cks1 regulates cdk1 expression: a novel role during mitotic … ·...

Cks1 Regulates cdk1 Expression: A Novel Role during

Mitotic Entry in Breast Cancer Cells

Louise Westbrook,1Marina Manuvakhova,

1,2Francis G. Kern,

1Norman R. Estes II,

1

Harish N. Ramanathan,1and Jaideep V. Thottassery

1,2

1Southern Research Institute and 2University of Alabama at Birmingham, Comprehensive Cancer Center, Birmingham, Alabama

Abstract

Cks1, a small protein whose expression is strongly associatedwith aggressive breast tumors, is a component of cyclin-cdk complexes, as well as the SCFSkp2 ubiquitin ligase. In thesestudies, we explored its roles in estrogen receptor–positivebreast tumor cells. When exposed to the antiestrogen ICI182780, these cells accumulate in G1 by reducing the expres-sion of Cks1, and increasing the levels of p130/Rb2, a cdk2inhibitor and SCFSkp2 target. Heregulin B1 or estradiol abro-gate antiestrogen effects by increasing Cks1 expression, down-regulating p130/Rb2 and inducing S phase entry. Depletionof Cks1 in these cells by RNA interference concomitantlydecreased Skp2 and up-regulated p130/Rb2 and anotherSCFSkp2 target, p27Kip1. Remarkably, however, Cks1-depletedcells not only exhibit slowed G1 progression, but also accu-mulate in G2-M due to blocked mitotic entry. Notably, we showthat cdk1 expression, which is crucial for M phase entry, isdrastically diminished by Cks1 depletion, and that restorationof cdk1 reduces G2-M accumulation in Cks1-depleted cells.cdk1 reduction in Cks1-depleted cells is a consequence of amarked decrease in its mRNA and not due to alteration in itsproteolytic turnover. Both heregulin B1 and estradiol couldneither restore cdk1 nor sustain cycling in Cks1-depleted cells,although classical estrogen receptor function remained unal-tered. Cks1 depletion also decreased Skp2 in human mamma-ry epithelial cells without altering cell cycle progression. Thus,the indispensability of Cks1 to the breast cancer cell cycle,versus its redundancy in normal cells, suggests that Cks1 abro-gation could be an effective interventional strategy in breastcancer. [Cancer Res 2007;67(23):11393–401]

Introduction

The cdk2 inhibitor and pocket protein, p130/Rb2, is abundant inG0 and in early G1, and a distinguishing feature of cell cycle arrestinduced by the antiestrogen ICI 182780 ( fulvestrant) in estrogenreceptor–positive (ER+) MCF-7 breast cancer cells is that theyaccumulate in a ‘‘G0-like’’ G1 state characterized by increases inp130/Rb2 (1). The levels of p130/Rb2, and another cdk2 inhibitor,p27Kip1, are mainly regulated through degradation by ubiquitin-dependent proteolysis and involves the SCFSkp2-Cks1 ubiquitin ligasecomplex (2–4). Skp2, the specificity component of the SCFSkp2-Cks1

ligase, binds to p27Kip1 in a Cks1-dependent manner (5–7). Recentstudies in MCF-7 cells show that forced expression of Skp2 couldconfer acute resistance to antiestrogens like tamoxifen and ICI182780 (8, 9). We and others have shown that certain growthfactors like heregulin h1 (HRGh1) could also induce ICI 182780–resistant proliferation in MCF-7 cells (10–12). However, whetherthis involves alterations in the regulation of SCFSkp2-Cks1 or thecdk2 inhibitors is unknown.

Targeted deletion of Skp2 in mice leads to increased levels ofboth p130/Rb2 and p27Kip1, consistent with a role for Skp2 in theturnover of these cdk2 inhibitors in certain cells (4). Inappropriateexpression of Skp2 in G0 cells also promotes S phase entryconcomitant with loss of p27Kip1 (4, 13, 14). Importantly, Cks1�/�mice share certain similarities with Skp2 knockouts, and p130/Rb2levels in Cks1�/� cells were much higher than wild-type con-trols, consistent with its role in p130/Rb2 degradation (4, 7). Cks1mRNA and protein also fluctuate in parallel with the levels of Skp2(9, 15, 16). Thus, alterations in Cks1 expression may also provide aregulatory mechanism for the degradation of cdk2 inhibitors andother cell cycle proteins.

Overexpression of Cks1 is also strongly associated with aggres-sive breast tumors and decreased disease-free and overall survival,and in general, correlates with decreased p27Kip1 levels (17). Lowlevels of p27Kip1 have been shown in a number of studies to beassociated with reduced overall and disease-free survival inpatients with breast cancer (18–20). In contrast, other studiesshow that p27Kip1 is overexpressed in a subset of highly pro-liferative breast carcinomas, and this was associated with strongexpression of cyclin D1 and ER positivity (21, 22). Therefore, it isunclear whether ‘‘Cks1-Skp2’’ represents a good therapeutic targetfor breast cancer because Cks1-independent mechanisms are alsoinvolved in the degradation of p27Kip1 and p130/Rb2, and alsobecause Cks1�/� mice are viable (although smaller than wild-type), and normal cell types from these mice do traverse the cellcycle despite various abnormalities. Nonetheless, it is possible thatunlike normal cells, Cks1 might play essential roles in specificgrowth pathways in cancer cells and therefore be a target thatcould be exploited in therapy.

Cks1 has also been shown to play Skp2- and p27Kip1-independentroles. The Schizosaccharomyces pombe and Saccharomyces cerevi-siae Cks1 were initially identified as subunits of cdc2 and cdc28(budding and fission yeast cdk1), respectively, although they do notdirectly affect catalytic phosphorylation by cdks (15). Subsequently,Cks proteins were also shown to have roles in stimulating theregulation of xenopus cdk1 kinases Wee1 and Myt1, and thephosphatase cdc25 (23–25). Also, high expression of Cks1 notrelated to p27Kip1 levels has been reported in non–small cell lungcarcinomas (26). Thus, it is possible that Cks1 is also essential inother cell cycle phases, and in certain mammalian cells, apart fromits role in G1-S.

Note: Supplementary data for this article are available at Cancer Research Online(http://cancerres.aacrjournals.org/).

Requests for reprints: Jaideep Thottassery, Biochemistry and Molecular BiologyDepartment, Southern Research Institute, 2000 Ninth Avenue South, Birmingham,AL 35205. Phone: 205-581-2846; Fax: 205-581-2877; E-mail: [email protected].

I2007 American Association for Cancer Research.doi:10.1158/0008-5472.CAN-06-4173

www.aacrjournals.org 11393 Cancer Res 2007; 67: (23). December 1, 2007

Research Article

Research. on January 16, 2021. © 2007 American Association for Cancercancerres.aacrjournals.org Downloaded from

http://cancerres.aacrjournals.org/

In this report, we show that depletion of Cks1 in MCF-7–derivedcells blocks cell cycle progression induced by both estrogen-dependent and growth factor–dependent pathways. Cks1 depletionnot only slows progression through G1-S, but also blocked theirentry into M phase. Cks1 silencing led to a rapid loss of Skp2,concomitant increases in p130/Rb2, a rather progressive accumu-lation in p27Kip1, and marked reduction in the level of cdk1, whichis essential for M phase entry. To our knowledge, these are the firststudies that link Cks1 to the regulation of cdk1 expression. Thisbeing rather unexpected, given Cks1’s dispensability for normalcell proliferation, suggests that functional abrogation of Cks1 couldbe an effective and potentially safe therapeutic strategy in additionto adjuvant hormonal therapies in breast cancer.

Materials and Methods

Chemicals and growth factors. Recombinant human HRGh1 (residues176-246 corresponding to the epidermal growth factor–like domain) was

from R&D Systems. ICI 182780 (Faslodex, fulvestrant) was a gift from

AstraZeneca. Improved modified Eagle’s medium was obtained from

Mediatech, Inc.Cell lines and cell cycle studies. MCF-7 cells (American Type Culture

Collection) or MCF-7/LacZ, an estrogen-responsive MCF-7–derived line

with a stably transfected LacZ which has growth properties similar to

parental MCF-7 were used and maintained in improved modified Eagle’smedium containing 5% fetal bovine serum (27–29). T47D or ZR75-1 are ER+

breast tumor lines, and were used in certain studies, and were maintained in

medium with 10% fetal bovine serum. Human mammary epithelial cells

(HMEC; Cambrex), were maintained in mammary epithelial growthmedium which contained the growth factors human epidermal growth

factor, insulin, and hydrocortisone. For cell cycle studies, cells were exposed

to propidium iodide. Samples were then treated with 5 Ag/mL of RNase(Calbiochem), and then analyzed on a fluorescence-activated cell sorting

(FACS) scan using laser excitation at 488 nm (Becton Dickinson). Cell cycle

analysis was done using ModFit (Verity Software House). For quantifying

mitotic cells, samples were stained with an antibody specific for phos-phorylation at Ser10 in histone H3, which occurs exclusively during mitosis

in mammalian cells.

RNA interference studies. For Cks1 knockdown, four separate small

interfering RNA (siRNA) duplexes were screened (Dharmacon, Inc.). Theirsense sequences are as follows: no. 1, CGACG AGGAGUUUGAGUAUUU; no.

3, ACCAGAACCUCACAUCUUGUU; no. 4, UCUGAU GUCUGAAUCUGAAUU;

and no. 5 CAAAUUUACUAUUCGGACAUU. Cells plated in 60 mm disheswere transfected with either a Cks1-specific siRNA or a control duplex with

no known homology to mammalian genes using DharmaFECT reagent

(Dharmacon) in serum-free medium. After 24 h of siRNA incubation,

cultures were either harvested, or re-fed with the medium and conditionsindicated for each experiment, and then harvested at various time points.

Harvested cells were either subjected to FACS scans to determine the

proportion in each cell cycle phase, or were lysed for immunoblotting

analysis. In certain experiments, total RNA was prepared for Northern blotanalysis of cdk1 expression.

Immunoblotting. Fifty micrograms of cell lysate was run on Criterion

precast SDS-PAGE gels (Bio-Rad). Proteins were transferred onto Transblotnitrocellulose filters (Bio-Rad) by electroblotting. Blots were probed with

the following antibodies: Cks1 (Santa Cruz), Skp2 (Zymed), p130/Rb2 (Santa

Cruz), pRb (BD PharMingen), p107 (Santa Cruz), p27Kip1 (BD PharMingen),

p21Cip1 (BD PharMingen), pThr187-p27Kip1 (Santa Cruz), cdk1 (Cell Signal-ing), cdk2 (Santa Cruz), cyclin B1 (Neomarkers), securin (Neomarkers),

and actin (clone AC40, Sigma). Enhanced chemiluminescence detection

with the Supersignal kit was used for band detection (Pierce).

Quantitative TaqMan PCR analysis of Cks1 expression. Total RNAwas isolated from cells, partially synchronized with a 72-h ICI 182780

treatment, at various time points following their release into HRGh1,estradiol (E2), or control medium. Cells were lysed using the TRI reagent

(Molecular Research Center) and total RNA made according to the

manufacturer’s protocol. First-strand cDNA was made using the SuperscriptIII kit (Invitrogen) according to the manufacturer’s protocol. Aliquots

from the cDNA were subject to qPCR analysis for Cks1 and Cks2 expression

using 300 nmol/L of 5¶ forward primer, 300 nmol/L of 3¶ reverse primer, and

100 nmol/L of double-fluorescently labeled minor groove–binding probe.For Cks1, the forward and reverse primers were 5¶ ATGTCT GAATCT-

GAATGGAGG and 5¶ TCATTTCTTTGG TTTCTTGGG, respectively, and the

probe 5¶ CCATGAACC AGAACCTCACA. For Cks2, the forward and reverse

primers were 5¶ GAAGAGGAG TGGAGGAGACTT and 5¶ TTTTGG AAG-AGGTCGTCTAAA, respectively, and the probe 5¶ TCATGAGCCAGAACC

ACATATTCTT. The reactions were carried out in an ABI PRISM TaqMan

7900 HT Sequence Detector (Applied Biosystems) according to the

manufacturer’s instructions under the following conditions: 40 cycles of15 s at 95jC and 1 min at 60jC. The comparative CT method was used to

represent the relative expression level of either Cks1 or Cks2 transcripts,

at various time points following release into HRGh1 or E2 containingmedium, with respect to a calibrator sample (0 h time point). The relative

expression level is expressed as a unitless number and calculated as 2�DDT

as previously described (30).

Northern blot analysis of cdk1 expression. Total RNA was isolatedfrom cells transfected with either CT siRNA or Cks1 siRNA. Cells were

harvested either immediately after completion of the 24-h transfection

procedure (i.e., 0 h), or 24 or 48 h subsequent to that. RNA was elec-

trophoresed on agarose-formaldehyde gels, blotted onto nylon membranes,and probed with 32P-labeled human cdc2 cDNA (excised from plasmid

provided by Dr. Clare H. McGowan, Department of Molecular Biology, The

Scripps Research Institute, La Jolla, CA).cdk1 protein turnover studies. The decay of constitutive levels of cdk1

was measured after inhibiting new protein synthesis by adding cyclohex-

imide at a concentration of 75 Ag/mL to the cells after the 24-h siRNA

application (i.e., 0 h time point). At increasing time intervals after theaddition of cycloheximide, lysates were prepared for immunoblotting.

Construction of cdk1 expression plasmid and transfection. A

plasmid (pTet 3XHA-cdc2) provided by Dr. Clare H. McGowan, that

contained an HA-tagged human cdk1 was excised as an EcoRI fragment andsubcloned into a plasmid upstream of an IRES sequence followed by a

blasticidin resistance gene previously described by us (31). This plasmid,

designated pIIB-HA cdc2 or the control vector pIIB was transfected intoMCF-7 cells using Fugene (Invitrogen). Twenty-four hours later, cells from

both transfections were retransfected with either CT siRNA or Cks1 siRNA

duplexes. Following 24 h of siRNA incubation, cultures were re-fed with 5%

FBS medium and then harvested after 48 h. Harvested cells were eithersubjected to FACS scans to determine the proportion in each cell cycle

phase, or were lysed for immunoblotting analysis.

Classical ER function assays using transient ERE-Luc transfections.Cells were cultured in FBS-containing medium and transfected with eitherCks1-specific siRNA or a control duplex for 24 h. Following the 24-h siRNA

transfection, cells were estrogen-deprived by quick stripping in two changes

of charcoal-stripped calf serum (CCS) medium, and transfected with an

ERE-Luc construct in the same medium. Cells were then treated withethanol vehicle or E2 (10

�8 mol/L) for 24 h, harvested, lysed, and luciferase

activities determined.

Results

ICI 182780 decreases Cks1 and Skp2 levels while concom-itantly increasing p130/Rb2 in ER+ breast cancer cells. Tounderstand the roles of Cks1 in human ER+ breast carcinoma cells,initial experiments were designed to determine the changes in cellcycle regulatory molecules in response to treatment of MCF-7/LacZ cells to ICI 182780. In cells growing exponentially in 5% FBS,the S phase proportion decreased from f32% to reach a minimumof 11% in response to ICI 182780 by 72 h (Fig. 1A and B). Decreasesin S phase were mainly compensated for by increases in G1 phase.Previous studies from other laboratories have shown a rapiddecline in cdk2 kinase activity in MCF-7 cells treated with ICI

Cancer Research

Cancer Res 2007; 67: (23). December 1, 2007 11394 www.aacrjournals.org



182780, which precedes the decline in the proportion of activelycycling cells, and is accompanied by a marked accumulation of thecdk2 inhibitor p130/Rb2 (1). Because p130/Rb2 levels are regulatedby phosphorylation-dependent proteolysis following its ubiquityla-tion by the SCFSkp2-Cks1 ubiquitin ligase, we examined the levelsof p130/Rb2, Skp2, and Cks1 following treatment of MCF-7/LacZcells with ICI 182780 (4, 32). Levels of p130/Rb2 were enhancedby antiestrogen treatment in these cells concomitant with markeddecreases in Cks1 and Skp2 (Fig. 1A). Interestingly, althoughp27Kip1 is the canonical SCFSkp2-Cks1 substrate, its increases, unlikep130/Rb2, were modest at best (Fig. 1A).

HRGB1 induces ICI 182780–resistant S phase entry andincreases Cks1 protein and mRNA. We and others have shownthat HRGh1 can induce ICI 182780–resistant growth in MCF-7–derived cells (10–12). Because the cell cycle is the ultimaterecipient of all mitogenic signals, we asked whether HRGh1 couldstimulate cell cycle progression in these cells in the continuouspresence of ICI 182780. Cells were partially synchronized with a72-h treatment with ICI 182780 resulting in f12% cells in S phase(80% in G1; Fig. 1B and C). The continued presence of ICI 182780for another 48 h led to further gradual decreases in S phase cells to

f8% to 9% (Fig. 1B), which was accompanied by further decreasesin Cks1, coupled with p130/Rb2 maintained at high levels (Fig. 1C).The continuous presence of ICI 182780 also led to further subs-tantial decreases in another pocket protein p107 (Fig. 1C). Cellcycle progression by both stimuli markedly increased Cks1 protein,which was accounted for largely by Cks1 mRNA increases (Fig. 1Cand D). Although Cks2 is expressed in these cells, changes in itsmRNA were not significant (data not shown). Both stimuli alsoincreased Skp2 protein levels moderately but consistently inseparate experiments (24 and 48 h lanes, Fig. 1C ; data not shown).Interestingly, despite their well-established roles in p27Kip1 degra-dation, increases in Cks1 and Skp2 were accompanied by onlyminor decreases in p27Kip1 abundance in these cells during cellcycle reentry by both stimuli (Fig. 1C).

Cell cycle progression by both stimuli also led to the appearanceof hyperphosphorylated forms of p130/Rb2 and marked decreasesin total p130/Rb2 (Fig. 1C). This effect is consistent with thefact that hyperphosphorylation of p130/Rb2 by cyclin D/cdk4/6complexes in mid-G1 phase leads it to its ubiquitination andproteolysis (4, 32). Unlike p130/Rb2 levels which were down-regulated, release into either HRGh1- or E2-containing medium led

Figure 1. HRGh1 induces cell cycleprogression and enhances Cks1 and Skp2in ICI 182780–arrested ER+ MCF-7/LacZbreast cancer cells. A, MCF-7/LacZcells accumulate in G1 when exposed toICI 182780 (10�7 mol/L, 72 h). Cellswere harvested and lysed. Lysates wereanalyzed by immunoblotting to determinethe expression of the indicated proteins.B and C, cells were partially synchronizedin G1 by a 72-h treatment with ICI 182780as above, and were then released intoHRGh1 or E2-containing medium inthe continued presence of ICI 182780(10�7 mol/L). At the indicated time points,cells were harvested for FACS analysisof cell cycle progression (B), and forimmunoblotting (C ). D, expression ofCks1 mRNA in partially synchronizedcells during HRGh1- or E2-stimulated cellcycle progression. At the indicated timepoints, cells were harvested and totalRNA was made. Cks1 expression wasdetermined by TaqMan PCR analysisof reverse-transcribed cDNA. Resultsare representative of three separateexperiments.

Cks1 Is Indispensable in the Breast Cancer Cell Cycle




to substantial increases in p107 pocket protein (Fig. 1C). S phaseentry by either stimulus was also accompanied by the increasedappearance of the hyperphosphorylated form of the pRb pocketprotein (Fig. 1C). Total pRB levels, unlike p130/Rb2, did notdecrease upon S phase entry (Fig. 1C).

Cks1-depletion led to rapid decline in Skp2, reduction incdk1, accumulation of p130/Rb2, p27Kip1, and hypophosphory-lated pRb. RNA interference was used to determine theconsequences of Cks1 loss in MCF-7–derived cells. A 24-h siRNAapplication of cells with either of four different siRNA duplexes wassufficient to cause a marked reduction of Cks1 protein (Fig. 2A).All four duplexes were roughly equivalent in terms of knockdown.In subsequent experiments, we used siRNAs 1, 4, and 5, andidentical results were obtained from the use of these duplexes.We also found that Skp2 levels were also almost undetectable afterthe 24-h Cks1 siRNA transfection procedure (Fig. 2A). Skp2 has

been shown to be autoubiquitinated in the absence of Cks1, whichsuggests that its stability is closely dependent on Cks1 levels, whichwould explain this result (33, 34). However, p27Kip1 levels werealmost equal in CT siRNA versus Cks1 siRNA-transfected cells atthis point (Fig. 2A). We surmised that because steady-state p27Kip1

reflects the balance of ubiquitination/turnover versus translationrates, perhaps p27Kip1 translation in these cells was not rapidenough to exhibit immediate accumulation. Therefore, we assessedthe effects of Cks1 depletion at various times after the 24-h siRNAtransfection protocol. We found that both Cks1 and Skp2 wereundetectable for at least another 48 h after the completion ofsiRNA transfection, which was accompanied by a gradual accu-mulation of p27Kip1 (Fig. 2B).

Unlike p27Kip1 however, p130/Rb2 exhibited marked increasesimmediately after the 24-h Cks1 siRNA application (0 h time point,Fig. 2B). Also, Cks1-depleted cells exhibited hypophosphorylatedforms of pRb, beginning at 24 h after completion of the siRNAtransfection protocol, a likely indirect effect of cdk2 inactivationdue to the increases in the two cdk2 inhibitor levels (Fig. 2B).Most interesting however, was the finding that cdk1 levels weremarkedly diminished in Cks1-depleted cells, although not asrapidly as Skp2. Cks1 depletion also led to gradual decreases insecurin, and modest cyclin B1 decreases (Fig. 2B).

Cks1-depleted MCF-7–derived cells initially exhibit slowedG1 progression, and are later blocked in G2-M: E2 or HRGB1cannot sustain cycling in Cks1-depleted cells. Because thesecells have a doubling time of f36 to 38 h, and because some of theeffects of Cks1 depletion on cell cycle regulatory proteins werenot immediate, we assessed the effects of Cks1 depletion on thecell cycle at 24 and 48 h harvest time points after the 24 h siRNAapplication (Table S1; Fig. 3A). Both CT siRNA and Cks1 siRNAtransfections were initially compared in cells made quiescent withestrogen-deprived CCS versus cells that are rapidly cycling inresponse to E2 or HRGh1 (Table S1; Fig. 3A). The S phase fractiondeclines after incubation in CCS, and CT siRNA-transfected cellshave 12.3% after 48 h in CCS. The S phase fraction increases inmedium supplemented with E2 or HRGh1, and are 30% and 24%,respectively, at 48 h (Table S1; Fig. 3A). On the other hand, Cks1siRNA-transfected cells incubated in CCS exhibited an even lower Sphase fraction as compared with CT transfectants with markedaccumulation in G1 at the 24-h time point and also a slight accu-mulation in G2-M (Table S1). At 48 h posttransfection, Cks1-depleted cells exhibited even higher accumulation in G2-M, ascompared with the 24-h time point (Table S1; Fig. 3A). Even moreremarkable was the finding that Cks1 siRNA-transfected cellsincubated with E2 or HRGh1 also exhibited marked accumulationin G2-M as compared with CT (Table S1; Fig. 3A).

In parallel, another set of siRNA-transfected cultures wereexposed to complete serum (5% FBS), containing the normalestrogen component. Some of these samples received ICI 182780,plus supplements of E2 or HRGh1. As expected, cells in S phase inCT siRNA-transfected cultures treated with ICI 182780 graduallydecreased (23% at 24 h and 15% by 48 h), with a markedaccumulation in G1 (Table S1). However, cells in Cks1-depletedcultures were markedly accumulated in G2-M by 48 h in both CTand ICI 182780 treatments (Table S1; Fig. 3A). Similarly, when E2 orHRGh1 was added to override the effects of ICI 182780, Cks1-depleted cells exhibited an even higher accumulation in G2-M ascompared with CT siRNA-transfected cells (Table S1; Fig. 3A).When we quantified cells in mitosis, we found that they weresignificantly reduced in Cks1 siRNA-transfected cells suggesting

Figure 2. Cks1 depletion by RNA interference in MCF-7/LacZ breast carcinomacells leads to decreases in cdk1. Cks1 depletion also simultaneously decreasesSkp2, while concomitantly increasing p130/Rb2 and p27Kip1 levels. A, fourseparate siRNA duplexes were tested to identify ones that showed effectiveknockdown of Cks1. siRNA duplexes were applied to cells using DharmaFECTtransfection reagent for 24 h, harvested, and lysed. Lysates were examined forthe levels of indicated proteins by immunoblotting. B, siRNA duplexes wereapplied to cells for 24 h, followed by harvest at 0, 12, 24, 36, and 48 h aftercompletion of transfection. Lysates were analyzed by immunoblotting todetermine the expression of the indicated proteins.

Cancer Research




that Cks1 depletion predominantly results in defect(s) in transitinto M phase (Fig. 3B). In sum, these results suggested that Cks1depletion leads to an initial transient accumulation in G1. However,Cks1-depleted cells that have exited G1-S phase experience a moresevere G2-M blockade, which although apparent at the 24-h harvestpoint, is clearer at the 48-h point as more cells transit into G2-Mphase from the preceding phases. This is consistent with the loss ofcdk1 protein in these cells which is delayed with respect to theincreases in p130/Rb2.

Reintroduction of cdk1 in Cks1 depleted cells prevents G2-Maccumulation. To assess whether reduction in cdk1 in Cks1-depleted cells played the pivotal role in the G2-M block, weectopically expressed cdk1 in MCF-7 cells by transient transfec-tion. Stable cdk1 overexpression is not tolerated by these cells(data not shown). MCF-7 cells were transiently transfected eitherwith a vector expressing a HA-tagged cdk1 cDNA or a CT vector.Cultures from both transfections were then retransfected witheither a Cks1-specific siRNA or control duplexes as in previousexperiments. Both CT transfectants and cdk1 transfectantsexhibited similar decreases in endogenous cdk1 and Skp2, andalso exhibited increased p27Kip1 following Cks1 depletion,although ectopic cdk1 remained unaltered (Fig. 4A). FollowingCks1 depletion, CT transfectants also exhibited a >3-foldaccumulation of cells in G2-M. On the other hand, the G2-Maccumulation in Cks1-depleted cdk1 transfectants was substantiallyreduced, with partial restoration of G1 and S phases (Fig. 4B). Thissuggests that despite alterations in other cell cycle proteins,the cdk1 reduction in Cks1-depleted cells is the proximate causeof the G2-M blockade. These studies were performed with MCF-7

cells in order to show that the effects of Cks1 depletion are notunique to MCF-7/LacZ cells.

Cks1 regulates cdk1 expression at the mRNA level. Inunperturbed cycling cells, cdk1 protein remains constant through-out the cell cycle due to a coordinated synthesis and degradation ofboth cdk1 protein and mRNA (35–37). After mitosis, the translationof cdk1 mRNA is shut off with a concurrent increase in cdk1 mRNAdecay. However, the stability of the cdk1 protein made in theprevious interphase was relatively high, resulting in its levelsremaining constant. Activation of cdk1 transcription at the G1-Stransition in each cell cycle results in the accumulation of newlysynthesized protein. To investigate whether cdk1 expression wasdependent on Cks1, we isolated total RNA from CT and Cks1siRNA-treated cells, immediately after the 24-h siRNA application,i.e., 0 h, and at the 24 and 48 h time points after the completion oftransfection (Fig. 5A). Interestingly, we find that cdk1 mRNA wasdrastically diminished concomitant with Cks1 knockdown, andremained very low at the 24 and 48 h harvest time points as well. Totest whether the steady-state cdk1 protein turnover is altered afterCks1 depletion, we treated CT siRNA or Cks1 siRNA-treated cellswith cycloheximide to block protein synthesis after 24 h of siRNAapplication and harvested cells at various time points. Although thecycloheximide block approach could affect the degradationmachinery itself, it can be concluded that at least under theseconditions, the turnover of the total cellular cdk1 pool after Cks1depletion was not significantly different from the turnover rate inCT siRNA-treated cells (Fig. 5B). The apparent half-life of cdk1 inCT versus Cks1-depleted cells was 7.2 and 7.4 h, respectively. Thus,Cks1 positively regulates cdk1 mRNA levels, and therefore, new

Figure 3. Cks1 depletion leads to arrest during mitoticentry. E2 and HRGh1 are incapable of stimulating cellcycle progression in Cks1-depleted cells. A, control orCks1-specific siRNA duplexes were applied to cells for 24 h,followed by incubation in CCS medium or FBS-containingmedium with the indicated supplements for 48 h. Cellswere harvested, stained with propidium iodide, andanalyzed by FACS. Representative FACS histogramsshowing cell accumulation in G2-M in Cks1-depletedgroups. B, Cks1-depleted cells do not progress into mitosis.Control or Cks1-specific siRNA duplexes were applied tocells for 24 h, followed by harvest at 48 h posttransfection.For quantifying mitotic cells, samples were stained withan antibody specific for phosphorylation at Ser10 in histoneH3 and analyzed by flow cytometry.





cdk1 protein synthesis is blocked when Cks1 is knocked down. Thisgradually results in the depletion of steady-state levels of cdk1protein without altering cdk1 turnover.

E2 or HRGB1 cannot restore cdk1 levels in Cks1-depletedcells. To further investigate why Cks1-depleted cells are blocked inG2-M and are incapable of cycling even when exposed to potentmitogens like E2 or HRGh1, we examined the levels of cdk1, Skp2,p27Kip1, p130/Rb2, and securin. We show that, in general, both E2

and HRGh1 are unable to negate the effects of Cks1 depletion onall of these variables, except that Cks1 depletion–mediatedincreases in p130/Rb2 are less prominent in E2, and particularly,HRGh1-treated cultures (Fig. 6). Because SCFSkp2-Cks1–mediatedubiquitination and proteolytic degradation of p27Kip1 is dependenton its phosphorylation at Thr187, we also showed that the inabilityof E2 or HRGh1 to degrade it was not due to lack of phos-phorylation at this site (Fig. 6). We also show that the effects ofCks1 depletion on cdk1 levels are rather specific because cdk2levels were not affected significantly (Fig. 6). We also testedwhether the effects of Cks1 depletion on cdk1 levels occur in otherER+ cells by knocking down Cks1 in T47-D cells. A 24-h Cks1 siRNAapplication in these cells led to complete depletion of Cks1 proteinwith somewhat delayed kinetics as compared with what waspreviously observed in MCF-7–derived cells (SupplementaryFig. S1). However, in these cells, Cks1 depletion led to a markedreduction in cdk1 levels as well (Supplementary Fig. S1). We alsofound similar results in ZR75-1, another ER+ line (data not shown).We also showed that Cks1 depletion did not alter basal or E2-inducible luciferase activities in cells transiently transfected withan ERE-Luc reporter plasmid, nor did it alter ERa protein levels(Supplementary Fig. S2).

Cks1 depletion in HMECs does not alter cell cycleprogression. For Cks1 abrogation to be an effective intervention,the selectivity of its effects would be an important issue. Wetherefore assessed the effects of Cks1 depletion on HMECs. HMECsare grown in a defined medium containing insulin and epidermalgrowth factor, and in these conditions, they express moderateamounts of Cks1 constitutively (data not shown). However, siRNAtransfections are done in serum and growth factor–free conditionsfor 24 h, and in these conditions, Cks1 levels are low but detectable(0 h time point, Supplementary Fig. S3A). Cks1 siRNA duplexes areeffective in these cells and induce marked decreases in expression.After the 24 h transfection, cells are re-fed with growth factorcontaining defined medium, which causes a rapid increase inCks1 expression (24 and 48 h lanes, Supplementary Fig. S3A). Cks1siRNA duplexes are however very effective in inhibiting Cks1expression. Cks1 depletion in these cells also led to decreases inSkp2 levels as in the tumor cells. Interestingly, cdk1 levels are barelydetectable in HMECs, and did not exhibit major alterations follow-ing Cks1 depletion (data not shown). Similarly, Cks1 depletion did

Figure 4. Reintroduction of cdk1 in Cks1-depleted MCF-7 cells reducesG2-M accumulation. A, MCF-7 cells were transiently transfected with pIIB-HA-cdc2 or the control vector pIIB followed by application of either control orCks1-specific siRNA duplexes to both groups. Cells were harvested 48 h aftersiRNA application and immunoblotting was done with the indicated antibodies.B, control or Cks1-specific siRNA duplexes were applied to CT or cdk1transfectants, followed by incubation in CCS medium or FBS-containing mediumwith the indicated supplements for 48 h. Cells were harvested, stained withpropidium iodide, and analyzed by FACS. Representative FACS histograms.

Figure 5. cdk1 mRNA is markedly reduced in Cks1depleted MCF-7/LacZ cells. A, control or Cks1-specificsiRNA duplexes were applied to cells for 24 h, followedby harvest at 0, 24, or 48 h time points. Total RNA waselectrophoresed, blotted onto nylon filters, and probed witha human cdc2 (cdk1) probe. B, steady-state cdk1 proteinturnover is not altered in Cks1-depleted cells. Control orCks1-specific siRNA duplexes were applied to cells for24 h. Cells were then fed cycloheximide (75 Ag/mL)containing medium to stop protein synthesis, andharvested at 1, 2, 4, and 8 h after the addition ofcycloheximide (post-CHX ). Lysates were analyzed byimmunoblotting. Densitometric analysis was done todetermine cdk1 levels relative to actin and is graphicallypresented as a function of time after the addition ofcycloheximide.

Cancer Research




not alter p27Kip1 as well, which increases after incubation in serum-free medium, and then returns to lower levels in defined medium.The cell cycle profiles of HMECs after 48 h of Cks1 depletion werealso not altered (Supplementary Fig. S3B). These results suggestthat Cks1 depletion has cell type–specific effects and that Cks1depletion in normal cells might not be very deleterious.

Discussion

A large proportion of breast cancers that are initially estrogen-responsive, eventually progress to exhibit resistance to antiestro-gens, including pure antiestrogens such as ICI 182780. HRGh1, agrowth factor ligand for the Her3/4 dimerization partners of theHer2 receptor, has been shown to induce both tamoxifen- and ICI182780–resistant growth in MCF-7 cells (10–12, 38, 39). We sur-mised that identifying an essential nexus in cell cycle progressionmight provide interventional targets for both estrogen-dependentas well as growth factor–dependent proliferation of ER+ breastcancer cells. ‘‘Cks1-Skp2’’ and their downstream pathways seem tobe such a nexus. In this report, we have shown that both E2 andHRGh1 stimulate S phase progression in ER+ breast carcinomacells, accompanied by the up-regulation of both Cks1 and Skp2,with concomitant decreases in the p130/Rb2 protein (Fig. 1B and C ;Supplementary Fig. S4). However, Cks1 plays important roles notonly in the G1-S phase, but also in the G2-M phase in these cells.

Cks1 and G1-S progression. The p130/Rb2 protein in additionto being a cdk2 inhibitor, is also a pocket protein and formstranscriptional repressor complexes with E2F4/5 that inhibittranscription of S phase genes (40). Cks1 was recently shown toplay a role in p130/Rb2 ubiquitination and degradation (4). This isconsistent with our finding that Cks1 depletion led to signifi-

cant and rapid increases in p130/Rb2. Cks1 depletion also led top27Kip1 accumulation, although with somewhat delayed kinetics.This could reflect either a slower translation rate for p27Kip1 inthese cells or the simultaneous operation of other p27Kip1-degradative pathways. The accumulation of both cdk2 inhibitorsp27Kip1 and p130/Rb2, and the appearance of hypophosphorylatedpRb in Cks1-depleted cells, presumably due to cdk2 inactivation,correlates with the initial G1 accumulation. The reason for anincomplete arrest in G1 is unclear, although it is reasonable tospeculate that even a complete inhibition of cdk2 activity is notsufficient in breast cancer cells, as is also the case in other cancercells such as colorectal carcinoma cells (41).

Cks1-dependent regulation of cdk1 and mitotic entry. Theblock in entry into mitosis induced by Cks1 depletion in thepresent study is significant. It has been shown that in mammaliancells, cdk1 activity is essential for successful entry into mitosis (42).Although reported nearly 13 years ago, a lesser known fact is thatp27Kip1 is also an inhibitor of cdk1, apart from its well-appreciatedinhibitory effects on cdk2 (43). Furthermore, it was also reportedrecently that in Skp2�/� mouse embryo fibroblasts, there isincreased association of p27Kip1 with both cdk1 and cdk2, resultingin decreased kinase activities of cyclin A-cdk2 and cyclin A/B cdk1complexes (44). However, our novel finding that Cks1 abrogationalmost completely depletes cdk1 protein itself, and that ectopiccdk1 can reverse the G2-M blockade, suggests that Cks1 regulationof cdk1 expression is an indispensable function in G2-M in breastcancer cells.

Cks1 could regulate cdk1 at the level of transcription, or duringmRNA turnover, or both. An E2F-binding repressor element atthe �20 position in the cdk1 promoter binds p130/Rb2-E2F4complexes and represses transcription. This complex comes off atthe beginning of the S phase (45). Because p130/Rb2 levels increasein Cks1-depleted cells, this could contribute to transcriptionalrepression. However, ICI 182780 treatment of MCF-7 cells alsocauses an increase in cellular abundance of p130/Rb2-E2F4complexes (1), but does not decrease cdk1 (this study). Thissuggests that nearly complete loss of Cks1, as in the siRNA-treatedcells, could trigger other mechanisms that are obligatory for cdk1promoter occupancy and transcriptional repression by thesecomplexes (e.g., nuclear entry of E2F4, complexation with DP-1,etc.). These mechanisms, perhaps coupled with increased cdk1mRNA turnover, could drastically diminish cdk1 mRNA, and even-tually protein, in Cks1-depleted cells.

Tsai et al. showed that Cks1 depletion in H358 lung cancer cellsresulted in a decrease in cdk1 activity and a modest accumulationin G2-M (46). Unlike the present findings, however, they did not finda decrease in cdk1 expression (46). During the transition throughcell cycle phases, cdk activity is also regulated by reversiblephosphorylation at conserved sites such as Thr160/161. Cks proteinsare predicted to prevent access to this conserved threonine incdk1/2 to both the activating kinase and inactivating phosphatase(47, 48). It is therefore possible that Cks1 could prevent thephosphorylation of Thr161 on cdk1 in certain cell types and blockentry into M phase. It is also possible that decreases in cyclin B1following Cks1 depletion could also contribute to the decreases incdk1 activity reported by Tsai et al. and subsequent accumulationof cells in G2-M (46).

Cks1 regulation of cyclin B1 and securin. In our system, Cks1depletion led to moderate, although significant decreases in cyclinB1. In contrast, xenopus Cks immunodepletion from egg extractsincreases cyclin B1 levels, as a result of decreased activation of

Figure 6. HRGh1 and E2 are incapable of restoring cdk1 levels in Cks1depleted MCF-7/LacZ cells. Lysates from cells transfected with control orCks1-specific siRNAs that were treated with indicated conditions for 48 h wereanalyzed by immunoblotting to determine expression of the indicated proteins.





the APC ubiquitin ligase, and prevents exit from mitosis (25, 49).Cks1 depletion in MCF-7–derived cells also led to decreases inthe steady-state levels of another APC substrate, securin (Figs. 2Band 5). These findings are in contrast to findings in budding yeastin which Cks1 inactivation led to a stabilization of securin (49).Whether premature activation of the APC or subsequent protea-some functions occur following Cks1 depletion in our system, andare secondary to cdk1 decreases, will be tested in the future.

Concluding remarks. Both orthologues, Cks1 and Cks2, whichare 81% identical, were expressed in the cells used in our study. Ourstudies, following specific depletion of Cks1, therefore suggest thatCks2 cannot substitute for certain Cks1 roles in G2-M in these cells,just as Cks2 cannot substitute for Cks1 in its Skp2-dependentfunction of p27Kip1 ubiquitination (50). It is also likely that someeffects seen in this study following Cks1 depletion are indirecteffects of Skp2 down-regulation, due to its autoubiquitination inthe absence of Cks1, accounting for the inability of Cks2 in thesecells to override these effects (Fig. 2; refs. 33, 34). In conclusion, ourstudies show that Cks1 contributes to multiple essential rolesduring cell cycle progression in ER+ breast cancer cells (depictedschematically Fig. S4). It is remarkable that despite the panoply ofpathways activated by them, neither E2 nor HRGh1 could bypassthe requirement for Cks1 in these cells. This suggests that Cks1plays certain nonredundant roles in these proliferative pathways inbreast cancer cells and could therefore be a target for therapy inaddition to adjuvant antiestrogens. Although ICI 182780 reduces

Cks1 expression, it does not cause G2-M arrest, possibly because anear-complete eradication of Cks1 is probably essential for markedreduction of cdk1. Also p27Kip1 increases in ICI 182780–treatedcells are not substantial enough to inhibit cdk1 activity. However,p130/Rb2, which exclusively inhibits cdk2, increases markedly inICI 182780–treated cells. As a result of time, due to slowed G1

progression, cells steadily accumulate in this phase instead ofarresting in G2-M. Growth factors such as HRGh1 can overridethese effects in part by stimulating Cks1 expression and couldstimulate antiestrogen-resistant progression. Because Cks1 is indis-pensable for cell cycle progression by both ER-dependent andindependent pathways in breast cancer cells, unlike its redun-dancy in HMECs, abrogation of functional Cks1 might be a safeand effective therapeutic strategy even in antiestrogen-resistantER+ disease.

Acknowledgments

Received 11/13/2006; revised 8/27/2007; accepted 10/1/2007.Grant support: Susan G. Komen Breast Cancer Foundation grant BCTR00-456

(J.V. Thottassery), IR&D grant 1094 (J.V. Thottassery), National Cancer Institute BreastSpecialized Programs of Research Excellence Developmental grant (J.V. Thottassery),NIH grant CA50376 (F.G. Kern), Adolph Weil Endowed Chair in Cancer Biology(F.G. Kern), and DAMD 17-01-1-0400 (N.R. Estes).

The costs of publication of this article were defrayed in part by the payment of pagecharges. This article must therefore be hereby marked advertisement in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Dr. Clare McGowan for providing the human cdc2 cDNA, and Dr. MichelePagano for helpful discussions.

Cancer Research


References

1. Carroll JS, Prall OW, Musgrove EA, Sutherland RL. Apure estrogen antagonist inhibits cyclin E-Cdk2 activityin MCF-7 breast cancer cells and induces accumulationof p130-2F4 complexes characteristic of quiescence.J Biol Chem 2000;275:38221–9.

2. Pagano M, Tam SW, Theodoras AM, et al. Role of theubiquitin-proteasome pathway in regulating abundanceof the cyclin-dependent kinase inhibitor p27. Science1995;269:682–5.

3. Carrano AC, Eytan E, Hershko A, Pagano M. SKP2 isrequired for ubiquitin-mediated degradation of the CDKinhibitor p27. Nat Cell Biol 1999;1:193–9.

4. Tedesco D, Lukas J, Reed SI. The pRb-related proteinp130 is regulated by phosphorylation-dependent prote-olysis via the protein-ubiquitin ligase SCF(Skp2). GenesDev 2002;16:2946–57.

5. Carrano AC, Pagano M. Role of the F-box protein Skp2in adhesion-dependent cell cycle progression. J Cell Biol2001;153:1381–90.

6. Ganoth D, Bornstein G, Ko TK, et al. The cell-cycleregulatory protein Cks1 is required for SCF(Skp2)-mediated ubiquitinylation of p27. Nat Cell Biol 2001;3:321–4.

7. Spruck C, Strohmaier H, Watson M, et al. A CDK-independent function of mammalian Cks1: targeting ofSCF(Skp2) to the CDK inhibitor p27Kip1. Mol Cell 2001;7:639–50.

8. Signoretti S, Di Marcotullio L, Richardson A, et al.Oncogenic role of the ubiquitin ligase subunit Skp2 inhuman breast cancer. J Clin Invest 2002;110:633–41.

9. Foster JS, Fernando RI, Ishida N, Nakayama KI,Wimalasena J. Estrogens down-regulate p27Kip1 inbreast cancer cells through Skp2 and through nuclearexport mediated by the ERK pathway. J Biol Chem 2003;278:41355–66.

10. Thottassery JV, Sun Y, Westbrook L, et al. Prolongedextracellular signal-regulated kinase 1/2 activationduring fibroblast growth factor 1- or heregulin h1-induced antiestrogen-resistant growth of breast cancercells is resistant to mitogen-activated protein/extracel-

lular regulated kinase kinase inhibitors. Cancer Res 2004;64:4637–47.

11. Larsen SS, Egeblad M, Jaattela M, Lykkesfeldt AE.Acquired antiestrogen resistance in MCF-7 humanbreast cancer sublines is not accomplished by alteredexpression of receptors in the ErbB-family. BreastCancer Res Treat 1999;58:41–56.

12. Keshamouni VG, Mattingly RR, Reddy KB. Mecha-nism of 17-h-estradiol-induced Erk1/2 activation inbreast cancer cells. A role for Her2 and PKC-y. J BiolChem 2002;277:22558–65.

13. Nakayama K, Nagahama H, Minamishima YA, et al.Targeted disruption of Skp2 results in accumulation ofcyclin E and p27(Kip1), polyploidy and centrosomeoverduplication. EMBO J 2000;19:2069–81.

14. Sutterluty H, Chatelain E, Marti A, et al. p45SKP2promotes p27Kip1 degradation and induces S phase inquiescent cells. Nat Cell Biol 1999;1:207–14.

15. Hadwiger JA, Wittenberg C, Mendenhall MD, Reed SI.The Saccharomyces cerevisiae CKS1 gene, a homolog ofthe Schizosaccharomyces pombe suc1+ gene, encodes asubunit of the Cdc28 protein kinase complex. Mol CellBiol 1989;9:2034–41.

16. Simon KE, Cha HH, Firestone GL. Transforminggrowth factor h down-regulation of CKShs1 transcriptsin growth-inhibited epithelial cells. Cell Growth Differ1995;6:1261–9.

17. Slotky M, Shapira M, Ben Izhak O, et al. Theexpression of the ubiquitin ligase subunit Cks1 inhuman breast cancer. Breast Cancer Res 2005;7:R737–44.

18. Catzavelos C, Bhattacharya N, Ung YC, et al.Decreased levels of the cell-cycle inhibitor p27Kip1protein: prognostic implications in primary breastcancer. Nat Med 1997;3:227–30.

19. Porter PL, Malone KE, Heagerty PJ, et al. Expressionof cell-cycle regulators p27Kip1 and cyclin E, alone andin combination, correlate with survival in young breastcancer patients. Nat Med 1997;3:222–5.

20. Tan P, Cady B, Wanner M, et al. The cell cycleinhibitor p27 is an independent prognostic marker insmall (T1a,b) invasive breast carcinomas. Cancer Res1997;57:1259–63.

21. Fredersdorf S, Burns J, Milne AM, et al. High levelexpression of p27(kip1) and cyclin D1 in some humanbreast cancer cells: inverse correlation between theexpression of p27(kip1) and degree of malignancy inhuman breast and colorectal cancers. Proc Natl Acad SciU S A 1997;94:6380–5.

22. Barnes DM, Gillett CE. Cyclin D1 in breast cancer.Breast Cancer Res Treat 1998;52:1–15.

23. Patra D, Wang SX, Kumagai A, Dunphy WG. Thexenopus Suc1/Cks protein promotes the phosphor-ylation of G(2)/M regulators. J Biol Chem 1999;274:36839–42.

24. Patra D, Dunphy WG. Xe-p9, a Xenopus Suc1/Cksprotein, is essential for the Cdc2-dependent phosphor-ylation of the anaphase-promoting complex at mitosis.Genes Dev 1998;12:2549–59.

25. Patra D, Dunphy WG. Xe-p9, a Xenopus Suc1/Ckshomolog, has multiple essential roles in cell cyclecontrol. Genes Dev 1996;10:1503–15.

26. Inui N, Kitagawa K, Miwa S, et al. High expression ofCks1 in human non-small cell lung carcinomas.Biochem Biophys Res Commun 2003;303:978–84.

27. McLeskey SW, Zhang L, Kharbanda S, et al. Fibroblastgrowth factor overexpressing breast carcinoma cells asmodels of angiogenesis and metastasis. Breast CancerRes Treat 1996;39:103–17.

28. McLeskey SW, Zhang L, El-Ashry D, et al. Tamoxifen-resistant FGF-transfected MCF-7 cells are cross-resistantin vivo to the antiestrogen, ICI 182,780 and two aromataseinhibitors. Clin Cancer Res 1998;4:697–711.

29. Zhang L, Kharbanda S, Chen D, et al. MCF-7 breastcarcinoma cells overexpressing FGF-1 form vascular-ized, metastatic tumors in ovariectomized or tamoxifen-treated nude mice. Oncogene 1997;15:2093–108.

30. Pfaffl MW. A new mathematical model for relativequantification in real-time RT-PCR. Nucleic Acids Res2001;29:e45.

31. Qu Z, Thottassery JV, Van Ginkel S, et al. Homoge-neity and long-term stability of tetracycline-regulatedgene expression with low basal activity by using thertTA2S-M2 transactivator and insulator-flanked reportervectors. Gene 2004;327:61–73.





32. Bhattacharya S, Garriga J, Calbo J, Yong T, Haines DS,Grana X. SKP2 associates with p130 and acceleratesp130 ubiquitylation and degradation in human cells.Oncogene 2003;22:2443–51.

33. Wirbelauer C, Sutterluty H, Blondel M, et al. The F-box protein Skp2 is a ubiquitylation target of a Cul1-based core ubiquitin ligase complex: evidence for a roleof Cul1 in the suppression of Skp2 expression inquiescent fibroblasts. EMBO J 2000;19:5362–75.

34. Wang W, Ungermannova D, Jin J, Harper JW, Liu X.Negative regulation of SCFSkp2 ubiquitin ligase by TGF-h signaling. Oncogene 2004;23:1064–75.

35. McGowan CH, Russell P, Reed SI. Periodic biosyn-thesis of the human M-phase promoting factor catalyticsubunit p34 during the cell cycle. Mol Cell Biol 1990;10:3847–51.

36. Welch PJ, Wang JY. Coordinated synthesis anddegradation of cdc2 in the mammalian cell cycle. ProcNatl Acad Sci U S A 1992;89:3093–7.

37. Dalton S. Cell cycle regulation of the human cdc2gene. EMBO J 1992;11:1797–804.

38. Tang CK, Perez C, Grunt T, Waibel C, Cho C, Lupu R.Involvement of heregulin-h2 in the acquisition of the

hormone-independent phenotype of breast cancer cells.Cancer Res 1996;56:3350–8.

39. Atlas E, Cardillo M, Mehmi I, Zahedkargaran H,Tang C, Lupu R. Heregulin is sufficient for the pro-motion of tumorigenicity and metastasis of breastcancer cells in vivo . Mol Cancer Res 2003;1:165–75.

40. Mayol X, Grana X, Baldi A, Sang N, Hu Q, Giordano A.Cloning of a new member of the retinoblastoma genefamily (pRb2) which binds to the E1A transformingdomain. Oncogene 1993;8:2561–6.

41. Tetsu O, McCormick F. Proliferation of cancer cellsdespite CDK2 inhibition. Cancer Cell 2003;3:233–45.

42. Riabowol K, Draetta G, Brizuela L, Vandre D, BeachD. The cdc2 kinase is a nuclear protein that is essentialfor mitosis in mammalian cells. Cell 1989;57:393–401.

43. Toyoshima H, Hunter T. p27, a novel inhibitor of G1cyclin-Cdk protein kinase activity, is related to p21. Cell1994;78:67–74.

44. Nakayama K, Nagahama H, Minamishima YA, et al.Skp2-mediated degradation of p27 regulates progressioninto mitosis. Dev Cell 2004;6:661–72.

45. Tommasi S, Pfeifer GP. In vivo structure of thehuman cdc2 promoter: release of a p130-E2F4 complex

from sequences immediately upstream of the transcrip-tion initiation site coincides with induction of cdc2expression. Mol Cell Biol 1995;15:6901–13.

46. Tsai YS, Chang HC, Chuang LY, Hung WC. RNAsilencing of Cks1 induced G2/M arrest and apoptosis inhuman lung cancer cells. IUBMB Life 2005;57:583–9.

47. Bourne Y, Watson MH, Hickey MJ, et al. Crystalstructure and mutational analysis of the human CDK2kinase complex with cell cycle-regulatory proteinCksHs1. Cell 1996;84:863–74.

48. Song H, Hanlon N, Brown NR, Noble ME, JohnsonLN, Barford D. Phosphoprotein-protein interactionsrevealed by the crystal structure of kinase-associatedphosphatase in complex with phosphoCDK2. Mol Cell2001;7:615–26.

49. Kaiser P, Moncollin V, Clarke DJ, et al. Cyclin-dependent kinase and Cks/Suc1 interact with theproteasome in yeast to control proteolysis of M-phasetargets. Genes Dev 1999;13:1190–202.

50. Spruck CH, de Miguel MP, Smith AP, et al.Requirement of Cks2 for the first metaphase/anaphasetransition of mammalian meiosis. Science 2003;300:647–50.



2007;67:11393-11401. Cancer Res Louise Westbrook, Marina Manuvakhova, Francis G. Kern, et al. Mitotic Entry in Breast Cancer CellsCks1 Regulates cdk1 Expression: A Novel Role during

Updated version

http://cancerres.aacrjournals.org/content/67/23/11393

Access the most recent version of this article at:

Material

Supplementary

http://cancerres.aacrjournals.org/content/suppl/2007/11/20/67.23.11393.DC1

Access the most recent supplemental material at:

Cited articles

http://cancerres.aacrjournals.org/content/67/23/11393.full#ref-list-1

This article cites 50 articles, 24 of which you can access for free at:

Citing articles

http://cancerres.aacrjournals.org/content/67/23/11393.full#related-urls

This article has been cited by 6 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. (CCC)Click on "Request Permissions" which will take you to the Copyright Clearance Center's

.http://cancerres.aacrjournals.org/content/67/23/11393To request permission to re-use all or part of this article, use this link



http://cancerres.aacrjournals.org/content/suppl/2007/11/20/67.23.11393.DC1

http://cancerres.aacrjournals.org/content/67/23/11393.full#ref-list-1

http://cancerres.aacrjournals.org/content/67/23/11393.full#related-urls

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]



cks1 regulates cdk1 expression: a novel role during mitotic … ·...

Documents