labeled primer (M13 with VIC NED PET or6-FAM fluorescent dyes) 08 microM of reverse primer 1U GoTaq (Promega Fitchburg WIUSA) 1times PCR Buffer (Promega) 020 mM dNTPs (Invitrogen Carlsbad CA USA)between 15 and 25 mM MgCl2 (Table 1) 10 microg BSA (Invitrogen) and 5ndash10 ng of DNACycling conditions were 95 C for 3 min followed by 5 cycles at 95 C 30 s 52ndash62 C(Table 1) 30 s 72 C 45 s and 30 cycles at 92 C 30 s 52ndash62 C 30 s 72 C 55 s witha final extension at 72 C for 30 min (Toonen 1997) Amplification was verified in 2agarose gel PCR products were pooled with GS600-LIZ size standard (Applied BiosystemsWalthamMAUSA) and genotyped in theABI 3500 genetic Analyzer (Applied Biosystems)Genotypes were determined using the program Geneious 719

Statistical analysesClonal structure of each species was assessed using the lsquoGenClonersquo on R 323 package(R Core Team 2015) Samples with the same alleles at all loci (ramets) were assignedto the same multilocus genotype (MLG or genets) and considered to be a product ofasexual reproduction To check if individuals with the same MLG were truly clones theprobability of finding identical MLGs resulting from distinct sexual reproductive events(Psex) was calculated following Arnaud-Haond et al (2007) When Psex lt 0001 samplesare considered ramets belonging to the same genet In order to avoid the overestimationof genotype numbers due to scoring errors or somatic mutations (Douhovnikoff amp Dodd2003) a second analysis calculating the genetic distance among all pairs of genets wasperformed Based on the genetic distances MLGs that differed at only one allele wereassigned to the same multi-locus Lineage (MLL) (Arnaud-Haond et al 2007) For thegenetic diversity and population structure analyses only unique MLLs were considered

To assess the clonal structure of each population two indexeswere calculated as proposedby Arnaud-Haond et al (2007) (1) clonal richness to evaluate the proportions of clones ineach population (R=Gminus1Nminus1) where G represents distinct multilocus lineages (MLL)and N is the total number of individuals sampled The index ranges from zero (when allindividuals are clones) to one (when all samples analyzed correspond to a different MLL)and (2) the genotypic evenness to evaluate the equitability in the distribution of the MLLcalculated by the Simpsonrsquos complement evenness index (V = (DminusDmin)(DmaxminusDmin))where D represents the observed diversity Dmax the value assumed if all genets have thesame number of ramets and Dmin the diversity value when all but one genet has oneindividual (Hurlbert 1971) This index ranges from zero (when one genet dominates thepopulation) to one (when genets each have the same number of ramets)

Quality control of loci followed Selkoe amp Toonen (2006) To assess each populationrsquosgenetic diversity the number of alleles (Na) observed (Ho) and expected heterozygosities(He) were calculated using the lsquodiveRsityrsquo in R 323 package (R Core Team 2015)Significant deviations from HardyndashWeinberg equilibrium (HWE) and linkage equilibriumwere tested with the FSTAT program (Goudet 1995) The occurrence of null alleles wasinvestigated using the Micro-Checker program (Van Oosterhout et al 2004) To measure

Capel et al (2017) PeerJ DOI 107717peerj3873 521

Table 1 Description of Tubastraea coccinea and Tubastraea tagusensismicrosatellite loci with their respective GeneBank Accession number Forward primers in-clude an M13 sequence (5prime-TGTAAAACGACGGCCAGT-3prime)

LocusAccession number

Primer sequence Repeatmotif

Species TA ( C)[ ] MgCl2(mM)

Range(bp)

TSB (N = 23-Tc24-Tt) IBG (N = 24-Tc24-Tt)

Na Ho He F IS Na Ho He F IS

FTGTAAAACGACGGCCAGTACTTCGGTGATCGGACGAG-PET T coccinea 562 a

Tco1 KY198738

R AGCACGGGTACTTGCTTTG(GTT)6

T tagusensis 562567ndash600

2 012 018 000 1 000 000 NA

F TGTAAAACGACGGCCAGTGTGGAGAGTGAATAAGCTTGGG-NED T coccinea 602 2 100 050 minus100 2 100 050 minus100

Tco4 KY198739

R GCCTGATGGTTTCTTGAGGTC(TCA)4

T tagusensis 582253ndash259

2 040 032 minus014 2 033 028 000

F TGTAAAACGACGGCCAGTTCAGGAGCCGATTAATACCTG-6FAM T coccinea 542 5 050 076 039 3 020 034 050

Tco5 KY198740

R TGTGCAGTGAATGTGCTCAAG(GAAA)5

T tagusensis 5425368ndash432

2 060 042 minus033 2 067 044 minus033

F TGTAAAACGACGGCCAGTGGTGCAGTGTAAATTGGTTCG-PET T coccinea 54 2 2 100 050 minus100 2 100 050 minus100

Tco8 KY198741

R GACAAGTGGAAAGCGGACG(GGA)6

T tagusensis 522343ndash349

2 100 050 minus100 2 100 050 minus100

F TGTAAAACGACGGCCAGTTTGACCACGTACTGCCAAG-VIC T coccinea 602 a

Tco9 KY198742

R TCTGTTCAGAGAGCTCCGC(TA)10

T tagusensis 602347ndash357

2 020 018 000 1 000 000 NA

F TGTAAAACGACGGCCAGTGTGCCCTAGGTCCATGGTTT-VIC T coccinea 6215 3 070 051 minus031 3 100 057 minus071

Tco29 KY198743

R CCGGCTTCTATATAGGCTTCC(ATA)20

T tagusensis 582211ndash222

3 020 046 064 1 000 000 NA

F TGTAAAACGACGGCCAGTGGGAATTCGGATGCAATTAT-6FAM T coccinea 6015 3 100 061 minus063 3 100 058 minus-067

Tco30 KY198744

R CTCTGTGGAATGAGCTGCAA(ACAT)6

T tagusensis 60225252ndash264

2 100 050 minus100 2 100 050 minus100

F TGTAAAACGACGGCCAGTGCGTGGTCTGGTCTTTTCAT-6FAM T tagusensis 582 2 100 050 minus100 2 100 050 minus100

Tco32a KY198745

R ACCCACTTTGAGGTGTTTGG(ATA)13 240ndash246

Tco32b KY198745 a T tagusensis 270ndash276 2 100 050 minus100 3 100 061 minus050

F TGTAAAACGACGGCCAGTGCGCCTACTACCACACGAAT-PET T coccinea 582 2 038 031 minus020 2 017 015 000

Tco34 KY198746

R TCCTTTCTACAGCGCACCTT(TTA)19

T tagusensis 582189ndash217

3 080 058 minus028 3 100 061 minus050

F TGTAAAACGACGGCCAGTGCAATGACAACAGCCAGAAC-VIC T coccinea 5815 b b

Tco36 KY198747

R TTTCGTCTGCCACATTCTTG(ATA)15 238ndash250

F TGTAAAACGACGGCCAGTAAACATTCGATTCCCACTCG-NED T coccinea 6215 4 100 074 minus032 2 100 050 minus100

Tco37 KY198748

R ACCCGGCCACTAATATTTCC(CTA)24

T tagusensis 6215242ndash263

3 100 062 minus050 3 100 061 minus050

F TGTAAAACGACGGCCAGTTTTGAGTTTGAGTTTATTGACTCCTT-NED T coccinea 5815 b b

Tco38 KY198749

R GGAGTAAGCTTAGAGGGGTGCT(TACA)6 227ndash235

NotesTA primerrsquos annealing temperature [ ] MgCl2 concentration of magnesium chloride N number of individuals genotyped Na number of alleles He expected heterozygosity Ho observed het-erozygosity FIS inbreeding coefficient (negative values indicate an excess of heterozygotes)

aLoci with evidence of linkage disequilibriumbLoci with evidence of null alleles

Capeletal(2017)PeerJD

OI107717peerj3873

621

population structure two indexes were calculated using the programs Genetix (Belkhir etal 2004) and GenoDive (Meirmans amp Van Tienderen 2004) (1) Wrightrsquos fixation indexFST ranging from zero when different populations have identical alleles frequenciesto one when each population has different fixed alleles (Wright 1965) However whenapplied to highly polymorphic markers such as microsatellites this index never reachesone and can underestimate genetic differentiation (Hedrick 1999 Meirmans amp Hedrick2011 Bird et al 2011) The second measure (2) Meirmans and Hedrickrsquos differentiationindex G

primeprime

ST is a standardized measure rescaled from zero to one based on the maximumvalue of G

primeprime

ST which simplifies interpretation of the degree of genetic differentiation amongpopulations when using highly polymorphic microsatellite markers (Meirmans amp Hedrick2011 Bird et al 2011)

A Bayesian analysis was performed to estimate the number of genetic clusters in thedataset using STRUCTURE v 234 software (Pritchard Stephens amp Donnelly 2000) withthe admixture ancestry model and correlated allele frequency The analysis was performedwith an initial burn-in of 500000 cycles followed by 500000 additional cycles and thenumber of clusters (K ) tested varied from one to three with 15 iterations for each K -valueA higher range in the number of clusters (K ranging from one to five) was also tested toverify possible substructure within the populations The most likely K -value was estimatedby estimating the lsquolsquolog probability of datarsquorsquo for each value of K (mean LnP(K )) (PritchardStephens amp Donnelly 2000) using STRUCTURE HARVESTER (Earl amp Von Holdt 2012)The 1K criterion frequently used in population genetic studies is applied for datasetswith more than two populations and as one of the hypotheses here is that the two localitiesare one panmitic population this criterion was not used in the present work (EvannoRegnaut amp Goudet 2005)

RESULTSCharacterization of microsatellite markersThe two 454 runs resulted in a total of 329832 reads with an average size of plusmn7085bp A total of 1077 regions with 2ndash6 bp microsatellite repeats with at least four unitswere found Among these regions 39 were selected for primer design based on thesize and position of the repeat within the sequence and the primer characteristics (eglacking primer-dimer formation) Within these 11 and 10 were successfully amplifiedand genotyped for Tubastraea coccinea and T tagusensis respectively (Accession numbersKY198738ndashKY198749) While two loci failed to amplify for T tagusensis (Tco36 andTco38) this species also exhibited two loci at a single locus with no evidence of linkagedisequilibrium between them (Tco32a and Tco32b) so both were included in theseanalyses

Evidence for null alleles for T coccinea TSB population was observed in the sametwo loci (Tco36 and Tco38) that failed to amplify for T tagusensis Since both locihad only homozygote genotypes at the two analyzed localities these loci were removedfrom the genetic diversity analyses The loci Tco1 and Tco9 showed evidence of linkagedisequilibrium with other loci and were also removed from the remaining analyses The

Capel et al (2017) PeerJ DOI 107717peerj3873 721

Table 2 Genetic diversity of Tubastraea coccinea and T tagusensis in two localities on the Southwestern Atlantic Ocean Todos os Santos Bay(TSB) and Ilha Grande Bay (IGB) Brazil

Specie Location N MLG MLL R V A AR Ap Ho He F IS

TSB 23 13 13 055 0845 21 274 4 080 056 minus0380T coccinea

IGB 24 6 6 021 113endash16 17 218 0 077 045 minus0651TSB 24 7 5 017 054 25 198 4 067 043 minus0468

T tagusensisIGB 24 6 3 009 104endash16 22 187 1 064 037 minus0615

NotesN Number of individuals sampled MLG multilocus genotype MLL multilocus lineages R clonal richness V genotypic evenness β pareteo distribution A allelesnumber AR allele richness Ap number of private alleles Ho observed heterozigosities He expected heterozigosities F IS inbreeding coefficient

number of alleles per locus ranged from one to five in T coccinea and one to four in Ttagusensis Between localities Ho ranged from 038 to 1 (TSB) and 017 to 1 (IGB) for Tcoccinea and from 02 to 1 (TSB) and 0 to 1 (IGB) for T tagusensis He ranged from 031 to076 (TSB) and 015 to 058 (IGB) for T coccinea and from 018 to 062 (TSB) and 0 to 061(IGB) for T tagusensis (Table 1) In general the observed heterozygosity was higher thanexpected for most loci in both populations of both species with up to 100 of individualsbeing heterozygous at some loci (Table 1) although no significant deviation from HWEwas observed

ClonalityPsex values observed were highly significant (lt0001) for all but two and seven individualsof T coccinea and T tagusensis respectively Thus these data do not support the hypothesisof several individuals with the same MLG having originated by chance from distinct sexualreproduction events A high proportion of clones were observed at both localities for bothspecies (Table 2) For T coccinea at TSB of the 23 colonies sampled 13 MLLs were foundwhile at IGB only six MLLs out of the 24 colonies sampled were found T tagusensis hadfive (at TSB) and three (at IGB) unique MLLs among the 24 sampled colonies at eachlocality (Table 2) Missing values were considered as different alleles by the program andalthough only specimens with missing information at no more than one locus were keptit is important to note that the final number of MLL might be overestimated slightly

Clonal richness observed for T coccinea indicates that IGB is mostly composed of clones(R= 022) with only six MLLs out of 24 individuals while TSB has nearly half of theindividuals comprised of clones (13 MLL in 23 individuals sampled R= 055) (Table 2)In addition to the low MLL diversity at IGB 19 individuals had the same predominantMLL which was observed by the evenness indexes (V = 113minus16) Conversely the TSBpopulation of T coccinea had more equally distributed MLLs with the most common onebeing shared among only 4 individuals (V = 085) For T tagusensis both populations werecomposed mainly of clones with very low clonal richness (IGB R= 009 TSB R= 017)Similarly to what was observed for T coccinea MLLs were more equally distributed atTSB with 14 individuals belonging to the same MLL (V = 054) while in IGB the mostcommon one was shared among 22 individuals (V =minus104pminus16)

Capel et al (2017) PeerJ DOI 107717peerj3873 821

Genetic diversity and population structureOnly unique MLLs were used to assess genetic diversity and population structure in eachspecies For both species TSB had higher number of alleles allelic richness and numberof private alleles compared to IGB with T coccinea presenting the more accentuateddifferences (Table 2) There were no significant deficits of heterozygosity both observed(Ho) and expected (He) heterozygosity were similar when comparing between localitiesfor both T coccinea (TSB 080 and 056 IGB 077 and 045) and T tagusensis (TSB 067and 043 IGB 064 and 037) The inbreeding coefficient (F IS) although not significantwas negative for both localities and in both species indicating an excess of heterozygotes(Table 2)

FST and Gprimeprime

ST values were 006 (p= 008) and 013 (p= 007) for T coccinea andindistinguishable from zero (p= 069 and p= 069) for T tagusensis The lack of significantpopulation structure among the sampled localities indicates similar allele frequencies forboth species across these sites Although Bayesian analysis recovered two genetic clustersfor T coccinea for both ranges of K tested these groups are not a function of populationstructure between localities (Fig 2) but instead reflect the presence of population structurewithin each locality Furthermore there is no evidence of interbreeding between the twoclusters and the FST values between these sites is likely a result of the strikingly differentproportion of these two groups in each site In contrast no clustering was observed betweenor within localities for T tagusensis with the most likely K value being one for both rangesof K tested (Fig 2)

DISCUSSIONThe novel microsatellite markers reported herein will enable further studies regarding thegenetic diversity and population structure of Tubastraea spp corals in the Atlantic andnative ranges of these invasive populations Using thesemicrosatellites this study shows thatboth invasive coral species (T coccinea and T tagusensis) have high proportions of clonesat both localities on the Brazilian coast with identical multilocus lineages (MLLs) foundin sites separated by more than 1500 km The results indicate that asexual reproductiondominates in the invasive range of Tubastraea spp in the Southwestern Atlantic and despitethe large distance between localities no significant population structure could be found Incontrast there are clear signs of population structure across this same region in an endemicspawning coral species (Mussismilia hispida Azevedo 2015)

Our results support previous work reporting reproduction via asexual larvae inT coccinea (Ayre amp Resing 1986) Likewise the high proportion of clones found at bothsampled localities for T tagusensis indicates likely reproduction by asexual larvae for thisspecies also a reproductive mode previously recorded for only three scleractinian speciesPocillopora damicornis (Stoddart 1983) Tubastraea diaphana and T coccinea (Ayre ampResing 1986) Indeed a study on the reproductive strategies of T coccinea and T tagusensisin the Southwestern Atlantic observed a small number of spermaries and the presence ofembryos and planula at different times of the year concluding that asexual reproductioncould be important for both species (De Paula Pires amp Creed 2014) For most corals

Capel et al (2017) PeerJ DOI 107717peerj3873 921

Figure 2 Bayesian clustering analyses for Tubastraea coccinea and T tagusensis (A) and (B) shows themost likely K -value estimated by the mean of estimated lsquolsquolog probability of datarsquorsquo for each value of K forT coccinea (K = 2) and T tagusensis (K = 1) respectively (C) and (D) shows the genetic clusters whereeach individual is represented by a vertical bar with different colors indicating the relative proportion ofeach genetic cluster TSB Todos os Santos Bay IGB Ilha Grande Bay

clonality is a result of mechanical fragmentation due to physical disturbances (Fosteret al 2013 Nakajima et al 2015) T coccinea and T tagusensis however are not proneto fragmentation so the high number of clones observed for both species in this studyseems more likely to result from asexually produced larvae Nevertheless it is desirableto confirm the production of asexual larvae for both T coccinea and T tagusensis byperforming paternity studies in the future

For invasive species asexual reproduction can be crucial in the first stage of invasionwhen sexual partners are scarce or absent because it significantly enhances the chances ofsurvival for the colonists (Taylor amp Hastings 2005) Successful invasions originating froma few clonal genotypes have been previously recorded for plants (Ren Zhang amp Zhand2005 Liu et al 2006) and other cnidarians (Reitzel et al 2008) Asexual reproduction isdominant in the invasive range and it may have contributed to the invasive success ofTubastraea in the Southwestern Atlantic where the rocky shores provide a suitable habitatand release from enemies (Enemy Release Hypothesis Keane amp Crawley 2002) At IGB

Capel et al (2017) PeerJ DOI 107717peerj3873 1021

both studied coral species have high percentage of clones and an extremely low genotypicevenness indicating that most colonies are clones belonging to the same genet Samplingmore areas surrounding each collection site is needed to thoroughly examine clonaldiversity for these regions but particularly in TSB where samples were more widely spacedthis observation supports the role of asexual reproduction in increasing local abundanceGregarious settlement has been previously observed for both T coccinea (Glynn et al2008 De Paula Pires amp Creed 2014) and T tagusensis (De Paula Pires amp Creed 2014)although these studies did not determine if the aggregated larvae were sexually or asexuallyderived It is noteworthy that T coccinea has higher numbers of MLLs clonal richnessand genotypic evenness at TSB than at IGB suggesting increased occurrence of sexualreproduction or a greater number of successful colonists at the former site Rates ofsexual and asexual reproduction can be highly variable among geographic regions in othercorals (Baums Miller amp Hellberg 2006 Noreen Harrison amp Van Oppen 2009 Combosch ampVollmer 2011 Gorospe amp Karl 2013) but it remains unknown what governs the differencein the proportion of sexual and asexual reproduction at different localities Several factorscan influence both genotypic and genetic diversity in invasive species including the numberof invasions the genetic diversity of the source population(s) and a variety of biologicalfactors such as the main reproductive strategy adopted by the species (Dlugosch amp Parker2008) Although sexual reproduction might also occur in Tubastraea the results obtainedfor T coccinea might be an effect of the occurrence of recent multiple introductions fromdifferent native populations (Roman amp Darling 2007) Another hypothesis would be thepresence of cryptic species which has been found in other scleractinian corals (Pinzoacutenamp Weil 2011 Warner Van Oppen amp Willis 2015 Nakajima et al 2017) Morphologicalanalyses combined with molecular data including native populations are necessary tocorroborate this hypothesis

A decrease in genetic diversity as a result of a small founding population has beenpreviously recorded for several invasive populations (Roman amp Darling 2007 Geller et al2008 Johnson amp Woollacott 2015 Wrange et al 2016 but see Gaither et al 2010 GaitherToonen amp Bowen 2012 for counter-examples) Here we report excess of heterozygosity forboth populations of both species and the presence of up to 100 heterozygous individualsat some loci (Table 1) High levels of heterozygosity can result from an isolate-breakingeffect when multiple introductions mix previously separated native populations (Holland2000 Hamilton 2010) However in this case there is no evidence of mixing between thetwo genetic clusters (Fig 2) indicating that they are not interbreeding Thus it seems morelikely that TSB and IGB were colonized by different native populations followed by recenttransport between localities without sufficient time for them to interbreed although thepossibility of cryptic species that are incapable of interbreeding should also be consideredIf the first scenario of introduction by different native populations proves true the highheterozygosity could be either a result of a founder effect in which the new area wasby chance colonized by a higher number of heterozygote genotypes or due to a higherfitness of the heterozygote genotypes either of which could be propagated by asexualreproduction (De Meeus amp Balloux 2005) Alternatively Gaither Toonen amp Bowen (2012)showed that introduced fishes in Hawairsquoi with a known history actually had higher and

Capel et al (2017) PeerJ DOI 107717peerj3873 1121

more even genetic diversity than was observed in the native range and such an effect couldalso explain the observed pattern here In contrast to what is observed with T coccinea werecover only a single genetic cluster for T tagusensis between both populations This singlecluster could result from either invasion of both localities from the same source populationor a secondary invasion along the Brazilian coast from the original locality being spreadto another Unlike T coccinea which is now considered cosmopolitan (Cairns 2000) Ttagusensis has a restricted distribution (Cairns 1991) and may have naturally low geneticdiversity The distinction between these species is reminiscent of the pattern reported byGaither Bowen amp Toonen (2013) in which population structure of species in their nativerange predicts the diversity and rate of spread in the invasive range

Considering that (i) both T coccinea and T tagusensis brood larvae competent for onlysim18 days (in aquaria) that typically display gregarious settlement (Glynn et al 2008 DePaula Pires amp Creed 2014) and (ii) the absence of Tubastraea in extensive areas betweenthe two localities it is highly unlikely that they are connected through larval dispersal Onthe other hand oil platforms are known to be moved between these regions (Sampaio etal 2012) and are considered the main vector for the introduction of Tubastraea into thesouthwestern Atlantic (Castro amp Pires 2001 Creed et al 2016) Thus our data showing alack of structure between localities and the occurrence of shared MLLs for each speciesamong these distant sites indicate that anthropogenic vectors such as oil platformsmonobuoys or other vessels have played an important role in dispersing these alieninvasive species and possibly assisting other species to spread along the coast (Almeida etal 2015 Creed et al 2016)

CONCLUSIONSInvasive Tubastraea spp are spreading quickly throughout the Atlantic in some areascovering up to 100 of the available surface (Mantellato et al 2011) and outcompetingnative and endemic species (Mantellato et al 2011 Santos Ribeiro amp Creed 2013 Creed2006) Despite this documented impact and concern little is known about the geneticdiversity and reproductive strategies of Tubastraea species globally This study provides thefirst survey of genetic diversity and likely reproductive strategies along the southwesternAtlantic coast demonstrating that asexual reproduction has an important role in thepopulation dynamics of both T coccinea and T tagusensis and is probably a relevantfeature leading to their invasive success Results also indicate that there were likely atleast two different populations of T coccinea introduced into the southwestern Atlantic Amolecular systematic examination of the genus is highly recommended in order to checkfor the occurrence of cryptic species Future studies should focus on the identification ofpotential source populations and the global phylogeograpy of Tubastraea with the goal oftracking and limiting future invasions as well as the establishment of effective managementand prevention strategies

Capel et al (2017) PeerJ DOI 107717peerj3873 1221

ACKNOWLEDGEMENTSWe are grateful to Antonio Soleacute-Cava for helping editing the first set of Next-GenerationSequencing data and to Marcelo Mantellato and Projeto Coral-Sol for samples We arealso thankful to Diane Bailleul for all the support on the clonal analyses This is ScientificContribution No 30 of the Projeto Coral-Sol

ADDITIONAL INFORMATION AND DECLARATIONS

FundingThis work was supported by Coordenacatildeo de Aperfeicoamento de Pessoal de NiacutevelSuperior (Joel C Creed Ciecircncias do Mar 11372010) Fundacatildeo Carlos Chagas Filhode Amparo agrave Pesquisa do Estado do Rio de Janeiro (Katia Cristina Cruz Capel JoelC Creed and Carla Zilberberg FAPERJ-E-260100030312014 PensaRio Joel C CreedE262012862014) Conselho Nacional de Desenvolvimento Cientiacutefico e Tecnoloacutegico(Joel C Creed CNPq-3053302010-1) and Fundacatildeo de Amparo agrave Pesquisa do Estado deSatildeo Paulo (Marcelo V Kitahara FAPESP 201401332-0) and Award NSF-OA14-16889(National Science Foundation) The funders had no role in study design data collectionand analysis decision to publish or preparation of the manuscript

Grant DisclosuresThe following grant information was disclosed by the authorsCoordenacatildeo de Aperfeicoamento de Pessoal de Niacutevel Superior 11372010Fundacatildeo Carlos Chagas Filho de Amparo agrave Pesquisa do Estado do Rio de JaneiroFAPERJ-E-260100030312014 E262012862014Conselho Nacional de Desenvolvimento Cientiacutefico e Tecnoloacutegico CNPq-3053302010-1Fundacatildeo de Amparo agrave Pesquisa do Estado de Satildeo Paulo FAPESP 201401332-0National Science Foundation NSF-OA14-16889

Competing InterestsRobert J Toonen is an Academic Editor for PeerJ

Author Contributionsbull Katia Cristina Cruz Capel conceived and designed the experiments performed theexperiments analyzed the data wrote the paper prepared figures andor tables revieweddrafts of the paperbull Robert J Toonen wrote the paper reviewed drafts of the paperbull Caio TCC Rachid analyzed the data reviewed drafts of the paperbull Joel C Creed contributed reagentsmaterialsanalysis tools wrote the paper revieweddrafts of the paperbull Marcelo V Kitahara contributed reagentsmaterialsanalysis tools wrote the paperreviewed drafts of the paperbull Zac Forsman wrote the paper reviewed drafts of the paperbull Carla Zilberberg conceived and designed the experiments contributed reagentsmateri-alsanalysis tools wrote the paper reviewed drafts of the paper

Capel et al (2017) PeerJ DOI 107717peerj3873 1321

Field Study PermissionsThe following information was supplied relating to field study approvals (ie approvingbody and any reference numbers)

The samples used in the study were collected under the permit No 0032014 fromInstituto Brasileiro do Meio Ambiente e dos Recursos Naturais Renovaacuteveis ndash Ministeacuteriodo Meio Ambiente Brazil

DNA DepositionThe following information was supplied regarding the deposition of DNA sequences

All microsatellite developed will be available via GenBank accession numbers KY198738to KY198749 Sequences were uploaded as File S1

Data AvailabilityThe following information was supplied regarding data availability

The raw data has been uploaded as a Supplemental File

Supplemental InformationSupplemental information for this article can be found online at httpdxdoiorg107717peerj3873supplemental-information

REFERENCESAlbins MA HixonMA 2008 Invasive Indo-Pacific lionfish Pterois volitans reduce

recruitment of Atlantic coral-reef fishesMarine Ecology Progress Series 367233ndash238DOI 103354meps07620

Almeida ACS Souza FBC Gordon DP Vieira LM 2015 The non-indigenousbryozoan Triphyllozoon (Cheilostomata Phidoloporidae) in the Atlanticmorphology and dispersion on the Brazilian coast Zoologia 32476ndash484DOI 101590s1984-46702015000600007

Arnaud-Haond S Duarte M Alberto F Serratildeo A 2007 Standardizing methodsto address clonality in population studiesMolecular Ecology 165115ndash5139DOI 101111j1365-294X200703535x

Ayre DJ Miller KJ 2004Where do clonal coral larvae go Adult genotypic diversityconflicts with reproductive effort in the brooding coral Pocillopora damicornisMarine Ecology Progress Series 27795ndash105 DOI 103354meps277095

Ayre DJ Resing JM 1986 Sexual and asexual production of planulae in reef coralsMarine Biology 90187ndash190 DOI 101007BF00569126

Azevedo LP 2015 Conectividade geneacutetica do coral endeacutemico Mussismilia hispida (Scle-ractinia Mussidae) ao longo da costa brasileira Masterrsquos dissertation UniversidadeFederal do Rio de Janeiro

Baums IB Miller MW Hellberg ME 2006 Geographic variation in clonal structure in areef-building Caribbean coral Acropora palmata Ecologial Monographs 76503ndash519DOI 1018900012-9615(2006)076[0503GVICSI]20CO2

Capel et al (2017) PeerJ DOI 107717peerj3873 1421

Belkhir K Borsa P Chikhi L Raufaste N Bonhomme F 2004 Genetix 404 logicielsous Windows TM por la geacuteneacutetique des populations Laboratoire Geacutenome Popula-tions Interactions Montpellier CNRS UMR 500 Universiteacute de Montpelier II

Bird CE Karl S Smouse PE Toonen RJ 2011 Detecting and measuring geneticdifferentiation In Koenemann S Held C Schubart C eds Crustacean issuesphylogeography and population genetics in Crustacea Boca Raton CRC Press 31ndash55

Black R JohnsonMS 1979 Asexual viviparity and population genetics of ActiniatenebrosaMarine Biology 5327ndash31 DOI 101007BF00386526

Brazeau DA Lasker HR 1989 The reproductive cycle and spawning in a Caribbeangorgonian Biological Bulletin 1761ndash7 DOI 1023071541882

Cairns SD 1991 A revision of the ahermatypic scleractinia of the Galapagos and CocosIslands Smithsonian Contributions to Zoology 5041ndash32DOI 105479si00810282504

Cairns SD 2000 A revision of the shallow-water azooxanthellate Scleractinia of thewestern Atlantic Studies on the Natural History of the Caribbean Islands 75(1)1ndash192

Capel KCC 2012 Scleractinia (Cnidaria Anthozoa) da Reserva Bioloacutegica Marinha doArvoredo (SC) com ecircnfase na estrutura espaco-temporal da formacatildeo mais merid-ional de corais recifais no Oceano Atlacircntico Masterrsquos dissertation UniversidadeFederal de Santa Catarina

Capel KC Migotto AE Zilberberg C Kitahara MV 2014 Another tool towardsinvasion Polyp bail-out in Tubastraea coccinea Coral Reefs 331165DOI 101007s00338-014-1200-z

Caralt S Cebrian E 2013 Impact of an invasive alga (Womersleyella setacea) on spongeassemblages compromising the viability of future populations Biological Invasions151591ndash1600 DOI 101007s10530-012-0394-7

Castro CB Pires DO 2001 Brazilian coral reefs what we already know and what is stillmissing Bulletin of Marine Science 69357ndash371

Combosch DJ Vollmer SV 2011 Population genetics of an ecosystem-defining reefcoral Pocillopora damicornis in the Tropical Eastern Pacific PLOS ONE 6e21200DOI 101371journalpone0021200

Costa TJF Pinheiro HT Teixeira JB Mazzei EF Bueno L HoraMSC Joyeux JCCarvalho-Filho A Amado-Filho G Sampaio CLS Rocha LA 2014 Expansion of aninvasive coral species over Abrolhos Bank Southwestern AtlanticMarine PollutionBulletin 85252ndash253 DOI 101016jmarpolbul201406002

Creed JC 2006 Two invasive alien azooxanthellate corals Tubastraea coccinea andTubastraea tagusensis dominate the native zooxanthellateMussismilia hispida inBrazil Coral Reefs 25350 DOI 101007s00338-006-0105-x

Creed JC Fenner D Sammarco P Carins S Capel K Junqueira AOR Cruz I MirandaRJ Carlos-Junior L Mantelatto MC Oigman-Pszczol S 2016 The invasion ofthe azooxanthellate coral Tubastraea (Scleractinia Dendrophylliidae) through-out the world history pathways and vectors Biological Invasions 19283ndash305DOI 101007s10530-016-1279-y

Capel et al (2017) PeerJ DOI 107717peerj3873 1521

Cure K Benkwitt CE Kindinger TL Pickering EA Pusack TJ McIlwain JL HixonMA 2012 Comparative behavior of red lionfish Pterois volitans on native Pacificversus invaded Atlantic coral reefsMarine Ecology Progress Series 467181ndash192DOI 103354meps09942

DeMeeus T Balloux F 2005 F-statistics of clonal diploids structured in numerousdemesMolecular Ecology 142695ndash2702 DOI 101111j1365-294X200502643x

De Paula AF Creed JC 2004 Two species of the coral Tubastraea (Cnidaria Scleractinia)in Brazil a case of accidental introduction Bulletin of Marine Science 74175ndash183

De Paula AF Pires DO Creed JC 2014 Reproductive strategies of two invasive Suncorals (Tubastraea spp) in the southwestern Atlantic Journal of the Marine BiologicalAssociation of the United Kingdom 94481ndash492 DOI 101017S0025315413001446

Dlugosch KM Parker M 2008 Founding events in species invasions genetic variationadaptive evolution and the role of multiple introductionsMolecular Ecology17431ndash449 DOI 101111j1365-294X200703538x

Douhovnikoff V Dodd RS 2003 Intra-clonal variation and a similarity threshold foridentification of clones application to Salix exigua using AFLP molecular markersTheoretical and Applied Genetics 1061307ndash1315 DOI 101007s00122-003-1200-9

Earl DA Von Holdt BM 2012 STRUCTURE HARVESTER a website and programfor visualizing STRUCTURE output and implementing the Evanno methodConservation Genetics Resources 4359ndash361 DOI 101007s12686-011-9548-7

Evanno G Regnaut S Goudet J 2005 Detecting the number of clusters of individualsusing the software Structure a simulation studyMolecular Ecology 142611ndash2620DOI 101111j1365-294X200502553x

Faircloth BC 2008Msatcommander detection of microsatellite repeat arrays andautomated locus-specific primer designMolecular Ecology Resources 892ndash94DOI 101111j1471-8286200701884x

Fenner D 2001 Biogeography of three Caribbean corals (Scleractinia) and the in-vasion of Tubastraea coccinea into the Gulf of Mexico Bulletin of Marine Science691175ndash1189

Fenner D Banks K 2004 Orange Cup Coral Tubastraea coccinea invades Florida andthe Flower Garden Banks Northwestern Gulf of Mexico Coral Reefs 23505ndash507DOI 101007s00338-004-0422-x

Fernandez-Silva I Whitney J Wainwright B Andrews KR Ylitalo-Ward H BowenBW Toonen RJ Goetze E Karl SA 2013Microsatellites for next-generationecologists a post-sequencing bioinformatics pipeline PLOS ONE 8e55990DOI 101371journalpone0055990

Foster NL Baums IB Sanchez JA Paris CB Chollett I Agudelo CL VermeijMJA Mumby PJ 2013Hurricane-driven patterns of clonality in an ecosystemengineer the Caribbean coralMontastraea annularis PLOS ONE 8e53283DOI 101371journalpone0053283

Capel et al (2017) PeerJ DOI 107717peerj3873 1621

Fukami H Budd AF Paulay G Sole-Cava A Chen CLA Iwao K Knowlton N 2004Conventional taxonomy obscures deep divergence between Pacific and Atlanticcorals Nature 427832ndash835 DOI 101038nature02339

Gaither MR Bowen BW Toonen RJ 2013 Population structure in the native rangepredicts the spread of introduced marine species Proceedings of the Royal Society BBiological Sciences 28020130409 DOI 101098rspb20130409

Gaither MR Bowen BW Toonen RJ Planes S Messmer V Earle J Ross RobertsonD 2010 Genetic consequences of introducing allopatric lineages of BluestripedSnapper (Lutjanus kasmira) to HawaiiMolecular Ecology 191107ndash1121DOI 101111j1365-294X201004535x

Gaither MR Toonen RJ Bowen BW 2012 Coming out of the starting blocksextended lag time rearranges genetic diversity in introduced marine fishes ofHawaii Proceedings of the Royal Society B Biological Sciences 2793948ndash3957DOI 101098rspb20121481

Gallardo B ClaveroM SaacutenchezMI Vilagrave M 2016 Global ecological impacts ofinvasive species in aquatic ecosystems Global Change Biology 22151ndash163DOI 101111gcb13004

Geller J Sotka EE Kado R Palumbi SR Schwindt E 2008 Sources of invasions of anortheastern Pacific acorn barnacle Balanus glandula in Japan and ArgentinaMarine Ecology Progress Series 358211ndash218 DOI 103354meps07466

Glynn PW Colley SB Mate JL Cortes J Guzman HM Bailey RL Feingold JS EnochsIC 2008 Reproductive ecology of the azooxanthellate coral Tubastraea coccinea inthe equatorial eastern pacific Part V DendrophylliidaeMarine Biology 153529ndash544DOI 101007s00227-007-0827-5

Gorospe KD Karl SA 2013 Genetic relatedness does not retain spatial pattern acrossmultiple spatial scales dispersal and colonization in the coral Pocillopora damicornisMolecular Ecology 223721ndash3736 DOI 101111mec12335

Goudet J 1995 FSTAT (version 12) a computer program to calculate F-statisticsJournal of Heredity 86485ndash486 DOI 101093oxfordjournalsjhereda111627

Halpern BS Frazier M Potapenko J Casey KS Koenig K Longo C Lowndes JSRochwood RC Selig ER Selkoe KAWalbridge S 2014 Spatial and temporalchanges in cumulative human impacts on the worldrsquos ocean Nature Communications67615 DOI 101038ncomms8615

HamiltonM 2010 Population genetics New York John Wiley amp Sons IncHarrison PL 2011 Sexual reproduction of Scleractinian Corals In Dubinsky Z

Stambler N eds Coral reefs an ecosystem in transition Part 3 Dordrecht Springer59ndash85

Hedrick PW 1999Highly variable loci and their interpretation in evolution andconservation Evolution 53313ndash318 DOI 1023072640768

Capel et al (2017) PeerJ DOI 107717peerj3873 1721

Hennessey SM Sammarco PW 2014 Competition for space in two invasive Indo-Pacific coralsmdashTubastraea micranthus and Tubastraea coccinea Laboratory ex-perimentation Journal of Experimental Marine Biology and Ecology 459144ndash150DOI 101016jjembe201405021

Hoegh-Guldberg O 1999 Climate change coral bleaching and the future of the worldrsquoscoral reefsMarine and Freshwater Research 50839ndash866 DOI 101071MF99078

Holland BS 2000 Genetics of marine bioinvasions Hydrobiologia 42063ndash71DOI 101007978-94-017-2184-4_7

Hurlbert SH 1971 The nonconcept of species diversity a critique and alternativeparameters Ecology 52577ndash586 DOI 1023071934145

Johnson CHWoollacott RM 2015 Analyses with newly developed microsatellite mark-ers elucidate the spread dynamics of Tricellaria inopinata drsquoHondt and Occhipinti-Ambrogi 1985ndasha recently established bryozoan along the New England seashoreAquatic Invasions 10135ndash145 DOI 103391ai201510202

Keane RM Crawley MJ 2002 Exotic plant invasions and the enemy release hypothesisTrends in Ecology amp Evolution 17164ndash170 DOI 101016S0169-5347(02)02499-0

Lages BG Fleury BG Menegola C Creed JC 2011 Change in tropical rocky shore com-munities due to an alien coral invasionMarine Ecology Progress Series 43885ndash96DOI 103354meps09290

Liu J DongMMiao SL Li ZY SongMHWang RQ 2006 Invasive alien plants inChina role of clonality and geographical origin Biological Invasions 81461ndash1470DOI 101007s10530-005-5838-x

Lockwood JL Cassey P Blackburn T 2005 The role of propagule pressure inexplaining species invasions Trends in Ecology and Evolution 20223ndash228DOI 101016jtree200502004

Mantellato MC Creed JC 2014 Non-indigenous sun corals invade mussel beds inBrazilMarine Biodiversity 45605ndash606 DOI 101007s12526-014-0282-8

Mantellato MC Mouratildeo GG Migotto A Lindner A 2011 Range expansion of theinvasive corals Tubastraea coccinea and Tubastraea tagusensis in the SouthwestAtlantic Coral Reefs 30397 DOI 101007s00338-011-0720-z

Meirmans PG Hedrick PW 2011 Assessing population structure FST and related mea-suresMolecular Ecology Resources 115ndash18 DOI 101111j1755-0998201002927x

Meirmans PG Van Tienderen PH 2004 GENOTYPE and GENODIVE two programsfor the analysis of genetic diversity of asexual organismsMolecular Ecology Notes4792ndash794 DOI 101111j1471-8286200400770x

Miranda RJ Cruz ICS Barros F 2016 Effects of the alien coral Tubastraea tagusensis onnative coral assemblages in a southwestern Atlantic coral reefMarine Biodiversity163Article 45 DOI 101007s00227-016-2819-9

Molnar JL Gamboa RL Revenga C SpaldingMD 2008 Assessing the global threatof invasive species to marine biodiversity Frontiers in Ecology and the Environment6485ndash492 DOI 101890070064

Capel et al (2017) PeerJ DOI 107717peerj3873 1821

Mooney HA Cleland EE 2001 The evolutionary impact of invasive species Proceedingsof the National Academy of Sciences of the United States of America 985446ndash5451DOI 101073pnas091093398

Nakajima Y Nishikawa A Iguchi A Nagata T Uyeno D Sakai K Mitarai S 2017Elucidating the multiple genetic lineages and population genetic structure of thebrooding coral Seriatopora (Scleractinia Pocilloporidae) in the Ryukyu ArchipelagoCoral Reefs 36415ndash426 DOI 101007s00338-017-1557-x

Nakajima Y Shinzato C Satoh N Mitarai S 2015 Novel polymorphic microsatellitemarkers reveal genetic differentiation between two sympatric types of Galaxeafascicularis PLOS ONE 10e0130176 DOI 101371journalpone0130176

Noreen AME Harrison PL Van Oppen JH 2009 Genetic diversity and connectivity ina brooding reef coral at the limit of its distribution Proceedings of the Royal Society B2763927ndash3935 DOI 101098rspb20091050

Ottaway JR Kirby GC 1975 Genetic relationships between brooding and broodedActinia tenebrosa Nature 255221ndash223 DOI 101038255221a0

Pandolfi JM Bradbury RH Sala R Hughes TP Bjorndal KA Cooke RG McArdle DMcClenachan L NewmanMJH Paredes GWarner RR Jackson JBC 2003 Globaltrajectories of the long-term decline of coral reef ecosystems Science 301955ndash958DOI 101126science1085706

Pinzoacuten JHWeil E 2011 Cryptic species within the Atlantic-Caribbean genusmeandrina(scleractinia) a multidisciplinary approach and description of the new speciesMean-drina jacksoni Bulletin of Marine Science 87823ndash853 DOI 105343bms20101085

Pritchard JK Stephens M Donnelly P 2000 Inference of population structure usingmultilocus genotype data Genetics 155945ndash959

R Core Team 2015 R a language and environment for statistical computing Vienna RFoundation for Statistical Computing Available at httpwwwR-projectorg

Reaka-Kudla ML 1997 Global biodiversity of coral reefs a comparison with rainforestsIn Reaka-Kudla ML Wilson DE Wilson EO eds Biodiversity II understanding andprotecting our biological resources Washington DC Joseph Henry Press

Reitzel AM Darling JA Sullivan JC Finnerty JR 2008 Global population geneticstructure of the starlet anemone Nematostella vectensis multiple introductionsand implications for conservation policy Biological Invasions 101197ndash1213DOI 101007s10530-007-9196-8

RenM-X Zhang Q-G Zhand D-Y 2005 Random amplified polymorphic DNAmarkers reveal low genetic variation and a single dominant genotype in Eich-hornia crassipes populations throughout ChinaWeed Research 45236ndash244DOI 101111j1365-3180200500445x

Roman J Darling JA 2007 Paradox lost genetic diversity and the success of aquaticinvasions Trends Ecology Evolution 22454ndash464 DOI 101016jtree200707002

Sakai AK Allendorf FW Holt JS Lodge DML Molofsky J With KA Baughman SCabin RJ Cohen JE Ellstrand NC McCauley DE OrsquoNeil P Parker IM ThompsonJNWeller SG 2001 The population biology of invasive species Annual Review of

Capel et al (2017) PeerJ DOI 107717peerj3873 1921

Ecology Evolution and Systematics 32305ndash332DOI 101146annurevecolsys32081501114037

Sammarco PW Atchison AD Boland GS 2004 Expansion of coral communities withinthe Northern Gulf of Mexico via offshore oil and gas platformsMarine EcologyProgress Series 280129ndash143 DOI 103354meps280129

Sammarco PW Porter SA Cairns SD 2010 A new coral species introduced into theAtlantic OceanndashTubastraea micranthus (Ehrenberg 1834) (Cnidaria Anthozoa Scler-actinia) an invasive threat Aquatic Invasions 5131ndash140 DOI 103391ai20105202

Sammarco PW Porter SA Genazzio M Sinclair J 2015 Success in competition forspace in two invasive coral species in the western AtlanticndashTubastraea micranthusand T coccinea PLOS ONE 10e0144581 DOI 101371journalpone0144581

Sampaio CLS Miranda RJ Maia-Nogueira R Nunes JACC 2012 New occurrencesof the nonindigenous orange cup corals Tubastraea coccinea and T tagusensis(Scleractinia Dendrophylliidae) in Southwestern Atlantic Check List 8528ndash530DOI 101556083528

Santos LAH Ribeiro FV Creed JC 2013 Antagonism between invasive pest coralsTubastraea spp and the native reef-builderMussismilia hispid in the south-west Atlantic Journal of Experimental Marine Biology and Ecology 44969ndash76DOI 101016jjembe201308017

Sax DF Brown JH 2000 The paradox of invasion Global Ecology amp Biogeography9363ndash371 DOI 101046j1365-2699200000217x

Sax DF Stachowick JJ Brown JH Bruno JF DawsonMN Gaines SD Grosberg RKHastings A Holt RD Mayfield MM OrsquoConnorMI RiceWR 2007 Ecologicaland evolutionary insights from species invasions Trends in Ecology and Evolution22465ndash471 DOI 101016jtree200706009

Schuelke M 2000 An economic method for the fluorescent labeling of PCR fragmentsNature Biotechnology 18223ndash234 DOI 10103872708

Selkoe KA Toonen RJ 2006Microsatellites for ecologists a practical guide to using andevaluating microsatellite markers Ecology Letters 9615ndash629DOI 101111j1461-0248200600889x

Shiganova TA 1998 Invasion of the Black Sea by the ctenophoreMnemiopsis leidyi andrecent changes in pelagic community structure Fisheries Oceanography 7305ndash310DOI 101046j1365-2419199800080x

Silva AG De Paula AF Fleury BG Creed JC 2014 Eleven years of range expansionof two invasive corals (Tubastraea coccinea and Tubastraea tagusensis) throughthe southwest Atlantic (Brazil) Estuarine Coastal and Shelf Science 1419ndash16DOI 101016jecss201401013

Stoddart JA 1983 Asexual production of planulae in the coral Pocillopora damicornisMarine Biology 76279ndash284 DOI 101007BF00393029

Taylor CM Hastings A 2005 Allee effects in biological invasions Ecology Letters8895ndash908 DOI 101111j1461-0248200500787x

Capel et al (2017) PeerJ DOI 107717peerj3873 2021

Toonen RJ 1997Microsatellites for ecologists non-radioactive isolation and amplifi-cation protocols for microsatellite markers Available at http biogeekucdaviseduMstats

Van Oosterhout C HutchinsonWFWills DPM Shipley P 2004Micro-checkersoftware for identifying and correcting genotyping errors in microsatellite dataMolecular Ecology Notes 4535ndash538 DOI 101111j1471-8286200400684x

Vaughan TWWells JW 1943 Revision of the suborders families and genera of theScleractinia Geological Society of America Special Papers 441ndash363

Vitousek PM 1990 Biological invasions and ecosystem processes towards an integrationof population biology and ecosystem studies Oikos 577ndash13 DOI 1023073565731

Warner PA Van OppenMJHWillis BL 2015 Unexpected cryptic species diversity inthe widespread coral Seriatopora hystrix masks spatial-genetic patterns of connectiv-ityMolecular Ecology 242993ndash3008 DOI 101111mec13225

Wrange A-L Charrier G Thonig A RosenbladMA Blomberg A Havenhand JNJonsson PR Andreacute C 2016 The story of a hitchhiker population genetic patterns inthe invasive barnacle Balanus (Amphibalanus) improvisus Darwin 1854 PLOS ONE11e0147082 DOI 101371journalpone0147082

Wright S 1965 The interpretation of population structure by F-statistics with specialregard to systems of mating Evolution 19395ndash420

Capel et al (2017) PeerJ DOI 107717peerj3873 2121