characterization of the mycobacterium tuberculosis inibac ... · range of inhibitors to cell wall...

JOURNAL OF BACTERIOLOGY,0021-9193/00/$04.0010

Apr. 2000, p. 1802–1811 Vol. 182, No. 7

Copyright © 2000, American Society for Microbiology. All Rights Reserved.

Characterization of the Mycobacterium tuberculosis iniBAC Promoter,a Promoter That Responds to Cell Wall Biosynthesis Inhibition

DAVID ALLAND,1* ANDRIES J. STEYN,2† TORIN WEISBROD,2 KATE ALDRICH,1

AND WILLIAM R. JACOBS JR.2

Division of Infectious Diseases, Montefiore Medical Center, Bronx, New York 10467,1 and Howard Hughes Medical Institute,Department of Microbiology and Immunology, Albert Einstein College of Medicine, Bronx, New York 104612

Received 11 October 1999/Accepted 22 December 1999

The cell wall provides an attractive target for antibiotics against Mycobacterium tuberculosis. Agents such asisoniazid and ethambutol that work by inhibiting cell wall biosynthesis are among the most highly effectiveantibiotics against this pathogen. Although considerable progress has been made identifying the targets for cellwall active antibiotics, little is known about the intracellular mechanisms that are activated as a consequenceof cell wall injury. These mechanisms are likely to have an important role in growth regulation and in theinduction of cell death by antibiotics. We previously discovered three isoniazid-induced genes (iniB, iniA, andiniC) organized in tandem on the M. tuberculosis genome. Here, we investigate the unique features of theputative iniBAC promoter. This promoter was specifically induced by a broad range of inhibitors of cell wallbiosynthesis but was not inducible by other conditions that are toxic to mycobacteria via other mechanisms.Induction required inhibitory concentrations of antibiotics and could be detected only in actively growing cells.Analysis of the iniBAC promoter sequence revealed both a regulatory element upstream and a potentialrepressor binding region downstream of the transcriptional start site. The induction phenotype and structureof the iniBAC promoter suggest that a complex intracellular response occurs when cell wall biosynthesis isinhibited in M. tuberculosis and other mycobacteria.

New therapies are urgently needed to treat Mycobacteriumtuberculosis, one of the leading causes of death from a singleinfectious disease worldwide (15). Although this pathogen canbe treated effectively with multidrug therapy (1), incompletetreatment has led to the development of drug-resistant strains(17, 30). In general, antibiotics that inhibit cell wall biosynthe-sis are among the most effective agents against bacterial patho-gens. In the case of M. tuberculosis, a number of highly effectiveantibiotics including isoniazid (INH) and ethambutol work byinhibiting biosynthesis of the mycobacterial cell wall. Becausethe cell wall is an attractive target for antibiotic development,considerable effort has been focused on discovering the meta-bolic steps that are essential for biosynthesis of cell wall com-ponents (10, 11, 23, 28). The enzymatic targets of many cellwall active antibiotics also have been discovered recently (7, 12,25, 38).

Despite progress in characterizing the mycobacterial cellwall, very little is known about the intracellular mechanismsthat are activated as a consequence of cell wall injury. Antibi-otic-induced cell death may involve events that are not directlyrelated to inhibition of the primary antibiotic target. For ex-ample, autolysins are activated when cell wall biosynthesis isinhibited by b-lactam antibiotics in many gram-positive bacte-ria (13, 19, 39). Microarray technology has revealed that di-verse sets of genes are induced following treatment of cellswith drugs (14, 42). In the case of M. tuberculosis, novel anti-biotics that directly target these pathways may be highly effec-tive in the treatment of disease due to this organism, eitheralone or synergistically with other cell wall-active agents. The

identification of promoters that are specifically induced by cellwall damage could also be valuable as part of a screen thatused reporter assays to discover novel cell wall-active com-pounds (25).

In the course of studying the differential gene expression ofM. tuberculosis in response to INH, we discovered three INH-induced genes organized in tandem on the M. tuberculosisgenome that we termed iniB, iniA, and iniC (3). We postulatedthat all three ini genes comprised a single operon, iniBAC.Northern blot and reverse transcription-PCR experimentsdemonstrated that the iniA gene was induced by both INH andethambutol (3), two antibiotics that act on the cell wall bydifferent mechanisms (7, 12, 25, 38). The kasA gene has beenshown to be induced by INH and the related compound ethi-onamide (25, 42). However, no mycobacterial promoters thatare induced by unrelated antibiotics targeting different path-ways of cell wall biosynthesis have been identified. Little isknown about the structure of regulated promoters in M. tuber-culosis. The inducible promoters that have been characterizedin M. tuberculosis include promoters for the sigma factors sigB(20) and sigF (27), the DNA repair protein recA (26), and theresponse regulator mtrA (41). In the case of recA, a putativeupstream activation sequence has been identified, and a Cheo-like box that binds to the transcriptional repressor LexA hasbeen found (26). Here, we demonstrate that the promoter ofthe putative iniBAC operon is specifically induced by a broadrange of inhibitors to cell wall biosynthesis including antibioticsthat inhibit the synthesis of (i) peptidoglycan (ampicillin andampicillin/sulbactam [24]), (ii) arabinogalactam (ethambutol[12, 38]), (iii) mycolic acids (INH, ethionamide, and 2-alkynoicacid [KOAs]), and (iv) fatty acids (5-chloropyrazinamide[5-chloro-PZA]) (7, 25; O. Zimhony et al., unpublished data).We characterize the nature of the induction and demonstratethe suitability of the promoter to screen for cell wall-activeantibiotics using luciferase reporter plasmids. The structure of

* Corresponding author. Mailing address: Division of InfectiousDiseases, Centennial Building 4th floor, Montefiore Medical Center,111 East 210th St., Bronx, NY 10467. Phone: (718) 920-2971. Fax:(718) 920-2746. E-mail: [email protected].

† Present address: Department of Immunology and Infectious Dis-ease, Harvard School of Public Health, Boston, MA 02115.

1802

on October 14, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

the promoter is investigated and likely regulatory sequencesare identified.

MATERIALS AND METHODS

Bacteria and culture methodology. Escherichia coli DH5a (33) was used for allplasmid constructions. E. coli cultures were grown at 37°C in Luria-Bertanimedium (33) with the addition of hygromycin B (200 mg/ml; Sigma, St. Louis,Mo.) or kanamycin (40 mg/ml; Sigma) where appropriate. Mycobacterium bovisBCG Pasteur and BCG Montreal strains ATCC 35735 and ATCC 35747, and M.smegmatis strain mc2155 (34) were grown at 37°C on a rotary shaker in Middle-brook 7H9 medium (Difco, Detroit, Mich.) containing 0.05% Tween 80, 0.02%glycerol, and 10% oleic-albumin dextrose complex (Becton Dickinson, Cock-eysville, Md.), with the addition of hygromycin B (50 mg/ml) for strains contain-ing pYUB509-based constructs or kanamycin (24 mg/ml) for mc2155 strainscontaining pCV125-based constructs. For induction experiments, additional an-tibiotics were added at the indicated final concentrations. BCG and mc2155strains were cultured in 150-cm2 tissue culture flasks (Corning, Cambridge,Mass.) at 100 ml per flask, starting from 1:100 dilutions of strain stocks. Cultureswere grown to an optical density at 590 nm (OD590) of approximately 0.4, exceptfor experiments specifically designed to examine promoter induction at variousODs. The cultures were then split into 30-ml square medium bottles (Nalgene,Rochester, N.Y.) at 5 ml per bottle, antibiotics and other reagents were added tothe growing cultures as indicated, and the cultures were then returned to theincubator. Culture aliquots were removed at specified time points for luciferaseor b-galactosidase assays.

Sequence positions. The sequence numbering used in this study correspondsto the M. tuberculosis genomic sequence position (16; National Center for Bio-technology Information [NCBI] database [http://www.ncbi.nlm.nih.gov/cgi-bin/Entrez/framik?db5Genome&gi5135]). By this convention, the iniB gene (Rv0341or MTCY13E10.01) starts at 409354, the iniA gene (Rv0342 or MTCY13E10.02)starts at 410824, and the iniC gene (Rv0343 or MTCY13E10.03) starts at 412755.The translational start sites designated in this investigation vary slightly fromprevious annotations.

Plasmids and strains. The plasmids and strains used in this study are listed inTable 1. Plasmid pYUB509, containing lacZ and fflux reporter genes, was used toconstruct pG4697-6 and pG1697-3 for testing iniBAC promoter activity in lucif-erase and b-galactosidase assays (Table 1). Plasmid pG4697-6, which containeda sequence beginning 211 bp upstream of the first iniBAC open reading frame(iniB) extending to the translational start site, was transformed into the antibi-otic-susceptible BCG Montreal strain ATCC 35735 (BCGS) to create strainBCGS(pG4697-6). Plasmid pG4697-6 was also transformed into the INH-resis-tant BCG Montreal strain ATCC 35747 (BCGR), which contains a deletion inthe katG gene, to create strain BCGR(pG4697-6). Plasmid pG1697-3, whichcontained the same 211-bp region in the reverse orientation, was transformedinto BCGS to create strain BCGS(pG1697-3). Plasmid pCV125, an integratingvector containing kanamycin resistance and a promoterless lacZ gene, was ob-tained from MedImmune (Gaithersburg, Md.). This plasmid was used as thebasis for constructs aimed at testing the activity of partial promoter deletions.Fourteen plasmids were constructed by ligating successive 59 or 39 deletions ofthe 211-bp sequence upstream of iniB into pCV125 (Table 1). These 14 plasmidswere transformed into M. smegmatis strain mc2155 to create strains mc2155(pG4799-1) through mc2155(pG4799-12), mc2155(pG15499-1), and mc2155(pG15499-2). The finished plasmid constructs were subjected to automated DNAsequencing in order to exclude mutations that could occur during the PCR orcloning process. The unpublished plasmid pKB15 was a gift of Graham Hatfull,this integrating plasmid carries the fflux gene under control of the L5 phage pLpromoter, resulting in constitutive expression of luciferase. Plasmid pKB15 alsocontains hygromycin and ampicillin resistance genes and L5 attP, int, and oriE.pKB15 was transformed into BCG Pasteur, resulting in strain BCG(pKB15).

Chromosomal DNA and RNA extraction. Chromosomal DNA from differentmycobacterial species was extracted using a sodium dodecyl sulfate (SDS)-hexa-decyltrimethylammonium bromide (Fisher, Pittsburgh, Pa.) protocol as de-scribed previously (2). For RNA preparation, BCG strain ATCC 35735 wasgrown to an OD590 of 0.5. INH was then added to the culture for a finalconcentration of 1.0 mg/ml, or the culture was allowed to continue without addedINH. After an additional 18-h incubation, RNA was extracted using a TRIzol(Life Technologies, Gaithersburg, Md.) based protocol as described previously(3).

PCR generation of amplicons. PCRs were performed in 50-ml volumes con-taining either 10 ng of chromosomal DNA or 1 ng of plasmid DNA with 2.5 mMeach deoxynucleosides triphosphate, 20 pmol each of upstream and downstreamprimers, 1.25 U of Taq polymerase with a final concentration of 13 PCR buffer(Gibco BRL, Grand Island, N.Y.), and 2 mM MgCl2. DNA was amplified in anApplied Biosystems Geneamp 9700 thermal cycler (Perkin-Elmer, Foster City,Calif.) for 30 cycles of 94°C for 1 min, annealing at 55°C for 1 min, and 72°C for1 min, followed by 72°C for 10 min.

Luciferase assays. At specified time points, 25 ml of each culture was removedand added to 75 ml of 7H9 medium in a glass cuvette (Lumacuvette-P; Celsis-Lumac, Landgraaf, The Netherlands). Luciferase activity was measured using 40mM luciferin (Sigma) in 1 M C6H5Na3O7 z 2H2O (pH 4.5) in a Lumac 2010Aluminometer (Celsis-Lumac) according to the manufacturer’s recommendations.

Induction was calculated as follows: relative light units (RLU) for sample cul-ture/RLU for medium-only control culture, if RLU for sample . RLU forcontrol. A decrease in luciferase activity of the sample culture compared to thecontrol culture (repression) was calculated as RLU for control/RLU for sample.

b-Galactosidase assays. At specified time points, 500 ml of each culture wasset aside on ice for subsequent measurement of the OD590. An additional 500 mlof each culture was simultaneously removed and added to 500 ml of Z buffer (60mM Na2HPO4 z 7H2O, 40 mM NaH2PO4 z H2O, 10 mM KCl, 1 mM MgSO4 z7H2O, 50 mM b-mercaptoethanol, adjusted to pH 7.0) in a 2-ml microcentrifugetube. Two drops of chloroform and one drop of 0.1% SDS were then added, andthe tubes were vortexed for 30 s. The tubes were incubated at 28°C for 5 min, 200ml of fresh o-nitrophenyl-b-D-galactopyranoside (ONPG) (4 mg/ml; Sigma) in Zbuffer was added to each tube, and the tubes were shaken well and incubated at28°C. When a faint yellow color appeared in the control tube (5 to 20 min), thereaction was stopped with 0.5 ml of 1 M Na2CO3 and spun in a microcentrifugeat top speed for 5 min, and the OD420 of the supernatant was measured.b-Galactosidase units were calculated using the formula 1,000 3 OD420/time(minutes) 3 0.5 3 OD590.

Primer extension. Oligonucleotide primers were end labeled with [g32P]ATPat their 59 ends, using T4 polynucleotide kinase as described in the primerextension kit (Promega, Madison, Wis.); 0.1 pmol of labeled primer was an-nealed to 6.5 mg of total RNA at 75°C for 0.5 h. Extension was carried out withavian myeloblastosis virus reverse transcriptase (Promega) according to the man-ufacturer’s instructions at 42°C for 0.5 h. The reactions were added to 20 ml ofloading dye (98% [vol/vol] formamide, 10 mM EDTA, 0.1% xylene cyanol, 0.1%bromophenol blue) and denatured at 90°C for 10 min. The reaction productswere then run on an 8% polyacrylamide-urea sequencing gel. Bands were visu-alized by autoradiography. Sequencing reactions were carried out by cycle se-quencing (Perkin-Elmer) according to the manufacturer’s instructions.

Southern blots. Genomic DNA from different mycobacterial species was di-gested with PvuII, subjected to electrophoresis in a 0.7% agarose gel, and trans-ferred by capillary action to Biotrans Plus nylon membranes (ICN Pharmaceu-ticals, Costa Mesa, Calif.). The blots were prehybridized at 50°C in Rapid-Hybbuffer (Amersham, Arlington Heights, Ill.) and then hybridized overnight with[a32P]dCTP-radiolabeled (Megaprime labeling kit; Amersham) probes. Theprobe complementary to a 400-bp segment of the iniA gene was generated byPCR using the primers iniART-T and iniART-B. The probe complementary tothe entire iniB gene was generated by a BamHI-NruI digestion of pG7897-4(Table 1). The blots were washed in progressively more stringent conditions untilautoradiography revealed clear bands and minimal background hybridization.

Statistical analysis. Mean induction or repression and 95% confidence inter-nals were calculated using Microsoft Excel 97 software.

RESULTS

Induction of the iniBAC promoter. The discovery that theiniA gene was induced by ethambutol as well as INH (3) sug-gested that induction was not specific to inhibition of mycolicacid biosynthesis. Integrating reporter plasmids containing theiniBAC promoter fused to the genes encoding luciferase andb-galactosidase were constructed to further investigate the in-duction characteristics. The iniA gene appeared to be the sec-ond gene in a three-gene operon consisting of iniB, iniA, andiniC. We chose to investigate the promoter activity of thesequence extending 211 bp upstream of iniB to the transla-tional start site of iniB (positions 409142 to 409353). BCGS

(pG4697-6), which contained the full-length 211-bp sequence,was cultured to log phase and then split into untreated portionsor portions that were treated with antibiotics and other re-agents. Induction was assessed by comparing luciferase activityin the treated portions to that in the untreated control. Signif-icant induction occurred in the presence of many different cellwall-active agents despite the divergence of their known mech-anisms of action (Fig. 1A). After 24 and 48 h of incubationwith antibiotics, induction by INH, ethambutol, ethionamide,5-chloro-PZA, and KOA was 10- to 30-fold greater than con-trol cultures. Induction by ampicillin, and by the combinationb-lactam–b-lactamase inhibitor Unasyn (ampicillin/sulbac-tam), was consistently three- to fivefold greater than in controlcultures. Induction by INH was reversed by coincubation withrifampin, indicating that the induction was due to increasedrates of transcription. Among the cell wall biosynthesis inhib-itors tested, only cycloserine did not result in induction of thereporter.

VOL. 182, 2000 PROMOTER INDUCTION BY CELL WALL INHIBITORY ANTIBIOTICS 1803


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

To ensure that the observed induction was not simply due toluciferase release into the media by cell wall-active antibiotics,the experiments were repeated with BCG(pKB15), a BCGstrain which expressed luciferase constitutively. In contrast toBCGS(pG4697-6), luciferase expression in the BCG(pKB15)cultures decreased or remained unchanged under all experi-

mental conditions (Fig. 1B). The results demonstrate that the211-bp sequence immediately upstream of the iniB gene con-tains the promoter for the putative iniBAC operon. Inductionof this promoter was specific to antibiotics that inhibit cell wallbiosynthesis. The promoter was either not induced or re-pressed by other biological stresses, including hydrogen perox-

TABLE 1. Plasmids used in this study

Plasmid Description or source

pYUB509 The complete coding region for leuD and leuC was generated by PCR of pYUB 516 (8) using primers B1A and B4B. ThePCR fragment was digested with SnaB1 and NsiI and cloned into SnaB1/NsiI-digested pYUB469 (see below) to generatepLCD1. Plasmid pLCD1 was digested with SnaB1 and HindIII (partial); the resulting 5.2-kb fragment was treated withKlenow enzyme and cloned into SnaB1/PmlI-digested pYUB503 (see below) to generate pYUB506. The kanamycinresistance gene present in pYUB506 was removed by SpeI and HindIII (partial) digestion and replaced with thehygromycin gene generated by PCR of pMV261-H (a hygromycin-resistant derivative of pMV261 (36), using primersHYG1 and HYG2 to generate pYUB509.

pYUB503 Plasmid pYUB178 (31) containing an EcoRI polylinker with PacI, SnaB1, KpnI, PmlI, and PacI restriction sites cloned intothe EcoRI site. The KpnI site of pYUB178 was also destroyed with Klenow enzyme.

pYUB469 A general laboratory plasmid containing the full-length, promoterless E. coli lacZ and firefly fflux genes, cloned in tandeminto pBluescript KS (Stratagene, La Jolla, Calif.).

pG4697-6 The integrating plasmid pYUB509 with a 211-bp insertion containing the iniBAC promoter region. The insert consisted ofthe sequence beginning 211 bp upstream of the first iniBAC open reading frame (iniB) extending to the translational startsite (409142–409353). The sequence was generated from M. tuberculosis strain H37Rv genomic DNA by a seminestedPCR using primers iigBPT and iigBPIIB followed by a second PCR using primers iigBproxhoT and iigBpro2xhoB, whichcontain 59 XhoI sites. The PCR fragment was then inserted into the unique XhoI site of pYUB509 in the correctorientation.

pG1697-3 Same as pG4697-6 but inserted into pYUB509 in the reverse orientation

pCV125 Described in Materials and Methods

pG21898-12 211-bp iniBAC promoter sequence generated by PCR of pG4697-6 plasmid DNA using primers iniBproEcoT andiniBproSalB, inserted into the integrating plasmid pCV125 between the EcoRI and SalI restriction sites

pG21298-1 pG21898-12 with 18-bp 59 deletion of the 211-bp fragment, generated by PCR using primers iniBproEcoT20 andiniBproSalB

pG20298-2 pG21898-1 with 42-bp 59 deletion, generated using primers iniBproEcoT43 and iniBproSalB


pG21298-4 As in pG21898-1 with 89-bp 59 deletion, generated using primers iniBproEcoT90 and iniBproSalB






pG20298-10 pG21898-1 with 19-bp 39 deletion, generated using primers iniBproEcoT and iniBproSalB193


pG15499-2 pG20298-10 with 19-bp 39 deletion and 19-bp 39 spacer sequence, generated using primers iniBproEcoT andiniBproSalB193spa


pG7897-4 XmnI-PvuII fragment of the M. tuberculosis genome containing the iniB and iniA gene, cloned into the PvuII site ofpMV261 (36)

pKB115 Described in Materials and Methods

1804 ALLAND ET AL. J. BACTERIOL.


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

ide, heat shock, acidosis, and the antibiotics kanamycin, cipro-floxicin, and rifampin, that do not directly inhibit cell wallbiosynthesis (Fig. 1A). Induction also was not observed afterincubation with paraminosalicylic acid, an antituberculosisdrug with an unknown mechanism of action. Importantly, dis-ruption of the cell wall by lysozyme or granulysin also led torepression rather than induction of luciferase activity. Thesefindings demonstrate that induction of the iniBAC promoter

was due to inhibition of cell wall biosynthesis and could not becaused simply by lysis or disruption of the cell wall.

Next, induction was assessed using the INH-resistant strainBCGR(pG4697-6), which contains the same luciferase reporterconstruct as BCGS(pG4697-6) but is INH resistant due to adeletion in the katG gene. The katG gene encodes catalase-peroxidase, which is required to convert INH into its activeform (43). Induction by INH was not observed with this strain;

FIG. 1. Effects of different compounds on iniBAC promoter activity as measured by luciferase assays of integrated transcriptional fusion plasmids. Induction isshown after incubation with compounds for 24 h (grey bars) or 48 h (black bars). Final concentrations are indicated in micrograms per milliliter. Error bars represent95% confidence intervals. (A) INH-susceptible BCGS(pG4697-6) containing the iniBAC promoter fused to lacZ and fflux genes [-Pro indicates assays performed withBCGS(pG1697-3), which contains the same construct, except that the transcriptional fusion was performed by inserting the promoter in the opposite orientation fromthe coding region]. (B) INH-susceptible BCG(pMKB15) containing the L5 phage pL promoter fused to the fflux gene. (C) INH-resistant BCGR(pG4697-6) containingthe iniBAC promoter fused to lacZ and fflux genes.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

however, it remained inducible in the presence of other anti-biotics (Fig. 1C). This demonstrated that induction was due tothe biological activity of INH and was not due to nonspecificeffects of the unactivated compound. This conclusion is sup-ported by the observation that induction was observed only atantibiotic concentrations at or above their MICs (Fig. 2). In-duction did not increase further at concentrations above theMIC, although maximum induction occurred more rapidly atthe higher concentrations.

One inhibitor of cell wall biosynthesis, cycloserine, appearedto result in repression of luciferase expression. However, treat-ment with cycloserine resulted in rapid cell lysis, a phenome-non that was not observed with the other antibiotics. Inductionexperiments were repeated with diminishing doses of cy-closerine, but induction was not detected at any concentrationof this drug. A lacZ reporter system is less dependent on fullviability of the cells at the time of the induction assay (40).Induction experiments using ONPG to measure b-galactosi-dase activity also failed to consistently detect induction bycycloserine (data not shown). In contrast, all of the otherinhibitors of cell wall biosynthesis resulted in induction whenmeasured by b-galactosidase assay.

Induction kinetics. The time course of iniBAC promoterinduction after incubation with antibiotics was tested by incu-bating BCGS(pG4697-6) with INH (1 mg/ml) or ethambutol (5mg/ml) and assessing serial aliquots for luciferase activity. In-duction was apparent as early as 4 h after incubation witheither antibiotic, reaching a maximum between 25 and 48 h(Fig. 3).

The effect of the growth phase of the culture on inductionwas also studied. We speculated that ATP levels might bedependent on growth phase; therefore, b-galactosidase assayswere used to measure induction in these experiments.BCGS(pG4697-6) was grown from a highly diluted culture untilit reached stationary phase. Two aliquots were removed fromthe culture every 24 h starting at an OD590 of 0.1. Ethambutolwas added to one of the paired aliquots, then both were rein-cubated for an additional 24 h, and b-galactosidase activity wasmeasured. These experiments demonstrated that iniBAC pro-moter activity increased slowly as the OD590 of the cultureincreased (Fig. 4). However, induction by ethambutol occurredonly during log-phase growth and disappeared when the cul-

tures reached stationary phase. Similar induction characteris-tics were observed after incubation with INH (data not shown).

Species distribution of the iniBAC operon. We previouslydetermined that INH induced the iniA genes from both M.tuberculosis H37Rv and BCG (3). The 211-bp promoter regionwas sequenced in BCG strain ATCC 35735. Alignment withthe corresponding sequence in M. tuberculosis strain H37Rv(16; NCBI database) revealed that the two sequences were100% identical. Because mycobacterial species have similarcell wall structures, the presence of the iniBAC operon indifferent species of mycobacteria was assessed. Two probeswere used, one complementary to a 400-bp region of the iniAgene and the other complementary to the entire iniB gene. Theradiolabeled probes were hybridized separately to Southernblots containing genomic digests of three M. tuberculosisstrains (Erdman, H37Rv, and H37Ra), of mycobacterial strainBCG, and of M. smegmatis (strain mc2155), M. avium, M.marinum, M. microti, and M. nonchromogenicum. The iniAprobe hybridized strongly to single bands in all of the speciesexcept M. avium and M. nonchromogenicum. Hybridization to

FIG. 2. Induction of the iniBAC promoter in BCGS(pG4697-6) after incuba-tion with INH for 24 (■) and 48 (h) h and with ethambutol for 24 (Œ) and 48(‚) h.

FIG. 3. Induction of the iniBAC promoter in BCG strain BCGS(pG4697-6)after incubation with INH (1 mg/ml; ■) and ethambutol (5 mg/ml; ‚) as afunction of incubation time.

FIG. 4. Induction in different phases of growth. BCGS(pG4697-6) was sub-cultured by performing a 1:100 dilution of an actively growing culture. Serialaliquots were removed at increasing OD590 and split into paired subcultures. Onesubculture of each pair was not treated with antibiotics (F); the other subcultureof each pair was treated with ethambutol at a final concentration of 5 mg/ml (h).After an additional 24 h, b-galactosidase activity was measured. b-Galactosidaseunits are shown as a function of the OD590 of the paired subcultures at the timethat they were removed from the parent culture.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

the M. nonchromogenicum genomic DNA resulted in two weakbands (Fig. 5). The iniB probe also failed to hybridize to M.avium, although it hybridized strongly to all of the other spe-cies except M. marinum. A control probe complementary to aregion of the M. tuberculosis 16S rRNA gene hybridized to allof the species tested.

Mapping the transcriptional start site of the BCG iniBACoperon. The transcriptional start site for the operon was de-termined by primer extension analysis in order to better un-derstand the structure of the promoter region. Total RNA wasextracted from BCGS grown in the presence or absence of INHduring the last 18 h of culture. Primer extension was performedwith both samples using iniBprimer ext-3, which is complemen-tary to the first 21-bp of the translated M. tuberculosis iniB gene(Table 2). No products were visualized in the primer exten-sions of BCG RNA that had not been treated with isoniazid. Asingle product was detected after primer extension of RNAfrom isoniazid treated BCG. The band was situated 45 bpupstream of the likely translational start site (position 409308)(Fig. 6). Primer extensions performed with two additionalprimers complementary to other iniB gene sequences(iniBprimer ext-1 and iniBprimer ext-2) yielded identical re-sults (not shown). The complete absence of product from theRNA that was not treated with INH was confirmed by pro-longed exposure of the gels. This result is consistent with pre-viously described Northern blot hybridizations of M. tubercu-losis in which no iniA RNA was detected unless the sampleswere treated with INH (3).

Deletion analysis of the iniBAC promoter. The inductionkinetics of the 211-bp M. tuberculosis iniBAC promoter regionwas investigated in M. smegmatis using strain mc2155(pG4799-12). This strain contained the full-length M. tuberculosis pro-moter region cloned into the integrating vector pCV125 up-stream of lacZ. We observed that M. smegmatis had aninduction phenotype similar to that of BCG, although higherconcentrations of INH were required because M. smegmatis isrelatively INH resistant. Induction by INH (100 mg/ml) and 5ethambutol (5 mg/ml) was seen as early as 30 min after incu-bation with antibiotics and was maximal after 4 h of incubation.

FIG. 5. Testing of the iniBAC operon in different mycobacterial species.Mycobacterial species were tested by low-stringency Southern blot hybridizationfor the presence of the iniA and iniB genes: M. marinum (lane 1), H37ra (lane 2),M. tuberculosis strains Erdman (lane 3) and H37Rv (lane 4), M. avium (lane 5),BCG (lane 6), M. smegmatis (lane 7), M. nonchromogenicum (lane 8), and M.microti (lane 9). (A) Agarose gel showing PvuII digests of chromosomal DNA.(B) Southern blot of the gel in panel A hybridized with the iniA gene probe. (C)Hybridization with the M. tuberculosis 16S RNA gene probe. (D) Hybridizationwith the iniB gene.

TABLE 2. Primers used in this study

Name Sequence, added restriction sites (underlined), spacer sequences (lowercase) Positiona

iigBPT GATCATCACGGCTACGACATCCAC 409142–409165iigBPIIB TGACCGCCGAAACCACCGCTTGAC 409745–409722iigBproxhoT GGAACTCGAGATCATCACGGCTACGACATCCAC 409143–409165iigB2proxhoB TCATCTCGAGTTCCCTTCAATCGAAGAAGC 409353–409334iniBproEcoT CCGTCGAATTCGATCATCACGGCTACGACATCCAC 409142–409165iniBproSalB TCATGTCGACTTCCCTTCAATCGAAGAAGCTGTT 409353–409330iniBproEcoT20 CGGCTGAATTCTCCACGGATAAGTTCCGGACCGGC 409161–409184iniBproEcoT43 TTCCGGAATTCCGTAGGGGTGCCCCATTTCCCCTA 409184–409207iniBproEcoT65 CCCATGAATTCTAATCCCCTAACGCGGCGGCCAGG 409206–409229iniBproEcoT90 GGCGGGAATTCCGATCCCGATAGGTGTTTGGCCGG 409231–409254iniBproEcoT113 TTGTTGAATTCGCTTGCGGATCAGACCCCGATTTC 409254–409277iniBproEcoT134 CAGACGAATTCTTCGGGGTGAGGCGGAATCCATAG 409275–409298iniBproEcoT154 AGGCGGAATTCATAGCGTCGATGGCACAGCGCCGG 409295–409318iniBproEcoT175 ATGGCGAATTCCCGGTCACGCCGGCGAACAGCTTC 409315–409338iniBproEcoT189 TCACGGAATTCAACAGCTTCTTCGATTGAAGGGAA 409330–409348iniBproSalB193 AATCGGTCGACCTGTTCGCCGGCGTGACCGGCGCT 409334–409311iniBproSalB173 GGCTGGTCGACCGCTGTGCCATCGACGCTATGGAT 409314–409291iniBproSalB193-spa TTAAGGTCGACggtctccagtcgctcgactCTGTTCGCCGGCGTGACCGGCGCT 409334–409311b

iniBproSalB148 TCGGTGTCGACCGCCTCACCCCGAAATCGGGGTCT 409288–409265iniBprimer ext-1 CTGCGGAACAGGCTCAGGATGTAA 409400–409377iniBprimer ext-2 GCCCGTCCCGGAGCGGCAACGAAC 409442–409419iniBprimer ext-3 CGATAAGCGAGGTCATCTTCAT 409375–409354iniART-T GCGCTGGCGGGAGATCGTCAATG 411552–411574iniART-B TGCGCAGTCGGGTCACAGGAGTCG 412043–412020B1A ACATACGTACAACTCGAGAGAGGCACTTCGAGATGGCCTT NAB4B ACAATGCATTCAGGGGGCGGGTAGAGTGCGCGGTTTCCA NAHYG1 TGCCAACTAGTGCCCGTACCCTGTGAATAGA NAHYG2 GAGCAAAGCTTGCGTACGATCGACTGCCAGG NA

a Position for nucleotides after the added restriction site (if any). NA, not applicable.b Position for nucleotides after the spacer sequence.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

These conditions were used to investigate the amount of up-stream DNA sequence that was required to induce the b-ga-lactosidase reporter. Inserts containing serial 19 to 25-bp 59deletions of the 211-bp promoter region were cloned intopCV125 (Fig. 7A), and b-galactosidase activity was measured.Induction by both antibiotics was preserved until a 22-bp re-gion 169 to 147 bp upstream from the translational start site(409184 to 409206) was deleted. After deletion of this se-quence, both induction and uninduced expression fell to levelsof the promoterless plasmid control (Fig. 7B).

Effects of downstream deletions between the promoter andthe translational start site were investigated using serial 39deletions (Fig. 7A). Interestingly, a 19-bp deletion 1 to 19 bpfrom the translational start site (409353 to 409334) increasedinduction from 4.5- to 13-fold for INH, and from 19- to 53-foldfor ethambutol, without changing uninduced expression. Theincreased induction was not due to changes in the spacingbetween the promoter and the translational start site of theiniB gene. The higher level of induction continued to be ob-served after the absolute size of the promoter sequence wasrestored by replacing the 19-bp 39 deletion with a 19-bp spacersequence that was unrelated to the promoter sequence. Fur-ther 39 deletions preserved induction until a 26-bp sequence 39to 65 bp from the translational start site (409314 to 409288)was removed. When this last sequence was deleted, inductionand uninduced expression fell to levels of the promoterlessplasmid (Fig. 7B).

DISCUSSION

The iniBAC operon encodes genes that are induced specif-ically by a broad range of antibiotics that inhibit cell wallbiosynthesis. With the exception of cycloserine, the promoterwas induced by all clinically relevant antibiotics that act on theM. tuberculosis cell wall. Other toxic stimuli did not induce thepromoter, demonstrating the specificity of induction. Signifi-cant repression of luciferase activity was observed after treat-ment with a number of toxic agents that do not act by cell wall

inhibition. It is likely that the decreased availability of intra-cellular ATP levels in the dying cells contributed to this effect.

With the exception of general stress responses, it is ex-tremely uncommon for antibiotics with different mechanismsof action to induce the same set of genes in bacteria. VanA-type vancomycin resistance can be induced by different antibi-otics that inhibit cell wall synthesis, possibly through the bind-ing of peptidoglycan precursors in a two-component regulatorysystem (4, 22, 40). AmpC, the chromosomal b-lactamase ingram-negative bacteria, is induced by different b-lactam anti-biotics. Induction is oppositely controlled by cytoplasmic con-centrations of biosynthetic and degradative intermediates ofmurein metabolism (muropeptides) (21). However, VanA-typevancomycin resistance is also induced by cell wall hydrolyticenzymes such as lysozyme (40). We found that the iniBACpromoter was not induced by either lysozyme or granulysin, amolecule released by cytotoxic CD81 lymphocytes that directlykills extracellular M. tuberculosis by altering the membraneintegrity of the bacillus (35). The ampC gene is induced bydifferent b-lactam antibiotics, but these compounds are likelyto have similar mechanisms of action. In contrast, the iniBACpromoter is induced by cell wall biosynthesis inhibitors that acton different components of the cell wall. It is possible that theiniBAC operon is induced by osmotic stress; however, we be-lieve this to be unlikely. While antibiotics might lead to alter-ations in permeability of the bacterial cell wall and subsequentosmotic shock, both lysozyme and granulysin would also beexpected to result in permeability changes. Neither of thesecompounds led to induction of the promoter, suggesting that adifferent mechanism is involved in induction.

The functions of the genes encoded by the iniBAC operonare unknown. The iniB gene has weak homology to cell wallstructural proteins. The iniA and iniC genes are hypotheticalproteins with no close homologs (3). Given the induction pat-tern of this operon, it is possible that these genes participate inthe regulation of cell wall growth. It is also possible that theiniBAC operon has either a causal or a protective role in celldeath, when killing is initiated by inhibition of cell wall biosyn-thesis. Induction of the iniBAC operon was not detectable until4 h of incubation with antibiotics; in contrast, induction of theFAS-II complex and most of the other genes known to be INHinduced occurs as early as 20 min after exposure to INH (42).The delay in iniBAC induction corresponds to the time re-quired for INH to decrease the viability of M. tuberculosis inculture (37), suggesting a link between the iniBAC operon andcell death. The rapid induction kinetics of the FAS-II complexand other INH-induced genes closely parallel the repressiveeffect of INH on mycolate biosynthesis (37). This suggests thatunlike the iniBAC operon, these genes are induced by eventsrelated to the initial binding of INH to its target. The genes ofthe iniBAC operon lack close homologs in nonmycobacterialspecies. However, the iniA and iniB genes were detectable bylow-stringency hybridization in the fast-growing and avirulentM. smegmatis and in both virulent and avirulent slow-growingmycobacteria. It is intriguing that only M. avium did not hy-bridize to either gene probe. It remains possible that thesegenes are present in M. avium but have insufficient homologyto be detected by this method.

Deletion studies of the region upstream of the coding se-quences demonstrate that regulatory elements essential forgene expression are located in two regions, an upstream region169 to 147 bp 59 from the translational start site (409184 to409206) and a downstream region 65 to 39 bp 59 from thetranslational start site (409314 to 409288) (Fig. 8). The up-stream region contains a 10-bp sequence flanked by 6-bp in-verted repeats and part of two tandem 8-bp direct repeats.

FIG. 6. Mapping the transcriptional start sites of the iniBAC operon. Primerextension experiments were performed with end-labeled iniBprimer ext-3 usingeither no RNA or RNA isolated from BCG cultured in the absence of INH(INH2) or in the presence of INH at a final concentration of 1 mg/ml (INH1).Sequencing reactions were performed with the identical primer and run along-side the primer extension reactions.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

Deletion of this region resulted in decreased induction, sug-gesting the presence of UP elements, curved sequences, orbent sequences that could influence initiation of transcription(32). The downstream region includes both the transcriptionalstart site and a sequence with strong homology to 210 pro-moter sequences (9, 29). The decreased induction that resultedfrom deletion of this region is in agreement with observationsin E. coli that changes (or deletions) in the 210 region and theregion immediately downstream of the transcriptional start sitestrongly influence promoter strength (32). The observationthat induction can be increased by deleting the 19-bp 39 end ofthis promoter region is intriguing and suggests possible bindingof a transcriptional repressor downstream of the transcrip-tional start site. The increased induction is sequence specificand not due to a change in spacing because replacement of thedeletion with a spacer sequence does not alter the increasedinduction that was observed. Database analysis of regulatorysites has shown that the region downstream of 230 binds

repressors almost exclusively, whereas activators bind predom-inantly to positions between 280 and 230 (18). The possibilitythat a repressor protein binds to this region is currently beinginvestigated. The repressor sequence also appears to include aribosomal binding site. It is possible that a second, less appar-ent ribosomal binding site could exist upstream of this se-quence.

The reporter assays that we describe can be easily adapted toa 96-well plate or solid-phase format. These assays can be usedfor high-throughput screening of combinatorial libraries withthe aim of discovering new classes of compounds that inhibitMycobacterium cell wall biosynthesis. Assays that are specificfor cell wall inhibition may be more useful at finding biologi-cally active compounds than simple screens for inhibition orkilling of M. tuberculosis. When testing for inhibitory or cidalcompounds through repression of the constitutive luciferasereporter strain BCG(pKB15), highly effective drugs such asINH resulted in little inhibition of luciferase activity. Further-

FIG. 7. Effect of promoter deletions on antibiotic induction. Serial 59 and 39 deletions of the 211-bp sequence immediately upstream of the translational start siteof iniB were fused to the lacZ gene in the integrating plasmid pCV125 and transformed into M. smegmatis strain mc2155. (A) Schematic of promoter deletions andinduction after 4 h of treatment with either INH (100 mg/ml) or ethambutol (EMB; 5 mg/ml). The dotted line indicates the position of a 19-bp spacer that is unrelatedto the sequence it replaced; induction represents mean results from at least three experiments. Numbering corresponds to the distance from the translational start site.(B) b-Galactosidase activity of promoter deletions without (grey) or with (black) 4 h of incubation with INH (100 mg/ml). Values represent means of at least threeexperiments. Error bars represent 95% confidence intervals.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

more, these antibiotics were indistinguishable from relativelyineffective agents such as paraminosalicylic acid using theBCG(pKB15) assay (Fig. 1B).

In conclusion, the iniBAC operon is specifically induced byinhibitors of cell wall biosynthesis. Regulation of transcriptionis likely to be complex, involving both activator and repressormolecules. Further investigation of the regulatory elements ofthe iniBAC operon can potentially improve the understandingof the intracellular mechanisms that are activated by cell wallinhibition. Characterization of the proteins encoded by theiniB, iniA, and iniC genes may aid in the development of newantibiotics that may be effective alone or synergistically withother cell wall-active drugs.

ACKNOWLEDGMENTS

We thank Barry R. Bloom and Oren Zimhony for advice and sup-port, and we thank Rosaria Cerny for laboratory assistance. We alsothank Graham Hatfull and MedImmune Inc. for use of unpublishedvectors, Robert Modlin for his gift of granulysin, and J. P. Welsh for hisgift of 5-chloropyrazinamide.

This work was supported by National Institutes of Health grantsAI45244 and AI43268 and by the Howard Hughes Medical ResearchInstitute.

REFERENCES

1. Ad Hoc Committee of the Scientific Assembly on Microbiology, Tuberculo-sis, and Pulmonary Infections. 1995. Treatment of tuberculosis and tuber-culosis infection in adults and children. Clin. Infect. Dis. 21:9–27.

2. Alland, D., G. E. Kalkut, A. R. Moss, R. A. McAdam, J. A. Hahn, W.Bosworth, E. Drucker, and B. R. Bloom. 1994. Transmission of tuberculosisin New York City: an analysis by DNA fingerprinting and conventionalepidemiologic methods. N. Engl. J. Med. 330:1710–1716.

3. Alland, D., I. Kramnik, T. R. Weisbrod, L. Otsubo, L. P. Miller, W. R.Jacobs, Jr., and B. R. Bloom. 1998. Identification of differentially expressedmRNA in prokaryotic organisms by customized amplification libraries(DECAL): the effect of isoniazid on gene expression in Mycobacteriumtuberculosis. Proc. Nat. Acad. Sci. USA 22:13227–13232.

4. Allen, N. E., and J. N. Hobbs. 1995. Induction of vancomycin resistance inEnterococcus faecium by non-glycopeptide antibiotics. FEMS Microbiol.Lett. 132:107–114.

5. Arthur, M., C. Molinas, and P. Courvalin. 1992. The VanK-VanR two-component regulatory system controls synthesis of depsipeptide peptidogly-can precursors in Enterococcus faecium BM4147. J. Bacteriol. 174:2582–2591.

6. Balasubramanian, V., M. S. Pavelka, Jr., S. S. Bardarov, J. Martin, T. R.Weisbrod, R. A. McAdam, B. R. Bloom, and W. R. Jacobs, Jr. 1996. Allelicexchange in Mycobacterium tuberculosis with long linear recombination sub-strates. J. Bacteriol. 178:273–279.

7. Banerjee, A., E. Dubnau, A. Quemard, V. Balasubramanian, K. S. Um, T.Wilson, D. Collins, G. de Lisle, and W. R. Jacobs, Jr. 1994. inhA, a geneencoding a target for isoniazid and ethionamide in Mycobacterium tubercu-losis. Science 263:227–230.

8. Bange, F. C., A. M. Brown, and W. R. Jacobs, Jr. 1996. Leucine auxotrophyrestricts growth of Mycobacterium bovis BCG in macrophages. Infect. Im-mun. 64:1794–1799.

9. Bashym, M. D., D. Kaushal, D. K. Sujoy, and A. K. Tyagi. 1996. A study ofthe mycobacterial transcriptional apparatus: identification of novel featuresin promoter elements. J. Bacteriol. 178:4847–4853.

10. Besra, G. S., C. B. Morehouse, C. M. Rittner, C. J. Waechter, and P. J.Brennan. 1997. Biosynthesis of mycobacterial lipoarabinomannan. J. Biol.Chem. 272:18460–18466.

11. Besra, G. S., and P. J. Brennan. 1997. The mycobacterial cell wall: biosyn-thesis of arabinogalactan and lipoarabinomannan. Biochem. Soc. Trans.25:845–850.

12. Belanger, A. E., G. S. Besra, M. E. Ford, K. Mikusova, J. T. Belisle, P. J.Brennan, and J. M. Inamine. 1996. The embAB genes of Mycobacteriumavium encode an arabinosyl transferase involved in cell wall arabinan bio-synthesis that is the target for the antimycobacterial drug ethambutol. Proc.Natl. Acad. Sci. USA 93:11919–11924.

13. Best, G. K., N. H. Best, and A. V. Koval. 1974. Evidence of participation ofautolysins in bactericidal action of oxacillin of Staphylococcus aureus. Anti-microb. Agents Chemother. 6:825–830.

14. Brown, P. O., and D. Botstein. 1999. Exploring the new world of the genomewith DNA microarrays. Nat. Genet. 21:33–37.

15. Centers for Disease Control. 1993. Estimates of future global tuberculosismorbidity and mortality. Morbid. Mortal. Weekly Rep. 42:961–964.

16. Cole, S. T., R. Brosch, J. Parkhill, T. Garnier, C. Churcher, D. Harris, S. V.Gordon, L. Eiglmeier, S. Gas, C. E. Barry III, F. Tekaia, K. Badcock, D.Basham, D. Brown, T. Chillingworth, R. Connor, R. Davies, K. Devlin, T.Feltwell, S. Gentles, N. Hamlin, S. Holroyd, T. Hornsby, K. Jagels, B. G.Barrell, et al. 1998. Deciphering the biology of Mycobacterium tuberculosisfrom the complete genome sequence. Nature 393:537–544.

17. Fischl, M. A., R. B. Uttamchandani, G. L. Daikos, R. B. Poblete, J. N.Moreno, and R. R. Reyes. 1992. An outbreak of tuberculosis caused bymultiple-drug-resistant tubercle bacilli among patients with HIV infection.Ann. Intern. Med. 117:177–183.

18. Gralla, J. D., and J. Collado-Vides. 1996. Organization and function oftranscription regulatory elements, p. 1232–1245. In F. C. Neidhardt, R.Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S.Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichiacoli and Salmonella: cellular and molecular biology, 2nd ed., vol. 1. ASMPress, Washington, D.C.

19. Horne, D., and A. Tomasz. 1977. Tolerant response of Streptococcus sanguisto beta-lactams and other cell wall inhibitors. Antimicrob. Agents Che-mother. 11:888–896.

20. Hu, Y., and A. R. M. Coates. 1999. Transcription of two sigma 70 homologuegenes, sigA and sigB, in stationary-phase Mycobacterium tuberculosis. J. Bac-teriol. 181:469–476.

21. Jacobs, C., J. M. Frere, and S. Normark. 1997. Cytosolic intermediates forcell wall biosynthesis and degradation control inducible biosynthesis anddegradation control inducible b-lactam resistance in gram-negative bacteria.Cell 88:823–832.

22. Lai, M. H., and D. R. Kirsch. 1996. Induction signals for vancomycin resis-tance encoded by the vanA gene cluster in Enterococcus faecium. Antimi-crob. Agents Chemother. 40:1645–1648.

23. Lee, R. E., P. J. Brennan, and G. S. Besra. 1996. Mycobacterium tuberculosiscell envelope. Curr. Top. Microbiol. Immunol. 215:1–27.

24. Mandell, G. E., G. R. Douglas, Jr., and J. E. Bennett. 1995. Principles andpractice of infectious diseases, 4th ed. Churchill Livingstone, New York,N.Y.

25. Mdluli, K., R. A. Slayden, Y. Zhu, S. Ramaswamy, X. Pan, D. Mead, D. D.Crane, J. M. Musser, and C. E. Barry III. 1998. Inhibition of a Mycobacte-rium tuberculosis b-ketoacyl ACP synthase by isoniazid. Science 280:1607–1710.

26. Movahedzadeh, F., J. M. Colston, and E. O. Davis. 1997. Determination ofDNA sequences required for regulated Mycobacterium tuberculosis RecAexpression in response to DNA-damaging agents suggests that two modes ofregulation exist. J. Bacteriol. 179:3509–3518.

27. Michele, T. M., C. Ko, and W. R. Bishai. 1999. Exposure to antibioticsinduces expression of the Mycobacterium tuberculosis sigF gene: implicationsfor chemotherapy against mycobacterial persistors. Antimicrob. Agents Che-mother. 43:218–225.

28. Mikusova, K., M. Mikus, G. S. Besra, I. Hancock, and P. J. Brennan. 1996.Biosynthesis of the linkage region of the mycobacterial cell wall. J. Biol.Chem. 271:7820–7828.

29. Mulder, M. A., H. Zappe, and L. M. Steyn. 1997. Mycobacterial promoters.Tuberc. Lung Dis. 78:211–223.

30. Pablos-Mendez, A., M. C. Raviglione, A. Laszlo, N. Binkin, H. L. Rieder, F.Bustreo, D. L. Cohn, C. S. Lambregts-van Weezenbeek, S. J. Kim, P. Chau-let, and P. Nunn. 1998. Global surveillance for antituberculosis-drug resis-

FIG. 8. Proposed organization of iniBAC promoter region. Regions found tobe essential for induction are underlined with solid lines; the dotted underlineindicates the sequence whose deletion leads to increased induction. Also shownare the transcriptional start site (arrowhead), 6-bp inverted repeats (solid ar-rows), 8-bp direct repeats (dotted arrows), the position of the primer iniBprimerext-3 used in the primer extension experiments (striped arrow), and possible 210sequence and ribosomal binding site (rbs). The asterisk marks an alternatetranslational start site as annotated by Cole et al. (16; NCBI database).



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

tance, 1994–1997. World Health Organization-International Union againstTuberculosis and Lung Disease Working Group on Anti-Tuberculosis DrugResistance Surveillance. N. Engl. J. Med. 338:1641–1649.

31. Pascopella, L., F. M. Collins, J. M. Martin, M. H. Lee, G. F. Hatfull, C. K.Stover, B. R. Bloom, W. R. Jacobs, Jr. 1994. Use of in vivo complementationin Mycobacterium tuberculosis to identify a genomic fragment associated withvirulence. Infect. Immun. 62:1313–1319.

32. Record, M. T., Jr., W. S. Reznikoff, M. L. Craig, K. L. McQuade, and P. J.Schlax. 1996. Escherichia coli RNA polymerase (Ed70), promoters, and thekinetics of the steps of transcription initiation, p. 792–820. In F. C. Nei-dhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik,W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Esch-erichia coli and Salmonella: cellular and molecular biology, 2nd ed., vol. 1.ASM Press, Washington, D.C.

33. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: alaboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold SpringHarbor, N.Y.

34. Snapper, S. B., R. E. Melton, S. Mustafa, T. Kieser, and W. R. Jacobs, Jr.1990. Isolation and characterization of efficient plasmid transformation mu-tants of Mycobacterium smegmatis. Mol. Microbiol. 4:1911–1919.

35. Stenger, S., D. A. Hanson, R. Teitelbaum, P. Dewan, K. R. Niazi, C. J.Froelich, T. Ganz, S. Thoma-Uszynski, A. Melian, C. Bogdan, S. A. Porcelli,B. R. Bloom, A. M. Krensky, and R. L. Modlin. 1998. An antimicrobialactivity of cytolytic T cells mediated by granulysin. Science 282:121–125.

36. Stover, C. K., V. F. de la Cruz, T. R. Fuerst, J. E. Burlein, L. A. Benson, L. T.

Bennett, G. P. Bansal, J. F. Young, M. H. Lee, G. F. Hatfull, et al. 1991. Newuse of BCG for recombinant vaccines. Nature 351:456–460.

37. Takayama, K., L. Wang, and D. L. Hugo. 1972. Effect of isoniazid on the invivo mycolic acid synthesis, cell growth, and viability of Mycobacterium tu-berculosis. Antimicrob. Agents Chemother. 2:29–35.

38. Telenti, A., W. J. Philipp, S. Sreevatsan, C. Bernasconi, K. E. Stockbauer, B.Wieles, et al. 1997. The emb operon, a gene cluster of Mycobacterium tuber-culosis involved in resistance to ethambutol. Nat. Med. 3:567–570.

39. Tomasz, A., A. Albino, and E. Zanati. 1970. Multiple antibiotic resistance ina bacterium with suppressed autolytic system. Nature 227:138–140.

40. Ulijasz, A. T., A. Grenader, and B. Weisblum. 1996. A vancomycin-inducibleLacZ reporter system in Bacillus subtilis: induction by antibiotics that inhibitcell wall synthesis and by lysozyme. J. Bacteriol. 178:6305–6309.

41. Via, L. E., R. Curcic, M. H. Mudd, S. Dhandayuthapani, R. J. Ulmer, and V.Deretic. 1996. Elements of signal transduction in Mycobacterium tuberculosis:in vitro phosphorylation and in vivo expression of the response regulatorMtrA. J. Bacteriol. 178:3314–3321.

42. Wilson, M., J. DeRisi, H. H. Kristensen, P. Imboden, S. Rane, P. O. Brown,and G. K. Schoolnik. 1999. Exploring drug-induced alterations in gene ex-pression in mycobacterium tuberculosis by microarray hybridization. Proc.Natl. Acad. Sci. USA 96:12833–12838.

43. Zhang, Y., B. Heym, B. Allen, D. Young, and S. Cole. 1992. The catalase-peroxidase gene and isoniazid resistance of Mycobacterium tuberculosis. Na-ture 358:591–593.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

characterization of the mycobacterium tuberculosis inibac ... · range of inhibitors to cell wall...

Documents