characterization of the putative surface protein tlp in...
TRANSCRIPT
Characterization of the putative surface protein TLP in Plasmodium bergheiand Plasmodium falciparum
Ryan M Harrison1,2, Cristina K Moreria3, Catherine Lavazec3, Thomas J Templeton3
1 Gateways to the Laboratory Program, Weill Cornell/ Rockefeller/Sloan-Kettering Tri-Institutional MD-PhD Program, New York, NY
2 Department of Biomedical Engineering, Johns Hopkins University, Baltimore, MD3 Department of Immunology and Microbiology, Weill Cornell Medical College, New York, NY
Malaria, a complex illness caused by the protozoan parasite Plasmodium, is an endemic diseasethat is responsible for approximately a half billion human infections and over two million deathsper year. Development of a potent malaria vaccine will be supported by a broader fundamentalunderstanding of Plasmodium on both a molecular and cellular level. We intend to characterizethe TRAP-Like Protein (TLP), a recently discovered putative surface protein conserved acrossmultiple Plasmodium species. Due to TLP’s domain homology with Thrombospondin RelatedAdhesive Protein (TRAP), Circumsporozoite Protein (CSP) and Circumsporozoite-TRAP-Related Protein (CTRP), TLP is suspected to be involved in host cell recognition and invasion.
The lifecycle stage of expression for TLP was determined by Quantitative Real-Time PCRanalysis on wild type and TLP knockout cDNA from eight discrete time points in both P.berghei and P. falciparum. This analysis revealed that TLP is predominantly expressed inmosquito salivary gland sporozoites. To assess the function of TLP, knockout lines of P.falciparum were created by gene disruption. Knockout lines of P. berghei were obtained fromthe Leiden Malaria Research Group at Leiden University Medical Center. The gene disruption inboth P. falciparum and P. berghei was confirmed via diagnostic PCR. Southern blotcorroboration of the gene disruption, immunofluorescence assays and hepatocyte invasion assaysare in progress.
Key Words: Malaria, Plasmodium falciparum, Plasmodium berghei, TLP
Introduction
Epidemiology of Malaria
In terms of social and economic impact, malaria is by far one of the most devastating human
diseases. Afflicting approximately a half billion people annually, malaria is a pervasive and
endemic problem in many areas of the developing world (Guinovart et al., 2006). According to
the Centers for Disease Control, forty-one percent of the global population lives in areas at risk
for malaria transmission (Figure 1). Every year, over two million people die of malaria;
approximately 90% of these fatalities occur in sub-Saharan Africa. (Greenwood & Mutabingwa,
2002).
Figure 1: Global Distribution of Malaria
Malaria is an endemic disease afflicting approximately a half billion people per year. Areas where malariatransmission occurs are highlighted in dark green. Areas with limited risk of malaria are highlighted in lightgreen. Due to effective malaria eradication programs in the United States and Europe, today malaria is limited totropical and subtropical regions such as sub-Saharan Africa, the Amazon, South Asia and Southeast Asia.
WHO, 2002
While effective treatment options are widespread and relatively affordable by Western standards,
many populations, particularly in Africa and Southeast Asia, are unable to obtain the necessary
medication and treatment. Moreover, the economic and political instability in many malaria
endemic areas hinders drug distribution and malaria transmission prevention measures (Sachs &
Malaney, 2002).
Malaria is caused by the protozoan parasite Plasmodium. Of the many Plasmodium species, only
four species (P. falciparum, P. vivax, P. ovale and P. malariae) infect humans. The transmission
vector for the Plasmodium parasite is the Anopheles mosquito. In terms of malaria infectivity
rates, Anopheles gambiae mosquitoes, the primary transmission vector in sub-Saharan Africa, is
by far the most common transmission vectors to humans. In the past century, mosquito
population control measures have effectively eradicated malaria in the United States, Europe and
the rest of the developed world. While mosquito population control and anti-malarial drugs, such
as chloroquine, are currently effective preventative and treatment measures to malaria,
insecticide and drug resistance strains are developing in many parts of the world. To date, there
is no effective vaccine against Plasmodium and malarial infection.
Plasmodium Pathology
Plasmodium, the protozoan parasite responsible for malaria infections, has a diverse life cycle
spanning asexual and sexual stages in both its mosquito vectors and animal host (Miller et al.,
2002). The asexual life cycle stages occur largely in the vertebrate host, while the sexual stages
occur largely in the mosquito vector (Figure 2).
The primary clinical symptoms of human malaria are tertian or quartan fevers and anemia
(Miller et al., 2002). Fevers are caused by the synchronous rupture of schizonts, which release
between 8 and 64 merozoites into the host blood stream, depending on Plasmodium species.
Anemia is caused by the loss of healthy erythrocytes to lyses and parasite invasion. Secondary,
and more fatal, symptoms of malaria are due to the trafficking of large non-specific adhesive
proteins such as PfEMP-1 (Erythrocyte Membrane Protein), to the erythrocyte cell surface
Figure 2: Overview of the Plasmodium Life Cycle
Plasmodium, the protozoan parasite responsible for malaria, has an extremely complex life cycle in both itsvertebrate host and mosquito vector. Beginning its asexual life cycle with sporozoite entry from the mosquitosalivary glands, the parasite migrates to the host liver where it selectively invades hepatocytes. Upon thePlasmodium induced rupture of an infected hepatoocyte, thousands of merozoites, an erythrocyte infective stage,are released into the blood stream. Eventually, a handful of merozoite invaded erythrocytes will differentiate intogametocytes beginning the sexual stages. If ingested by a mosquito, these gametocytes will fertilize and developin the mosquito mid gut, eventually returning to the mosquito salivary glands as sporozoites.
“Malaria” Encyclopedia of Life Sciences
(Fairhurst et al. 2005, Fairhurst et al. 2006, Templeton et al., 2005). These adhesive domains
help lodge the infected erythrocyte within the microvasculature, preventing parasite detection
and destruction in the spleen. Potentially fatal organ failure can occur when these obstructions
and occlusions become widespread, as is common in the liver, kidneys, brain and placenta
(Miller et al., 2002).
Conserved adhesive domains mediate Plasmodium host cell invasion
At certain stages of the Plasmodium life cycle (sporozoite, merozoite and ookinte stages), the
parasite must seek out new host cells. Like all members of the phylum Apicomplexa,
Plasmodium has an apical complex, a specialized system designed to promote invasion of host
cells. Conserved apical complex organelles include microtubules, micronemes, a polar ring and
rhoptries. The process of host cell recognition and invasion is regulated by a complex set of
proteins and protein interactions. Although many proteins suspected to be involved in host cell
recognition and invasion remain uncharacterized, CSP (Circumsporozoite Protein), TRAP
(Thrombospondin Related Adhesive Protein) and CTRP (Circumsporozoite-TRAP Related
Protein) are characterized examples of invasion mediating proteins (Dessens et al., 1999; Kaneko
et al., 2006; Wengelnik et al., 1999; Yuda et al., 1999).
CSP and TRAP are large multidomain adhesive proteins expressed during the sporozoite life
cycle stage. TRAP contains conserved von Willebrand Factor A (vWFA) domains,
thrombospondin type I repeat (TSP) domains and a single transmembrane spanning helix capped
by a conserved tryptophan (Wengelnik et al., 1999); CSP contains TSP and transmembrane
domains (Figure 3). CSP is localized to the parasite surface while TRAP is localized both in the
micronemes and on the parasite surface. CSP adheres to the hepatocyte membrane, allows the
sporozoite to reorient such that the apical complex comes into contact with the target cell. A tight
junction is then formed between the apical complex polar ring the hepatocye membrane. TRAP
is released when micronemes discharge into junction. Beyond its involvement in the formation of
the tight junction and sporozoite motility, the exact mechanism by which TRAP acts remains
unknown. Notably, when either CSP or TRAP is disrupted, sporozoite motility and invasive
capability are reduced but not eliminated (Wengelnik et al., 1999).
CTRP, a protein involved in ookinete invasion, has similar vWFA, TSP, and single
transmembrane spanning helix motifs as CSP and TRAP. In fact, CTRP is essential for ookinete
invasion and the formation of oocyst. When CTRP is disrupted, ookinetes develop normally, but
oocysts do not develop in the mosquito mid gut (Dessens et al, 1999; Yuda et al., 1999).
TLP shares conserved adhesive domains with CSP, TRAP and CTRP
Basic science research to elucidate the fundamental cellular and molecular mechanics of
Plasmodium and its host and vector interactions will greatly support the development of more
effective treatments and an effective malaria vaccine. With the recent release of the Plasmodium
genome, new proteins are constantly being discovered that may play a role in sporozoite and
TRAPvWFA TSP REP Cy TRAPvWFA TSP REP Cy
CTRPvWFA TSPTSPTSP TSPTSPTSPTSPvWFAvWFAvWFAvWFAvWFA Cy CTRPvWFA TSPTSPTSP TSPTSPTSPTSPvWFAvWFAvWFAvWFAvWFA Cy
TLPvWFA vWFATSP Cy TLPvWFA vWFATSP Cy
Figure 3: CSP, TRAP, CTRP and TLP contain conserved adhesive domains
CSP, TRAP and CTRP, proteins known to mediate Plasmodium host cell invasion, have two conserved adhesivedomains: von Willebrand factor A (vWFA) domains and thrombospondin type I repeat (TSP) domains. Due todomain homology with these proteins, TSP is hypothesized to have a similar invasive function.
ookinete invasion pathways (Gardner et al., 2002). TLP (TRAP-Like Protein), a recently
discovered and completely uncharacterized protein, shares conserved TSP and vWFA adhesive
domains with CSP, TRAP and CTRP (Figure 3) (Hayward et al., 2000). Characterization of TLP
will be necessarily to elucidate the significance of this domain homology. In order to further our
understanding of TLP, and thereby Plasmodium in general, we intend to determine the life cycle
stage in which TLP is expressed. Due to TLP’s domain homology to CSP, TRAP and CTRP, all
characterized proteins involved in host cell invasion, we hypothesis that TLP might be primarily
expressed in an invasive stage such as the sporozoite, merozoite or ookinete. We will also
prepare gene disrupted knockouts for use in invasion assays. These assays will be used to
determine the extent to which TLP is involved in host cell recognition and invasion by
comparing TLP-knockout infectivity to wild type infectivity.
Methods
Plasmodium Parasites
P. falciparum NF54 strain gametocyte cultures were maintained for both wild type and TLP
knockout parasites. Wild type and TLP knockout cultures were kept at a constant temperature of
37oC to prevent premature gametocyte exflagellation. Cultures were fed daily with complete
RPMI/human serum media. Pyrimethamine was added to TLP knockout media to positively
select for gene disrupted parasites (TLP gene was disrupted with a cassette containing a gene for
Pyrimethamine resistance). One culture was maintained at less than 2% parasitemia by a 1:20
dilution every three to four days. This provided several gametocyte cultures three to four days
apart from each other. Parasitemia and gametocytemia was checked on day three, ten and
fourteen via Giemsa staining. If no gametocytes were present by day ten, the culture was
discarded. After day fourteen, exflagellation assays were conducted to determine whether to
proceed with mosquito infection. If not used for mosquito infection or genomic DNA extraction
by day seventeen, the culture was discarded.
P. berghei ANKA strain was cultured in mice. Parasitemia and gametocytemia were checked
daily from blood extracted from the tail vein. Mice were sacrificed to provide infected blood for
mosquito infections and genomic DNA extraction via tail vein bleeding.
Gene Disruption
TLP knockout P. falciparum parasites were generated by transforming erythrocytes with a
pHHT-TK plasmid containing DHFR (Duraisingh et al., 2002), a gene for pyrimethamine
resistance, via electroporation. These transected erythrocytes were then infected with P.
falciparum NF54 (Deitsh et al., 2001). TLP knockout P. berghei ANKA was generously donated
by the Leiden Malaria Research Group at Leiden University Medical Center in the Netherlands.
Erythrocytes infected with P. falciparum were transformed with a pHHT-TK plasmid containing
DHFR, a gene for pyrimethamine resistance, via electroporation. Cultures were then treated with
pyrimethamine to select for parasites with the integrated cassette. After a recovery time of up to
one month, transformed parasite clones were isolated by dilution cloning, where cultures were
added to a 96 well plate at a concentration of less than one parasite per well. After an additional
three weeks, plates were assays for live parasites with MALSTAT. Single clonal populations
were obtained from wells testing positive for Plasmodium. The population 7Fb from the NF54
strain was used as the primary TLP knockout for P. falciparum.
Diagnostic PCR
P. falciparum and P. berghei genomic DNA were isolated from gametocyte cultures using a
QIAamp DNA blood Midi kit (Qiagen). A total four amplification regions were selected to
confirm the presence of the integrated cassette (Figure 4). Primers were designed by hand in GC
rich regions (Plasmodium has an AT rich genome) such that two of these regions were
completely within the genome; two others were partially contained within the integrated cassette
(Table 1).
P. berghei Primer SetsPrimer Set Sense Oligonucleotide Anti-sense Oligonucleotide
A PbCLG5 S1GGATCCCATAAATGGCAACCCAAGC
PbCLG5 AS1CCTTTTGTTGTTACTCTGTCAATTAATG
B PbCLG5 S1GGATCCCATAAATGGCAACCCAAGC
pKO3UTR SGCGGAAATACAGAAGCTGGC
C PbCLG3 S1CTCGACACAGGAAATGATAAAAATG
PbCLGgene ASGTACATGCTGTCCAATCATCCC
D pKO5UTR ASCCAACTCAATTTAATAGATGTGTTAG
PbCLG3 AS1GCATCTTAATAGTTCATTTGTATTGGG
P. falciparum Primer SetsPrimer Set Sense Oligonucleotide Anti-sense Oligonucleotide
A PfCLG5UTR S2CGATCTGTTCACTGTATTGTGCC
PfCLG5 ASCCATCTGTATTCATAAACATGACAACC
B PfCLG5UTR S2CTGAGAATTTATGAATGCCCC
PfCLGgene ASCCTCCTACGTCTGCTTCCATATTTTCC
C PfCLG3 SCAACTTCAAATGAGCATCACGC
PfCLGgene ASCCTCCTACGTCTGCTTCCATATTTTCC
D pHHT-TK PfHRP3UTR S1 PfCLGgene ASCCTCCTACGTCTGCTTCCATATTTTCC
Table 1: Diagnostic PCR primers
Diagnostic primers were designed by hand on the criteria of 40% GC content and an approximate annealingtemperature of 50oC. Primers for sets “A” and “C” are both contained in the genomic DNA; one primer for sets“B” and “D” is in the genomic DNA, the other in the integrated cassette.
For P. berghei and P. falciparum, best results were obtained with 35 cycles of amplification, 30
second denaturation at 94oC, 30 second annealing at 48oC and 4 minute extension at 65oC. PCR
was done using a PTC-100 Thermal Cycler (MJ Research).
a)
b)
Figure 4: Diagnostic PCR design
Diagnostic PCR design for P. berghei and P. falciparum. Bolded letters correspond to primer sets (Table 1)and agarose gel lane labels in (Figure 6). Note that the integrated cassette is only present in TLP knockoutstrains.
Southern Blot
Genomic DNA was isolated from mature wild type and TLP knockout P. falciparum cultures via
phenol/chloroform extraction. 4.8ug of wild type or TLP knockout genomic DNA were digested
with HindIII and NcoI (Figure 5). The reaction was allowed to proceed overnight at 37oC.
The digest product, run on a 1.2% Ethidium Bromide stained agarose gel for 210minutes at 50V,
was visualized in a UV Transilluminator (Bio-Rad). Membrane transfer was performed by
capillary transfer using a 20x SSC transfer buffer and nitrocellulose membrane (Sambrook et al.,
1989). The membrane was hybridized overnight with a 600bp DIG labeled probe at 40oC.
Hybridization and labeling steps were carried out using the DIG High Prime DNA Labeling and
Detection Starter Kit II (Roche Applied Science). Florescent antibody-bound DIG labeled probe
was visualized by 2-10minute exposures to X-ray film.
gDNA gDNA
NcoI HindIII
Hybridization Probe
Wildtype
TLP knockout
7,600bp
gDNA gDNA
NcoI HindIII
Hybridization Probe
9,700bp
HindIII HindIII2000bp
Integrated Cassette
Figure 5: Southern blot design
A genomic DNA restriction digest with NcoI and HindIII theoretically yields a 7.6kbp and 2.0kbp band forwildtype and TLP knockout respectively. After transfer, the Hybond nitrocellulose membrane was hybridizedwith a 600bp DIG labeled hybridization probe and visualized with a florescent DIG antibody with X-ray film.
Real Time PCR
Using Quantitative Real-Time Polymerase Chain Reaction (QRT-PCR), gene expression was
monitored at eight discrete time points in both P. berghei and P. falciparum. RNA was extracted
at each time point in Trizol (Invitrogen) as recommended by the manufacturer. RNA was treated
with DNAse I (Boehringer Mannheim) and purified on an RNeasy Minielute cleanup column
(Qiagen) until free of DNA. cDNA was then obtained by subjecting extracted RNA to reverse
transcription using Superscript II primed with random hexamer primers (Invitrogen).
Quantitative Real-Time PCR assays were performed using a SYBR Green PCR Master Mix
protocol and 100uM primers. Gene specific primers for TLP, AMA-1, glutamic acid tRNA
synthase, RLPl11 and arginine tRNA synthase were empirically designed. CT’s beyond thirty
cycles were excluded as noise.
Results
TLP gene is likely disrupted
To confirm the disruption of the TLP gene, diagnostic PCR was preformed on P. berghei and P.
falciparum genomic DNA (Figure 6). The sets of primers “A” and “C” are complementary to the
genomic DNA and are therefore expected in both the wild type and TLP knockout. One of the
primers in set “D” located within the disruptive cassette and should only be observed in the TLP
knockout. For P. berghei, one of the primers of set “B” is located within the disruptive cassette
and like “D” should only be observed in the TLP knockout. For P. falciparum the PCR product
for primer set “B” spans the entire integrated cassette.
In P. berghei, band A was expected at 755bp; band B at 1,238bp; band C at 869bp; and band D
at 963bp. All bands were observed as expected. In P. falciparum, band A was expected at 620bp;
band B at 3,000bp (wild type) and 5,000bp (TLP knockout); band C at 800bp; and band D at
1,622bp. All bands were observed as expected with the exception of TLP knockout band B. This
is likely due to an insufficient extension time for the 5.0kbp fragment. A smear caused by
nonspecific extension resulted when attempted with longer extension times (up to ten minutes).
These results suggest that the disruptive cassette is likely integrated into the P. berghei and P.
falciparum TLP knockout genome.
TLP expression occurs predominately in the sporozoite
Quantitative Real-Time Polymerase Chain Reaction (QRT-PCR) was used to determine the life
cycle stages at which the TLP gene was expressed. Results for P. berghei (Figure 7) and P.
falciparum (Figure 8) are shown below.
A B C D
WT TLP
P. berghei
A B C D
P. falciparum
A B C D A B C D
WT TLP
Figure 6: Disruption cassette is likely integrated into the TLP knockout genome
Diagnostic PCR on P. berghei and P. falciparum genomic DNA suggests that the gene disruption cassette islikely integrated into the TLP knockout genome. For P. berghei, expected PCR product sizes are as follows:755bp band A; 1,238bp band B; 869bp band C; 963bp band D. For P. falciparum: 620bp band A; 3,000bp bandB wild type; 5,000bp band B TLP knockout; 800bp band C; 1,622bp band D. All bands were observed whereexpected except P. falciparum TLP knockout band B. This is likely due to insufficient extension time for the5,000bp PCR product.
Of the eight discrete mRNA isolation time points for P. berghei, five (ring, early trophozoite,
late trophozoite, schizont and merozoite) represent the asexual stages. HSP70 (Heat Shock
Protein 70), a ubiquitous chaperone protein, was the positive control for the entire life cycle.
AMA-1 (Apical Membrane Antigen 1), a well characterized protein previously determined to be
expressed in merozoites and sporozoites, was additional control for the merozoite and sporozoite
stages. Figure 7 demonstrates that TLP is predominately expressed in the sporozoite. In fact,
TLP is expressed at approximately the same levels as AMA-1 in merozoites, suggestive of a high
level of expression.
Figure 7: P. berghei TLP gene expression occurs predominately in the sporozoite
TLP gene is highly expressed in the sporozoite. No expression occurs in the host asexual stages (ring, earlytrophozoite, late trophozoite, schizont and merozoite), gametocyte or oocyst. AMA-1 (Apical Membrane Antigen1) is a positive control expressed in the merozoite and sporozoite stages. HSP70 (Heat Shock Protein 70) is apositive control expressed in all life cycle stages.
QRT-PCR was also conducted on P. falciparum at eight discrete time points (Figure 8). As for P.
berghei, AMA-1 was used a positive control for the sporozoite and merozoite stages. Glutamic
acid tRNA synthase was used a positive control for the entire lifecycle.
In addition to sporozoite expression, the TLP gene was expressed in the gametocyte and zygote.
Although both the gametocyte and zygote are not invasive, it is possible that P. falciparum is
storing TLP mRNA for later translation. It is important to note that since the Quantitative Real-
Time PCR for P. berghei and P. falciparum were normalized for different housekeeping genes,
expression ratios cannot be compared between the two.
Figure 8: P. falciparum TLP gene expression occurs in the sporozoite
TLP gene expression occurs in the gametocyte, zygote and sporozoite. No expression occurs in the host asexualstages (ring, early trophozoite, late trophozoite, schizont and merozoite). AMA-1 (Apical Membrane Antigen 1)is a positive control expressed in the merozoite and sporozoite stages. Glutamic acid tRNA synthase is a positivecontrol expressed in all life cycle stages.
Conclusion & Discussion
Through Quantitative Real-Time Polymerase Chain Reaction (QRT-PCR), we have determined
that TLP, TRAP-Like Protein, is expressed predominately in the sporozoite stage. In addition to
TLPs domain homology with CSP and TRAP, both sporozoite proteins known to mediate
hepatocyte invasion, TLP is hypothesized to be involved with sporozoite recognition and
invasion of hepatocytes. The overall protein expression and localization of CSP, TRAP, CTRP
and TSP are summarized in Table 2. TLP protein expression was derived from preliminary
Immunofluoresce Assays (IFA).
To study the function of TLP, TLP knockout strains of P. berghei and P. falciparum were
created via gene disruption. We verified the inclusion of an integrated cassette by diagnostic
PCR in both P. berghei and P. falciparum. These results, along with the circumstantial evidence
CSP TRAP CTRP TLP
membranecytoplasmmembranecytoplasmmembranecytoplasmmembranecytoplasm
SalivaryGland
Sporozoite+ - + + - - + -
HemocoelSporozoite + - + - - - - -Ookinete - - - - + + - -AsexualStages - - - - - - - -
Table 2: Expression and localization of several Plasmodium invasion mediating proteins
CSP, TRAP and CTRP are related proteins that play a role in Plasmodium recognition and invasion during thesporozoite (CSP and TRAP) and ookinete (CTRP) life cycle stages. TLP is an uncharacterized protein that hasdomain homology to these three known invasion-mediating proteins. This knowledge has led to the hypothesisthat TLP, like CSP and TRAP, might be involved in host cell recognition and invasion. Quantitative Real-TimePCR has revealed that the TLP gene is expressed during the sporozoite stage. Preliminary IFA suggest that theTLP protein is only expressed in salivary gland sporozoites. To date, the sub-cellular localization is unknown.
of pyrimethamine resistance in the TLP-knockout parasites, suggest that it is likely that the
cassette is properly inserted. To further verify the knockout, Southern blot analysis is necessary.
Future work includes hepatocyte invasion assays to assess the significance of TLP in sporozoite
and Immunofluoresce Assays (IFA) to determine the cellular localization of TLP. We expect
TLP is either localized to the cell surface, similar to CSP, or localized to the micronemes, similar
to TRAP. Depending on the outcomes of these characterization steps, TLP could become a very
early drug target candidate.
References
Centers for Disease Control. National Center for Infectious Diseases, Division of Parasitic Diseases.
Deitsch KW, Driskill CL, Wellems TE. Transfer motion of malaria parasites by the spontaneous uptake and expression ofDNA from human erythrocytes. Nucleac Acids Res. 2001;pp850-853.
Dessens JT, Beetsma AL, Dimopoulos G, Wengelnik K, Crisanti A, Kafatos FC, Sinden RE. CTRP is essential formosquito infection by malaria ookinetes. The EMBO Journal. 1999;Vol. 18 No22 pp6221-6227.
Duraisingh MT, Triglia T, Corman AF. Negative selection of Plasmodium falciparum parasites. Nucleic Acids Res.2002;pp716-724.
Fairhurst RM, Baruch DI, Brittain NJ, Ostera GR, Wallach JS, Hoang HL, Hayton K, Guindo A, Makobongo MO,Schwartz OM, Tounkara A, Doumbo OK, Diallo DA, Fujioka H, Ho M, Wellems TE. Abnormal display ofPfEMP-1 on erythrocytes carrying haemoglobin C may protect against malaria. Nature. 2005 Jun23;435(7045):1117-21.
Fairhurst RM, Wellems TE. Modulation of malaria virulence by determinants of Plasmodium falciparum erythrocytemembrane protein-1 display. Curr Opin Hematol. 2006 May;13(3):124-30.
Gardner MJ, Hall N, Fung E, White O, Berriman M, Hyman RW, Carlton JM, Pain A, Nelson KE, Bowman S, Paulsen IT,James K, Eisen JA, Rutherford K, Salzberg SL, Craig A, Kyes S, Chan MS, Nene V, Shallom SJ, Suh B,Peterson J, Angiuoli S, Pertea M, Allen J, Selengut J, Haft D, Mather MW, Vaidya AB, Martin DM, FairlambAH, Fraunholz MJ, Roos DS, Ralph SA, McFadden GI, Cummings LM, Subramanian GM, Mungall C, VenterJC, Carucci DJ, Hoffman SL, Newbold C, Davis RW, Fraser CM, Barrell B. Genome sequence of the humanmalaria parasite Plasmodium falciparum. Nature. 2002 Oct 3;419(6906):498-511.
Greenwood B & Mutabingwa T. Malaria in 2002. Nature 415, 670-672 (7 February 2002)
Guinovart C, Navia MM, Tanner M, Alonso PL. Malaria: burden of disease. Curr Mol Med. 2006 Mar;6(2):137-40.
Hayward RE, Derisi JL, Alfadhli S, Kaslow DC, Brown PO, Rathod PK. DNA microarrays and stage-specific geneexpression in Plasmodium falciparum malaria. Mol Microbiol. 2000 Jan;35(1):6-14.
Kaneko O, Templeton TJ, Iriko H, Tachibana M, Otsuki H, Takeo S, Sattabongkot J, Torii M, Tsuboi T. The Plasmodiumvivax homolog of the ookinete adhesive micronemal protein, CTRP. Parasitol Int. 2006 Sep;55(3):227-31. Epub2006 Jul 5.
Miller LH, Baruch DI, Marsh K, Doumbo OK. The pathogenic basis of malaria. Nature. 2002 Feb 7;415(6872):673-9.
Sachs J & Malaney P. The economic and social burden of malaria. Nature. 2002 Feb 7;415(6872):680-5.
Sambrook, J., Fritsch, E.M. and Maniatis, T. (1989) Molecular cloning: a laboratory manual, 2nd edition, Cold SpringHarbor Laboratory, Cold Spring Harbor, New York.
Templeton TJ, Deitsch KW. Targeting malaria parasite proteins to the erythrocyte. Trends Parasitol. 2005 Sep;21(9):399-402.
Wengelnik K, Spaccapelo R, Naitza S, Robson KJ, Janse CJ, Bistoni F, Waters AP, Crisanti A. The A-domain and thethrombospondin-related motif of Plasmodium falciparum TRAP are implicated in the invasion process ofmosquito salivary glands. 1999 Oct 1;18(19):5195-204.
Yuda M, Sakaida H, Chinzei Y. Targeted disruption of the Plasmodium berghei CTRP gene reveals its essential role inmalaria infection of the vector mosquito. J Exp Med. 1999 Dec 6;190(11):1711-6.Click here to read