characterisation and evolution of globin like genes … · 2018. 3. 1. · ii characterisation and...

CHARACTERISATION AND EVOLUTION OF

GLOBIN-LIKE GENES IN PHYLUM

CNIDARIA

Hayden Lee Smith

Bachelor of Science

Submitted in fulfilment of the requirements for the degree of Master of Applied Science (Research)

Earth, Environmental and Biological Sciences Science and Engineering Faculty

Queensland University of Technology 2018

Characterisation and evolution of globin-like genes in phylum Cnidaria i

Keywords

Actiniaria, bioinformatics, Cnidaria, differential gene expression, gene duplication,

globin gene superfamily, globin-X, hexacoordination, in silico protein prediction,

neofunctionalisation, neuroglobin, novel gene, pentacoordination, phylogenetics,

subfunctionalisation

ii Characterisation and evolution of globin-like genes in phylum Cnidaria

Abstract

Globins are among the best-studied gene and protein families in biology. In

particular, the globin superfamily of vertebrates has been extensively studied, but

little research on globin genes has occurred in early-diverging eumetazoans. This

study aimed to address this knowledge gap by identifying globin genes in early-

diverging eumetazoan phyla, such as phylum Cnidaria, and to use bioinformatic

approaches to characterise and understand the evolution, structure and expression of

these genes. Sea anemones (phylum Cnidaria; order Actiniaria) represent a highly

diverse group of organisms that inhabit different environments, and are an excellent

candidate to understand the diversity and distribution of globin genes in this phylum.

Compared to other cnidarians, sea anemones are relatively easier to obtain from their

environment and typically have large populations. Additionally, many species lack

symbionts that are a potential contaminant in experimental design. Thus, sea

anemones are the ideal cnidarian for a multitude of different experimental studies.

This study also aimed to infer possible relationships between phylum Cnidaria and

its sister group superphylum Bilateria, specifically the well-known vertebrate globin

repertoire. Cnidarians can give great insight into the evolutionary history of the

globin superfamily and could provide further knowledge to resolve the debate about

the ancestral globin gene in the vertebrate repertoire.

Using a bioinformatics approach, this research has addressed this knowledge

gap about the expression and evolution of globin genes and proteins in phylum

Cnidaria. This research has identified globin genes in four classes of cnidarians that

are molecularly, structurally and phylogenetically most similar to vertebrate

Characterisation and evolution of globin-like genes in phylum Cnidaria iii

neuroglobin and globin-X. There was a large-scale expansion of cnidarian globin-

like genes in order Actiniaria (including sea anemones) with up to 10 genes

identified across a diverse range of taxa. In silico protein predictions revealed the

possibility of two structural conformations for cnidarian globin proteins,

hexacoordinate and pentacoordinate. Additionally, the observed cnidarian globin

gene expansion specifically contained hexacoordinate sequences, however, there was

a single pentacoordinate sequence found exclusively in class Anthozoa. Tissue and

development specific expression analyses suggest that the expansion of globin-like

genes in cnidarians resulted in subfunctionalisation of duplicate copies, with a

possible neofunctionalisation event resulting in a single copy of the pentacoordinate

sequence. This research has improved our understanding of the evolution and

function of the globin gene superfamily in early-diverging eumetazoan phyla.

This thesis has helped to fill the knowledge gaps about the evolution of the

globin gene superfamily. A broad expansion of globin genes has been revealed in

two early-diverging phyla, Cnidaria and Placozoa, and these genes are similar to

vertebrate neuroglobin and globin-X genes. Subsequently, this suggests that a globin-

like gene was present in the metazoan ancestor which was most likely the progenitor

gene to the neuroglobin and globin-X subfamilies, and the expansion of the globin

gene repertoire in vertebrates. Current research has revealed that three globin

subfamilies, neuroglobin-like, myoglobin and hemoglobin, have undergone gene

expansions in divergent eumetazoan taxa and this research has identified a globin-

like gene expansion in Actiniarians. Subsequently, this is the first report of

convergent amplification in the globin superfamily. This thesis provides a starting

point for future research into the structural and biochemical properties of the

cnidarian globin proteins identified and how protein function has evolved over more

iv Characterisation and evolution of globin-like genes in phylum Cnidaria

than 600 million years of evolution. Consequently, understanding the evolution,

expression and structure of globin genes and proteins will improve our understanding

of the vertebrate globin repertoire.

Characterisation and evolution of globin-like genes in phylum Cnidaria v

Table of Contents

Keywords ................................................................................................................................. ii

Abstract ................................................................................................................................... iii

Table of Contents .................................................................................................................... vi

List of Figures ........................................................................................................................ vii

List of Tables ............................................................................................................................ x

List of Abbreviations ............................................................................................................... xi

Statement of Original Authorship .......................................................................................... xii

Acknowledgements ............................................................................................................... xiii

Chapter 1: Introduction ...................................................................................... 1

1.1 Overview ........................................................................................................................ 1

1.2 Context ........................................................................................................................... 2

1.3 Research Aims and Objectives....................................................................................... 3

1.4 Literature Review ........................................................................................................... 4

Chapter 2: Methods and Results ...................................................................... 23

2.1 Materials and Methods ................................................................................................. 23

2.2 Results .......................................................................................................................... 28

Chapter 3: General Discussion ......................................................................... 37

3.1 Key Findings ................................................................................................................ 38

3.2 Evolution of globin genes in phylum Cnidaria ............................................................ 39

3.3 Convergent amplification of globin genes in Eumetazoa ............................................ 42

3.4 Structure and function of globin proteins in phylum Cnidaria ..................................... 43

3.5 Effect of environment on globin gene expression in phylum Cnidaria ........................ 45

3.6 Research gaps and future directions ............................................................................. 46

3.7 Conclusion ................................................................................................................... 48

Bibliography ............................................................................................................. 49

Appendices ................................................................................................................ 63

Appendix A Supplementary Tables and Figures .................................................................... 63

vi Characterisation and evolution of globin-like genes in phylum Cnidaria

List of Figures

Figure 1.1: Actiniarian (sea anemone) species of interest; (A) A. tenebrosa and (B) E. pallida. ................................................................................................ 3

Figure 1.2: Hypothesised evolution of animal globins (modified from Burmester & Hankeln, 2014). Abbreviations: Androglobin, Adgb; Neuroglobin, Ngb, Globin-X, GbX; Cytoglobin, Cygb; Myoglobin, Mb; Globin-E, GbE; Globin-Y, GbY; Hemoglobin, Hb. .............................. 5

Figure 1.3: General cnidarian morphology; (A) overview and (B) single celled dermal layers (Technau & Steele, 2011). ....................................................... 7

Figure 1.4: Unrooted molecular phylogeny based on multiple alignments of a subset of 84 sequences that comprise 138 amino acids of Ngb, Ngb-like, hemoglobin, myoglobin, and cytoglobin sequences from diverse phyla (modified from Lechauve et al, 2013). .............................................. 10

Figure 1.5: Expression of myoglobin mRNA in selected Protopterus annectens tissue samples, as estimated by qRT-PCR (modified from Koch et al., 2016). Legend: gene copy reference. ........................................................... 12

Figure 1.6: Predictive structures of unliganded wild-type and mutant Ngb; focused on the heme pocket (modified from Azarov et al., 2016). ............. 14

Figure 2.1: Maximum Likelihood bootstrap phylogenetic tree of identified candidate cnidarian globin genes in genomes of cnidarian species, with supported Bayesian posterior probabilities. Model species representations of phyla Cnidaria, Ctenophora, Placozoa and Porifera (highlighted in purple, green, brown, and yellow, respectively) with vertebrate globin genes highlighted with red branches, and the S. minutum outgroup highlighted in grey. Phylogenetic values shown as maximum likelihood bootstrap support (0-100)/Bayesian posterior probabilities (0-1.0). Bootstrap values < 50 and posterior probabilities < 0.5 shown with a ~ symbol and nodes not identical between each method shown with a - symbol. ................................................................... 31

Figure 2.2: Maximum Likelihood bootstrap phylogenetic tree of identified candidate cnidarian globin genes in transcriptomes of cnidarian species, with supported Bayesian posterior probabilities. Cnidarian pentacoordinate and hexacoordinate branches highlighted in green and blue, respectively, with vertebrate branches highlighted in red and the S. minutum outgroup branch highlighted in black. Pentacoordinate cnidarian genes represented in ortholog reference nvec7000121 are associated with protein model highlighted in green. Hexacoordinate cnidarian genes are associated with protein model highlighted in blue. Phylogenetic values shown as maximum likelihood bootstrap support (0-100)/Bayesian posterior probabilities (0-1.0). Bootstrap values < 50 and posterior probabilities < 0.5 shown with a ~ symbol and nodes not identical between each method shown with a - symbol. Collapsed clades represent sequences with the corresponding ortholog reference

Characterisation and evolution of globin-like genes in phylum Cnidaria vii

gene nomenclature as referenced in Appendix A: Supplementary Table 2.3 (expanded clades shown in Appendix A: Supplementary Figure 2.2). ................................................................................................... 32

Figure 2.3: Predictive cnidarian globin protein structure with heme pocket residues shown. (A) Structural variation of A. tenebrosa ortholog references A.tenebrosa_nvec7000121 (highlighted green) and A.tenebrosa_nvec42000019 (highlighted blue) with side chain residue structures for F (CD1 position; phenylalanine), Q/H (E7 position; distal glutamine/histidine) and H (F8 position; proximal histidine) shown. (B) Structural variation of A. tenebrosa ortholog reference A.tenebrosa_nvec7000121 (highlighted green) and E. pallida ortholog reference E.pallida_nvec7000121 (highlighted gold) showing forward and reverse position of E7 residue Q, respectively, and with side chain residues surrounding E7 position shown. .................................................... 34

Figure 2.4: Heatmap for tissue specific RNA-seq differential gene expression (DGE) analysis with three biological replicates for each tissue type. (A) Analysis of A. tenebrosa tissue types: acrorhagi, tentacle and mesentery filament. (B) Analysis of N. vectensis tissue types: nematosome, tentacle and mesentery filament. ........................................... 35

Figure 2.5: Heatmap for development specific RNA-seq differential gene expression (DGE) analysis with two biological replicates for each tissue type. (A) Analysis of E. pallida developmental stages: immature (larvae) and mature (adult), with three biological replicates for adult stage only. (B) Analysis of N. vectensis developmental stages: immature (planula) and mature (adult). ........................................... 36

Supplementary Figure 2.1: Cladogram overview of phylogenetic relationships for early-diverging species, phylum Cnidaria derived from mitochondrial (Rodríguez et al., 2014) and genomic (Zapata et al., 2015) genes. Red, light green and pink highlighting represents the three most studied Superfamilies of Actiniaria; Actinioidea, Metridioidea and Edwardsioidea, respectively. Candidate cnidarian globin gene copy number in brackets after species name. Abbreviations: O, Order; C, Class. .............................................................. 75

Supplementary Figure 2.2: Maximum Likelihood phylogenetic tree of identified candidate cnidarian globin genes in transcriptomes of cnidarian species, with supported Bayesian posterior probabilities. Model and non-model representations of vertebrate globin genes, cnidarian classes Anthozoa, Cubozoa, Hydrozoa and Scyphozoa, with S. minutum as the outgroup. Phylogenetic values shown as maximum likelihood bootstrap support (0-100)/Bayesian posterior probabilities (0-1.0). .......................................................................................................... 76

Supplementary Figure 3.1: Maximum Likelihood bootstrap phylogenetic tree of identified candidate cnidarian globin genes in transcriptomes of cnidarian species, with supported Bayesian posterior probabilities. Blue dots represent gene duplication events within Actiniaria taxa. Red brackets represent individual gene duplication events within specific species. Phylogenetic values shown as maximum likelihood bootstrap support (0-100)/Bayesian posterior probabilities (0-1.0).

viii Characterisation and evolution of globin-like genes in phylum Cnidaria

Bootstrap values < 50 and posterior probabilities < 0.5 shown with a ~ symbol and nodes not identical between each method shown with a - symbol. Collapsed clades represent sequences with the corresponding ortholog reference gene nomenclature as referenced in Appendix A: Supplementary Table 2.3 (expanded clades shown in Appendix A: Supplementary Figure 2.2)........................................................................... 77

Characterisation and evolution of globin-like genes in phylum Cnidaria ix

List of Tables

Supplementary Table 2.1: Output from OrthoMCL for candidate cnidarian globin genes, with individual gene nomenclature used for all downstream analyses. ................................................................................... 63

Supplementary Table 2.2: Primer sequences and estimated gene sequence length for candidate cnidarian globin genes in A. tenebrosa and E. pallida. Candidate gene nomenclature referenced from OrthoMCL results detailed in Supplementary Table 2.4. ............................................... 66

Supplementary Table 2.3: Trinity De novo assembled transcriptome statistics for quality check analysis. Abbreviations: n/a, Not Applicable. ................. 67

Supplementary Table 2.4. Results of data interrogation for genome and transcriptome datasets. Details represent additional information for individual candidate cnidarian globin genes. Candidate gene nomenclature referenced from OrthoMCL results detailed in Supplementary Table 2.4. ............................................................................ 68

Supplementary Table 2.5: Synonymous and nonsynonymous mutations identified in validated transcriptome contigs for E. pallida species. Abbreviations: Syn, Synonymous; Non-syn, Non-synonymous; n/a, Not Applicable. ............................................................................................ 72

Supplementary Table 2.6: Intron-exon structure analysis of nine E. pallida globin genes. Gene, exon and intron lengths are given as nucleotide counts. N/A used to identify introns with large blocks of ambiguous nucleotides, thus true length of intron could not be determined. Abbreviations: forward, F; reverse, R. ......................................................... 73

x Characterisation and evolution of globin-like genes in phylum Cnidaria

List of Abbreviations

Androglobin (Adgb) Carbon monoxide (CO) Cytoglobin (Cygb) Globin-E (GbE) Globin-X (GbX) Globin-Y (GbY) Hemoglobin (Hb) Hemoglobin-α (HbA) Hemoglobin-β (HbB) Hydrogen Sulphide (H2S) Myoglobin (Mb) Neuroglobin (Ngb) Nitric Oxide (NO) Real-time Reverse Transcriptase Polymerase Chain Reaction (qRT-PCR) RNA sequencing (RNA-seq)

Characterisation and evolution of globin-like genes in phylum Cnidaria xi

Statement of Original Authorship

The work contained in this thesis has not been previously submitted to meet

requirements for an award at this or any other higher education institution. To the

best of my knowledge and belief, the thesis contains no material previously

published or written by another person except where due reference is made.

Signature:

Date: _________________________

xii Characterisation and evolution of globin-like genes in phylum Cnidaria

20 / 02 / 2018

QUT Verified Signature

Acknowledgements

I wish to express my sincere thanks to my supervisor Dr Peter Prentis and my

co-supervisors Dr Ana Pavasovic and Dr Matthew Phillips for their guidance,

suggestions and assistance. I wish to make a special mention to Joachim Surm for his

assistance with bioinformatic troubleshooting throughout my project.

This work was supported by the Evolutionary Physiological Genomics

Laboratory Group and the Central Analytical Research Facility, Queensland

University of Technology. Computational and data visualisation resources and

services used in this work were provided by the HPC and Research Support Group,

Queensland University of Technology.

Characterisation and evolution of globin-like genes in phylum Cnidaria xiii

Chapter 1: Introduction

1.1 OVERVIEW

Vertebrate (superphylum Bilateria, phylum Chordata) globins are among the

best-studied gene families and proteins in biology, however, there is still a general

lack of knowledge about the structure, expression and evolutionary history of globin

genes across other eumetazoan phyla. In particular, there is very little knowledge

about the globin gene superfamily in species of the early-diverging phylum,

Cnidaria. Cnidarians are the sister group to superphylum Bilateria and they represent

an ideal group to resolve the lack of knowledge surrounding the globin gene

superfamily in early-diverging taxa. The structure of globin proteins have been

characterised with an eight α-helix conformation, however the individual amino acid

changes that occur throughout these helices can alter the efficiency of different

ligands that bind to the heme group associated with globin proteins. Consequently,

the function of each globin subfamily changes based on structural variations found

within each specific subfamily. Each globin subfamily also typically has tissue and

developmental specific expression that is associated with changes in structure and

function of these proteins. The extensive study of the vertebrate globin gene

superfamily has resulted in a greater understanding of the evolutionary history for

each globin subfamily. However, this does not address the knowledge gap associated

with globin diversity in early-diverging taxa, such as phylum Cnidaria, as well as

those which were present in the last common eumetazoan ancestor. By elucidating

the structure, expression and evolution of globin genes in phylum Cnidaria, this

Chapter 1: Introduction 1

knowledge gap was addressed and a greater understanding of the globin gene

superfamily in eumetazoan taxa was elucidated.

1.2 CONTEXT

This project utilised genomic data from cnidarian species in order to evaluate

the expression and evolution of cnidarian globin genes, and to determine the protein

structure of globin genes in two actiniarian species, Actinia tenebrosa (Figure 1.1A)

and Exaiptasia pallida (Figure 1.1B). These two species are ideal for the study of

globin gene evolution due to their high abundance in two distinct environments of

the Australian east coast, the intertidal and shallow marine zones, respectively. Thus,

they are relatively easier to collect for experimentation compared to other cnidarian

taxa. This project has provided insight into the evolutionary history and function of

globin genes in early-diverging taxa of phylum Cnidaria. Globin genes were

identified in a wide distribution of cnidarians and included the four classes of phylum

Cnidaria (Anthozoa, Cubozoa, Hydrozoa and Scyphozoa; Supplementary Figure

2.1), and a broad expansion of globin genes in order Actiniaria was elucidated.

Additionally, variations in protein structure, and tissue and development expression

were observed in actiniarian species. Consequently, this research has provided a

foundation of knowledge for understanding the evolution and function of the globin

gene superfamily in early-diverging taxa.

2 Chapter 1: Introduction

Figure 1.1: Actiniarian (sea anemone) species of interest; (A) A. tenebrosa and (B) E. pallida.

1.3 RESEARCH AIMS AND OBJECTIVES

This project investigated the evolution, structure and expression of globin

genes in several species of cnidarians, with a specific focus on sea anemones (order

Actiniaria). Using molecular and bioinformatics approaches, this research has

increased our understanding of the globin gene superfamily in this early-diverging

eumetazoan phylum. Published datasets for multiple classes of cnidarians, as well as

published globin genes in the early-diverging phyla Ctenophora, Placozoa and

Porifera were obtained. Subsequently, these datasets were used to elucidate a better

understanding of the globin gene superfamily in phylum Cnidaria and Eumetazoa in

general, as well as to identify the variation in structure and expression profiles of

globin genes in select species.

Overall the project had two main objectives:

Objective 1: To understand the evolutionary history of the cnidarian globin

gene superfamily through phylogenetic and comparative genomic approaches. This

entailed a detailed examination of the diversification and distribution of cnidarian

globin genes, and a comparison of these genes to previously characterised vertebrate


globin genes using Maximum Likelihood and Bayesian Inference phylogenetic

methods.

Objective 2: To understand the structure and expression of cnidarian globin

genes through protein modelling and quantitative transcriptomic analyses. Validated

globin genes from A. tenebrosa and E. pallida were used to determine protein model

predictions for all globin proteins found in both species based on reviewed globin

protein structures. Previously published RNA-seq data was used to determine tissue

specific expression patterns in A. tenebrosa and Nematostella vectensis, as well as,

development specific expression patterns in E. pallida and N. vectensis.

1.4 LITERATURE REVIEW

1.4.1 BACKGROUND

The globin gene superfamily encodes proteins that are found in all kingdoms of

life with a ubiquitous distribution across metazoan species (Freitas et al., 2004;

Hardison, 1996; Hoogewijs et al., 2008; Lechauve et al., 2013). Globins are small

respiratory proteins that bind gaseous molecules to a heme group that contains an

iron-ion and porphyrin ring within the heme pocket of the protein’s structure

(Dickerson & Geis, 1983). Globin proteins are known to bind gaseous compounds

such as oxygen, carbon monoxide (CO) and nitric oxide (NO) (Dewilde et al., 2001;

Fago et al., 2006; Jayaraman et al., 2011). The binding potential of these compounds

is dependent on both the structure of the globin protein and the presence of a heme

group. The variation in structure and binding potential within vertebrate globin

proteins has resulted in the classification of 11 globin subfamilies; hemoglobin-α

(HbA), hemoglobin-β (HbB), myoglobin (Mb), cytoglobin (Cygb), neuroglobin


(Ngb), globin-X (GbX), globin-E (GbE), globin-Y (GbY), Agnathan globins,

Protostome globins and androglobin (Adgb) (Burmester et al., 2004) (Figure 1.2).

The globin genes present within and among vertebrate species have arisen from

repeated rounds of single gene and whole genome duplication events (Hoffman et al.,

2010; Hoffman et al., 2012; Jeffreys et al., 1980; Shen et al., 1981; Storz et al.,

2013), with the expansion and subsequent neofunctionalisation of these globin genes

seen throughout superphylum Deuterostomia (Hoffman et al., 2012; Burmester &

Hankeln, 2014). This superphylum has a broad distribution and diversity of globin

genes, however, Burmester & Hankeln (2014) have suggested the earliest diverging

globin subfamily in vertebrates is either Ngb, GbX or androglobin. By studying

early-diverging taxa, the identity of the ancestral globin gene can be elucidated and

this will present significant insights into the evolution of protein structure, binding

and function of this gene superfamily outside of vertebrate taxa.

Figure 1.2: Hypothesised evolution of animal globins (modified from Burmester & Hankeln, 2014).

Abbreviations: Androglobin, Adgb; Neuroglobin, Ngb, Globin-X, GbX; Cytoglobin, Cygb;

Myoglobin, Mb; Globin-E, GbE; Globin-Y, GbY; Hemoglobin, Hb.


The distribution of globin and globin-like genes in the established model

species of Bilateria (in particular vertebrates) is well-known, however, this is not the

case for early-diverging eumetazoan phyla, such as cnidarians. Bilaterians have a

diverse repertoire of globin genes that frequently show tissue and development

specific expression patterns (Burmester et al., 2004; Ebner et al., 2010; Hoogewijs et

al., 2011; Koch et al., 2016; Roesner et al., 2005). A defining feature of cnidarians is

the lack of complex organs and organ systems seen in bilaterians (Figure 1.3)

(Brusca & Brusca, 2003; Technau & Steele, 2012). They do, however, possess a

relatively simple nervous system (nerve net) and only have two dermal layers

(ectoderm and endoderm). Consequently, cnidarian species predominantly rely on

diffusion to supply oxygen to their working cells (Brusca & Brusca, 2003; Technau

& Steele, 2012) and are unlikely to possess circulating globin proteins. The lack of

morphological complexity and reliance on diffusion seen in cnidarians presents an

interesting experimental analogue to examine the diversity, distribution, expression,

and structure of globin genes and proteins in simple early-diverging eumetazoan

taxa. Currently, only Ngb-like genes have been identified in cnidarian species, which

have been characterised only in a single species, the hydrozoan Clytia hemisphaerica

(Lechauve et al., 2013). The two Ngb-like genes in C. hemisphaerica were found to

have tissue specific expression patterns and both were expressed predominantly in

tentacle bulbs and manubrium of this species. Specifically, these genes were found

associated with collagen-like proteins found in the wall of nematocysts (the venom

delivery organelle of cnidarians associated with nematoblast cells in the neural net;

Technau & Steele, 2011) (Lechauve et al., 2013). The identification of tissue specific

globin genes in phylum Cnidaria indicates a similar differentiation of globins as seen

in vertebrates. It is therefore highly likely that the diversity of globin genes in


cnidarians is linked to their morphology and physiology. Consequently, we can better

understand the role that these genes and proteins have within cnidarians, and

subsequently the distinctions of Ngb among eumetazoans.

Figure 1.3: General cnidarian morphology; (A) overview and (B) single celled dermal layers (Technau

& Steele, 2011).

Neuroglobins are an early branching and ancient member of the globin gene

superfamily in Eumetazoa (Burmester et al., 2000; Hoogewijs et al., 2008) and are

currently thought to have multiple functions in vertebrate neural cells (Burmester et

al., 2000; Burmester et al., 2009; Watanabe et al., 2012). Within vertebrates, the

function of Ngbs has yet to be fully characterised, but studies have shown that they

have roles in oxygen supply, storage, and interactions with mitochondria for cellular

respiration and signalling (Burmester et al., 2000; Burmester et al., 2009; Burmester


et al., 2004; Ruetz et al., 2017; Singh et al., 2013; Watanabe et al., 2012; Hoffman et

al., 2010; Teixerira et al., 2013). Some Ngb-like genes have been identified outside

of vertebrate taxa, such as in phyla Nematoda and Cnidaria. Thirty-three globin

genes have been identified in the nematode Caenorhabditis elegens, and many of

these genes have a broad distribution among other nematode species (Hoogewijs et

al., 2008). The high copy number of nematode globin genes is indicative of repeated

rounds of gene duplication increasing gene number in this phylum. In C. elegens

there is also evidence that many of the Ngb-like genes have undertaken new roles, as

32 of the 33 genes show patterns of tissue specific expression profiles throughout its

body plan (Hoogewijs et al., 2008). This research, along with the study of C.

hemisphaerica, has begun to address the knowledge gap for the evolution and

expression of globin genes in eumetazoan phyla outside of phylum Chordata, but

many more studies in other phyla are needed.

1.4.2 EVOLUTION OF THE GLOBIN GENE SUPERFAMILY

While the globin gene superfamily has been extensively studied, its

evolutionary history is still poorly understood in early-diverging eumetazoan taxa.

The globin gene family is found throughout all kingdoms of life (Freitas et al., 2004;

Hardison, 1996; Hoogewijs et al., 2008; Lechauve et al., 2013), and has a prokaryote

origin (Freitas et al., 2013). This gene family is widespread but has been extensively

studied mainly in vertebrate species. To understand the evolution of the globin gene

superfamily beyond the scope of vertebrates, the study of other taxa is required.

Phylogenetic analyses have partially elucidated the ancestral history of

vertebrate globin genes with the identification of three early divergent genes;


androglobin, neuroglobin and globin-X (Burmester et al., 2000; Burmester &

Hankeln, 2014; Hoogewijs et al., 2011; Roesner et al., 2005). The identification of

Ngb-like genes in early-diverging eumetazoans suggests that a globin-like gene was

most likely the ancestral globin gene present in the last common ancestor of phylum

Cnidaria and superphylum Bilateria (Hoogewijs et al., 2008; Lechauve et al., 2013).

In fact, phylogenetic analyses revealed that globin genes are present in most early-

diverging phyla, and form a clade with vertebrate Ngb and GbX genes (Figure 1.4)

(Lechauve et al., 2013). This conclusion is based on very limited sampling within

phylum Cnidaria and more research is needed to support or refute this idea. Overall

this lack of knowledge exposes the need for further research into the diversity and

evolution of globin genes in Eumetazoa.


Figure 1.4: Unrooted molecular phylogeny based on multiple alignments of a subset of 84 sequences

that comprise 138 amino acids of Ngb, Ngb-like, hemoglobin, myoglobin, and cytoglobin sequences

from diverse phyla (modified from Lechauve et al, 2013).

Gene duplication is one of the most important molecular mechanisms for the

generation of copy number variation and gene diversity within metazoan gene

families. Three processes give rise to gene duplication events; unequal crossing over,

chromosomal or genome duplication events and retroposition of mRNA transcripts

(Ohno, 1969; Zhang, 2003). The presence of two Ngb-like genes in C.

hemisphaerica (Lechauve et al., 2013) shows that there has been at least one gene

duplication event in phylum Cnidaria. The best evidence for the role of gene

duplication in the evolution of globin gene diversity, however, comes from the seven

globin subfamilies found exclusively in vertebrates. These seven globin subfamilies


are thought to have evolved from an ancestral globin gene present in the last

common ancestor of vertebrates (Burmester & Hankeln, 2014). In fact, phylogenetic

and comparative genomic analysis has revealed that the seven different globin

subfamilies unique to vertebrates are the result of at least two rounds of whole

genome duplication and a number of single gene duplication events (Hoffman et al.,

2012; Ohno, 1969). Consequently, gene and genome duplication events followed by

mutation have expanded the diversity of proteins encoded by globin genes in

vertebrates. The expansion of diversity has also resulted in an expansion of function,

with mutation and fixation resulting in subfunctionalisation and/or

neofunctionalisation of the different globin subfamilies into the vertebrate globin

repertoire.

Subfunctionalisation and neofunctionalisation can occur following gene

duplication events where one duplicate copy accumulates new mutations and gains a

new or related function (Ohno, 1969; Zhang, 2003). Fixation of these processes have

resulted in the current diversity of globin genes in vertebrates. Each subfamily has

undergone gene duplication followed by subfunctionalisation or neofunctionalisation

from the ancestral globin gene (Hoffman et al., 2012; Zhang, 2003). One example of

these processes is the recent characterisation of an expansion and subsequent

subfunctionalisation and/or neofunctionalisation for myoglobin genes in lungfish

(Koch et al., 2016). These genes show similar tissue specificity as myoglobin and

Ngb with gene expression predominantly in muscle, eye and brain tissues (Figure

1.5). They have also been suggested to replace the function of cytoglobin and Ngb,

as these two genes were not present. The four main globin subfamilies (hemoglobin,

myoglobin, cytoglobin and neuroglobin) are found throughout most vertebrates and

are a representation of the diversity of the globin superfamily that has revealed tissue


and development specific expression, as well as different functional roles (Brunori et

al., 2005; Burmester et al., 2002; Burmester et al., 2014; Fuch et al., 2005; Koch et

al., 2016; Stamatoyannopoulos, 2005). Improving our understanding of globin genes

in different eumetazoan phyla may reveal that early-diverging species, other than

nematodes, have undergone similar evolutionary mechanisms as seen in vertebrates.

Figure 1.5: Expression of myoglobin mRNA in selected Protopterus annectens tissue samples, as

estimated by qRT-PCR (modified from Koch et al., 2016). Legend: gene copy reference.

Overall, metazoan globin proteins all share a largely similar function for

binding gaseous compounds (Burmester & Hankeln, 2014; Pesce et al., 2003).

Despite this, in some instances significant differences can be seen at the molecular

level that can alter their functional properties (Dewilde et al., 2005; Fuchs et al.,

2005; Koch et al., 2016), as well as having different tissue and development

expression patterns (Burmester et al., 2004). For example, in vertebrates, hemoglobin

forms a tetramer for the supply and transport of oxygen around a circulating system,

whereas, Ngb forms a monomer and has multiple functions within neural cells

including oxygen supply (Burmester et al., 2000; Burmester et al., 2004; Burmester

& Hankeln, 2014; Pesce et al., 2003). Furthermore, there is a foetal and adult


developmental form of hemoglobin (Stamatoyannopoulos, 2005) but only a single

known form of Ngb and GbX. While only tissue specific expression has been

observed in C. hemisphaerica, it is unknown whether duplicated globin genes in

phylum Cnidaria display structural and functional differences at the protein level.

The knowledge gaps surrounding globin protein structure and function reveals the

importance of identifying globin genes in early-diverging Eumetazoan phyla, such as

Cnidaria.

1.4.3 GLOBIN STRUCTURAL VARIATION AND LIGAND BINDING

POTENTIAL

The structure and conformation of globin proteins influences their binding

potential for gaseous compounds, which can give insights into their function and

evolution (Bocahut et al., 2013; Borhani et al., 2015; Fago et al., 2006; Jayaraman et

al., 2011; Kriegl et al., 2002; Ramos-Alvarez et al., 2013). Recent studies have

expanded the knowledge of Ngb protein structure and function in phylum Chordata

(Dewilde et al., 2001; Jayaraman et al., 2011; Kiger et al., 2011), which can be used

to elucidate the functional characterisation of potential globin proteins in cnidarians.

This literature focuses on the conformational changes of the heme binding site

(Burmester et al., 2004; Pesce et al., 2003; Ota et al., 1997) and ligand binding

potential (Dewilde et al., 2001; Fago et al., 2006; Hoffman et al., 2010). There are

two conformations within globin proteins, pentacoordination and hexacoordination

(Bocahut et al., 2013; Dewilde et al., 2001; Fago et al., 2006; Jayaraman et al.,

2011). The vertebrate repertoire predominantly consists of pentacoordinate globin

proteins, with hexacoordination represented only in Ngb, GbX, androglobin and

cytoglobin (Figure 1.2) (Burmester & Hankeln, 2014). Both hexacoordinated and


pentacoordinated globin proteins have different binding potentials for gaseous

molecules such as oxygen, CO (Azarov et al., 2016; Dewilde et al., 2001; Fago et al.,

2006) and NO (Jayaraman et al., 2011; Tejero et al., 2015). The variation between

hexacoordinate and pentacoordinate conformations is the result of a single amino

acid replacement at the E7 helical position (Figure 1.6). This residue determines the

efficiency of gaseous compounds that can be bound and unbound to the heme group

(Azarov et al., 2016; Dewilde et al., 2001; Fago et al., 2006; Jayaraman et al., 2011;

Tejero et al., 2015). This is especially important as the pentacoordinate conformation

has been shown to reduce the impact of hypoxia due to nitric oxide (Jayaraman et al.,

2011) and carbon monoxide toxicity (Azarov et al., 2016; Dewilde et al., 2001; Fago

et al., 2006). Vertebrate Ngbs have hexacoordinate conformation, but have structural

modifications that alter the E7 position heme binding site to conform to the

pentacoordinate structure (Bocahut et al., 2013; Jayaraman et al., 2011), thus

allowing for greater autoxidation efficiency for heme binding and unbinding (Tejero

et al., 2015). Currently, there are no studies that have closely investigated the

structure and function of cnidarian globin proteins. Modelling the structure of

cnidarian globin proteins will help to address this knowledge gap.

Figure 1.6: Predictive structures of unliganded wild-type and mutant Ngb; focused on the heme pocket

(modified from Azarov et al., 2016).


The binding potential of Ngb in vertebrates varies based on environmental

conditions, but is limited mainly by the pentacoordinate conformation from its initial

hexacoordinate state (Fago et al., 2006; Jayaraman et al., 2011; Kriegl et al., 2002).

Studies have shown that the kinetics of oxygen, NO, CO and hydrogen sulphide

(H2S) ligand binding can be altered by pH, temperature, and globin and ligand

concentrations (Bocahut et al., 2013; Borhani et al., 2015; Fago et al., 2006;

Nienhaus et al., 2004; Ramos-Alvarez et al., 2013). By removing these

environmental variables, the binding potential of gaseous compounds is dependent

on globin protein structure around the heme pocket (Bashford et al., 1987; Brunori et

al., 2005; Dewilde et al., 2001; Giuffre et al., 2008). Studies with hexacoordinate

Ngb show that there is a faster binding mechanism involved in pentacoordinate

dissociation with specific distal and alternate side-chain residues limiting the release

of the ligands (Bocahut et al., 2013; Brunori et al., 2005; Giuffre et al., 2008; Kriegl

et al., 2002). Identifying the similarities between these studies and the key residues in

cnidarian globin proteins will help to uncover their potential binding properties.

Vertebrate globins typically have a greater binding affinity and stability to oxygen

for transport and storage than other gaseous molecules. Neuroglobin, however, has

been observed to have less affinity to oxygen and greater affinity for nitric oxide and

carbon monoxide (Brunori et al., 2005; Kiger et al., 2011; Kriegl et al., 2002),

suggesting a cellular detoxification function to be more likely than transport and

storage. Functionality in the proteins encoded by cnidarian globin genes is still to be

established but they would likely have similar gaseous affinities and biological

functions as vertebrate globins given the basic cellular characteristics observed in all

metazoan systems. Elucidating functionality and affinity of cnidarian globins for

various gases will enable further study into the mechanisms involved and how novel


functions have arisen throughout the evolutionary history of globin genes in

Eumetazoa.

1.4.4 DETOXIFICATION OF DELETERIOUS MOLECULES

Globin proteins have various physiological roles other than oxygen storage and

transport, such as, the removal of toxic and deleterious molecules. These molecules

can accrue from normal biological processes or external sources due to absorption

into an organism. The removal or detoxification of deleterious molecules is

necessary in order to maintain cell homeostasis in aerobic organisms. There are three

molecules that can have toxic effects and have been studied in relation to the

different globin subfamilies; CO, NO and H2S. Hemoglobin and myoglobin have

been shown to reduce NO and H2S toxicity (Bostelaar et al., 2016; Flögel et al.,

2001; Vitvitsky et al., 2015), and cytoglobin has been shown to reduce NO toxicity

(Hundahl et al., 2013). Neuroglobin, however, can reduce the toxicity of all three of

these molecules (Azarov et al., 2016, Ruetz et al., 2017, Singh et al., 2013),

subsequently suggesting a detoxification role rather than oxygen storage and

transport. While there is still very limited research into the detoxification function of

these four globin proteins, the current literature suggests that each globin protein is

similar and that it is protein efficacy as well as tissue specificity that distinguishes

them from each other. Therefore, identifying and characterising Ngb and Ngb-like

genes in early-diverging species will give us insights into the function of this globin

subfamily outside of vertebrates.

The discovery and subsequent functionality of Ngb is still ongoing, with

several key attributes and roles being identified in vertebrates; most recently, the role


of detoxification (Azarov et al., 2016; Brunori et al., 2005; Ruetz et al., 2017; Singh

et al., 2013). The globin superfamily is highly complex and further studies are

needed to improve our knowledge of the detoxification role and why it is necessary

in eumetazoans. Recent literature has identified the capability of Ngb to neutralise

CO (Azarov et al., 2016), NO (Brunori et al., 2005; Singh et al., 2013) and H2S

(Ruetz et al., 2017) that are in excess within an organism. Azarov et al. (2016) found

that by selectively mutating the distal histidine residue in Ngb, the affinity and

binding potential of Ngb to CO increased. This was primarily achieved due to the

structural conformation change from a hexacoordinate state to a pentacoordinate

state. Detoxification is important in maintaining homeostasis in neural cells and

mitochondria of vertebrates, and therefore is likely to be necessary in other

eumetazoan groups. Detoxification is especially important for cnidarians, as

diffusion is their only known physiological process that transports gaseous molecules

in and out of their cells and tissues (Brusca & Brusca, 2003; Technau & Steele,

2012). If diffusion is impaired or inefficient at removing excess molecules then it is

logical that a globin protein would supplement this role. Consequently,

characterising the protein structures of globin genes in cnidarians, will provide a

better understanding for the role of globin proteins in less complex morphologies, as

well as elucidating the similarities and differences between cnidarian and vertebrate

globin proteins.

1.4.5 ENVIRONMENTAL STRESS IN AQUATIC SPECIES

Aquatic species have been examined for the expression of globin genes under

oxygen stress conditions for a few model vertebrate species, however, information on

the expression of globin genes is lacking in non-model and non-vertebrate species.


Vertebrate studies show that gene expression and protein abundance vary in response

to hypoxia (Roesner et al., 2006; Roesner et al., 2008). For example, zebrafish Ngb

gene transcription and protein abundance increased up to five-fold under hypoxic

conditions (Roesner et al., 2006). Under similar conditions goldfish Ngb protein

abundance, however, had a five-fold increase compared to zebrafish, even though

goldfish Ngb transcription remained unchanged (Roesner et al., 2008). This

difference in protein abundance is suggested to be the result of adaptations to their

respective environmental conditions (Roesner et al., 2008). This is important when

comparing cnidarian species from different habitats. Intertidal cnidarians would

repeatedly be under hypoxic stress from emersion and consequently should have a

similar response mechanism as seen in goldfish (Roesner et al., 2008). Subsequently,

cnidarians that are always submerged would likely have a different response, as seen

in zebrafish (Roesner et al., 2006), as it is less likely that they would be under

hypoxic stress. Understanding the adaptations between different cnidarian species

would elicit a greater understanding as to the origins of hypoxic endurance and how

globin genes have expanded their functionality beyond a simple oxygen carrying and

storage protein. Furthermore, understanding the relationship between the expansion

of globin genes in a broad diversity of non-model taxa and different environments

would expand our knowledge of gene duplication.

Heat stress from natural environmental conditions is an important factor in

gene expression, particularly for chemical toxicity in cnidarians. However, there has

been very limited research for compounds such as nitric oxide. Nitric oxide is an

important compound across metazoan taxa for cellular processes (particularly cell

signalling) but can have toxic effects when overproduced, such as symbiont

expulsion in corals and sea anemones (Bouchard et al., 2008, Perez et al., 2006,


Trapido-Rosenthal et al., 2005). Expression of globin genes in cnidarians could

mitigate high concentrations of NO, and potentially CO and H2S, particularly for

species that are consistently under heat stress, such as A. tenebrosa in the intertidal

zone. Interestingly, Perez et al. (2006) studied the effect of heat stress and NO

concentration on symbionts, but did not report on the survivability/mortality of E.

pallida. Subsequently, it is still unknown whether globin genes have a detoxification

role in cnidarians, however, observations of Ngb activity in reducing NO toxicity in

vertebrates (Singh et al., 2013) suggests that cnidarian globin proteins are likely to

have a similar functional role.

1.4.6 SUMMARY AND IMPLICATIONS

The evolution of the globin gene superfamily is well-established in vertebrates,

and by analysing taxa from an early-diverging lineage (phylum Cnidaria), a better

understanding of globin gene evolution across Eumetazoa can be gained. Current

evidence has shown that globin genes are ubiquitous across all kingdoms of life,

revealing that they are likely essential to the survival of aerobic organisms. The

diversity and distribution of globin genes found within specific taxonomic groups is

dependent on the globin subfamily and gene copy number. By identifying and

evaluating each globin subfamily and their corresponding copy number in cnidarians,

this research will be able to gain insights into the evolutionary history of the globin

gene superfamily in early-diverging taxa from Eumetazoa. Individual globin

subfamilies, such as myoglobin or Ngb, found in specific vertebrate species have

undergone expansions of these specific genes. These expansions are the result of

repeated rounds of gene duplication events, with an increase in functional diversity

from the result of subfunctionalisation and/or neofunctionalisation after duplication.


In phylum Cnidaria, only two globin genes have been identified i.e., Ngb-like genes

in C. hemisphaerica. A more thorough bioinformatics approach across multiple

cnidarian classes will elucidate a more complete repertoire of globin genes found

within this phylum. Furthermore, the evolution of globin genes in cnidarians would

likely be similar to vertebrates due to the same mechanisms involved; gene

duplication, subfunctionalisation and neofunctionalisation. These mechanisms have

resulted in variations in gene sequences, protein structures and functional roles in

vertebrates, and consequently these variations would be seen in cnidarians.

The function of previously characterised metazoan globin proteins is primarily

for oxygen storage and transport, but recent literature has revealed a range of other

physiological roles are undertaken by different globin subfamilies. This variation in

function is largely associated with alterations in protein structure and expression

patterns. There are two structural conformations observed in globin proteins;

pentacoordination and hexacoordination. These structural variations have an

important role in multicellular systems for their binding and affinity of gaseous

ligands. In particular, the binding and detoxification of toxic molecules, such as nitric

oxide and carbon dioxide, would be an important functional role needed by

cnidarians that inhabit dynamic environments, specifically sea anemones.

Subsequently, the identification of globin protein structure in these organisms will

further our understanding of the evolution of the globin superfamily and the possible

function of the ancestral globin protein. Defining protein structure and function will

also improve our understanding and the significance of gene expression, especially

for the comparison between species of different morphologies and environments.

Tissue and development specific gene expression profiles have been well-

established for vertebrate globin genes. Throughout vertebrates, there are variations


to expression patterns of each globin subfamily, however, there are also instances of

differential expression within the same subfamily. These variations are associated

with expansions of an individual subfamily, such as tissue specific expression of Ngb

in nematodes and myoglobin in lungfish. Consequently, it would be congruent that

the tissue expression variations seen in these species, as well as development

expression variations seen in other vertebrates, would also be observed in the

cnidarian globin gene expansion that has been proposed. Furthermore, vertebrate

globin expression varies based on the environmental pressures they have been

exposed to, thus similar variations would be expected for cnidarian gene expression

profiles between species of different environmental habitats. Analysis of cnidarian

species, specifically sea anemones, from different habitats but similar ancestry will

elucidate a greater understanding of the globin gene repertoire and expression within

early-diverging species. Moreover, the similarities and differences of globin gene

expression profiles between cnidarians and vertebrates, and within cnidarian taxa

will further our understanding of the globin gene superfamily.


Chapter 2: Methods and Results

2.1 MATERIALS AND METHODS

2.1.1 Transcriptome construction and quality checking

Transcriptome datasets generated with Illumina platforms were obtained from

NCBI GenBank; Acropora digitifera (PRJNA309168; Mohamed et al., 2016),

Actinia tenebrosa (SRX1604071), Alatina alata (SRX978662), Anthopleura

buddemeieri (SRX1604661; Van Der Burg et al., 2016), Aulactinia veratra

(SRX1614867; Van Der Burg et al., 2016), Aurelia aurita (PRJNA252562;

Brekhman et al 2015), Calliactis polypus (SRX1614869; Van Der Burg et al., 2016),

Chironex fleckeri (SRX891607), Corallium rubrum (SRX675792; Pratlong et al.,

2015), Hydractinia polyclina (SRX315374), Nemanthus annamensis (SRX1634628;

Van Der Burg et al., 2016), Protopalythoa variabilis (SRX978667). Trinity de novo

assembler software (v2.0.6) was used to assemble high quality reads (> Q30, < 1%

ambiguities) into contiguous sequences (contigs) (Haas et al., 2013). Default settings

were used with the addition of Trimmomatic to remove low quality reads and

adaptors (Haas et al., 2013). Redundant and chimeric sequences present in the

transcriptome were removed using CD-hit (v4.6.1) by clustering sequences with >

95% similarity into a single contig (Fu et al., 2012). The quality and completeness of

the transcriptome assemblies were determined with CEGMA to report the presence

of the 248 core eukaryotic genes (CEG) that were complete (> 70% alignment with

CEG protein) (Parra et al., 2007) and BUSCO to report the presence of the 978

Chapter 2: Methods and Results 23

single-copy orthologs in metazoans that were complete (Simão et al., 2015). A

CEGMA and BUSCO score of > 80% was considered high quality.

2.1.2 Candidate gene identification

Blast searches using vertebrate globin sequences against the genomes of

Nematostella vectensis (Putnam et al., 2007), Acropora digitifera (Shinzato et al.,

2011), Hydra vulgaris (Chapman et al., 2010), Trichoplax adhaerens (Srivastava et

al., 2008), Amphimedon queenslandica (Srivastava et al., 2010) and Mnemiopsis

leidyi (Ryan et al., 2013) were conducted. Potential globin gene sequences were

extracted from genome scaffolds and transcripts.

Transcriptomes were annotated using the SwissProt database (Haas et al.,

2013) within the Trinotate software package (v2.0.6) with an e-value stringency of

1e−6. A custom BLAST database was created using globin genes annotated in the N.

vectensis and H. vulgaris genomes. Transcriptomes were locally blasted against this

custom database to ensure any predicted proteins were contained in the globin gene

candidate list. Candidate sequences were further scrutinised against the genome and

transcriptome assemblies of the dinoflagellate, Symbiodinium minutum, using the

Okinawa Institute of Science and Technology Graduate University’s Marine

Genomics Unit genome browser (http://marinegenomics.oist.jp/symb/viewer/

info?project_id=21). Sequences with an e-value < 1e-6 were considered as potential

dinoflagellate genes and subsequently removed from downstream analyses.

Candidate genes were assigned a custom nomenclature using the OrthoMCL

database (http://orthomcl.org/orthomcl/) (Chen et al., 2006). Candidate genes were

translated into protein sequences and queried against the OrthoMCL database to

assign these genes to orthologous groups. They were assigned a custom

24 Chapter 2: Methods and Results

nomenclature based on species and the best orthologous protein hit (Appendix A:

Supplementary Table 2.1).

2.1.3 Candidate gene validation and interrogation

Candidate sequences from A. tenebrosa and Exaiptasia pallida were validated

using PCR amplification and Sanger sequencing. Primers were designed using the

NCBI primer design tool (Ye et al., 2012) in order to amplify the entire open reading

frame of the candidate globin genes (Appendix A: Supplementary Table 2.2). PCR

amplification of candidate genes was achieved using the MyFi2x Taq Polymerase Kit

(BIOLINE); 12.5 µL MyFi2x polymerase master mix, 9.5 µL ddH2O, 1 µL 10 pmol

Forward primer, 1 µL 10 pmol Reverse primer, 1 µL (20-50ng) cDNA template.

Sanger sequencing was completed using a modified BigDye Terminator v3.1

protocol (Applied Biosystems). Sanger sequences were aligned and mapped back to

ORFs of the candidate gene they were designed from to validate assembly of

candidate globin genes in these two species.

Validated candidate sequences from E. pallida were mapped back to the

genome (Baumgarten et al., 2015) and the intron-exon structures were interrogated.

Candidate genes were used as blast queries against the genome to identify the

scaffolds they occurred on. Sequences were mapped back to these scaffolds using the

Geneious software (v9), and intron-exon boundaries were determined using the

typical GT/AG splicing rule.


2.1.4 Phylogenetic Analysis

The distribution and diversification of globin-like genes was analysed using

Maximum Likelihood, and Bayesian Inference phylogenetic methods. Exonic

nucleotide sequences comprising the globin protein domain (PFAM ID: PF00042)

were aligned in MEGA (v6.06) (Tamura et al., 2013) using Muscle codon modelling

(Edgar, 2004). The best fit model test was conducted in MEGA (v6.06) for all

phylogenetic trees. Subsequent phylogenetic analyses were conducted using IQ-

TREE (http://iqtree.cibiv.univie.ac.at) (Trifinopoulos et al., 2016) and MrBayes

(v3.2) (Ronquist et al., 2012). All phylogenies for nucleotide sequences were

undertaken using the General Time Reversal model with gamma distribution and

invariant sites. Maximum likelihood analyses were completed for 1,000 ultrafast

bootstrap replications, using Codon F3x4 state frequency, ascertainment bias

correction and 0.95 minimum correlation coefficient. Bayesian Inference analyses

were completed for 10,000,000 MCMC generations, sampling every 1,000th

generation, and used a default burn-in value of 25% (25,000 samples). The outgroup

used for all phylogenetic trees was a S. minutum gene containing a single globin

domain.

Outputs from IQ-TREE and MrBayes were further analysed using topology

tests in IQ-TREE (Trifinopoulos et al., 2016) and ancestral state reconstruction in

MrBayes (Ronquist et al., 2012), respectively. Topology testing, with the same

settings as above, was used to analyse ML trees and manually constrained trees using

the Approximately Unbiased test (Shimodaira, 2002). Constrained trees forced a

monophyletic node for cnidarian sequences with either Ngb or Ngb and GbX.

Ancestral state probabilities for three different constrained nodes (cnidarian

sequences with either Ngb, Ngb and GbX or GbX) were completed with default


settings as specified in the manual (Ronquist et al., 2012), with the following

changes: 2,000,000 MCMC generations, sampling every 2,000th generation, and

diagnosis frequency every 50,000th generation.

2.1.5 Protein modelling prediction

Validated candidate globin genes for A. tenebrosa and E. pallida were used to

model predictive protein structures. Amino acid sequences were input into RaptorX

(Källberg et al., 2012) to align against the Protein Data Bank with a stringency value

of ≤ 1e-3. This relatively low value was used due to the lack of invertebrate globin-

like protein structures available. Predictive models were subsequently loaded into the

Chimera protein editor (Pettersen et al., 2004) to annotate and visualise protein

structures, and manually align candidate cnidarian globin proteins for comparative

analyses.

2.1.6 Differential gene expression analysis

Tissue and development specific transcriptome datasets generated with

Illumina platforms were obtained from NCBI GenBank; A. tenebrosa

(PRJNA350366) and N. vectensis (PRJEB13676) for tissue data, and N. vectensis

(PRJNA213177) and E. pallida (PRJNA261862) for developmental data. Each

individual dataset was assembled with all raw reads combined into a single assembly

as per the above Transcriptome construction and quality checking section. The

Trinity RNA-seq software pipeline for determining differential gene expression was

used for each of the assembled datasets (Haas et al., 2013). Raw reads were mapped

back to the relevant combined assembly to obtain transcript abundance using the

RSEM estimation method (Li & Dewey 2011) and the bowtie alignment method


(Langmead et al., 2009). Principle components analysis was performed on the RSEM

abundance count and normalised FPKM data outputs to ensure no batch effects were

present. Differential expression was conducted using default settings in the Trinity

RNA-seq software pipeline for the edgeR method with a dispersion value of 0.1

(Haas et al., 2013; Robinson et al., 2010). Differentially expressed genes were

considered significant provided they had a false discovery rate p-value of < 1e-3.

Heatmaps were constructed in the Trinity RNA-seq software pipeline using default

Perl to R sample correlation matrix settings for the normalised data and a log2 fold

change centred on the mean, with minimum row and column expression values of 0

(Haas et al., 2013).

2.2 RESULTS

2.2.1 Transcriptome assembly and candidate gene validation

All assembled transcriptomes were high quality based on their N50 values, and

CEGMA and BUSCO completeness scores (Appendix A: Supplementary Table 2.3).

All transcriptomes had N50 values > 1,000, with the exception of A. aurita. All

transcriptomes were largely complete with CEGMA and BUSCO scores > 80%, with

the exception of Chironex fleckeri.

Analysis of genome sequences from early-diverging lineages (N. vectensis, A.

digitifera, H. vulgaris, T. adhaerens, A. queenslandica, and M. leidyi) identified a

total of 23 globin-like genes in the six different taxa examined (Appendix A:

Supplementary Table 2.4; Appendix A: Supplementary Figure 2.1). The three

cnidarian species N. vectensis, A. digitifera, and H. vulgaris had nine, three and four

globin-like genes, respectively, while T. adhaerens (Placozoa) had five globin-like

genes and M. leidyi (Ctenophora) and A. queenslandica (Porifera) had one each.


Analysis of transcriptomic data identified a total of 74 globin-like genes from

15 different cnidarian taxa (Appendix A: Supplementary Table 2.4; Appendix A:

Supplementary Figure 2.1). Cnidarian species had up to 10 globin-like genes.

Compared to genome analyses, an additional globin-like gene was identified in the

N. vectensis transcriptome (ortholog reference: N.vectensis_tadh6000210), and two

additional candidate genes identified in the A. digitifera transcriptome (ortholog

reference: A.digitifera_nvec42000019, A.digitifera_nvec76000030). The order

Actiniaria had the greatest number with between 5-10 globin-like genes identified in

all species. In the medusozoan classes, A. alata and C. fleckeri (Cubozoa) each had

one globin-like gene, A. aurita (Scyphozoa) had five globin-like genes, while H.

polyclina (Hydrozoa) had four globin-like genes.

Seven globin-like genes in A. tenebrosa and nine globin-like genes in E.

pallida were validated using Sanger sequencing with identity matches of ≥ 99.8%

and ≥ 98.6%, respectively. A nonsynonymous mutation was observed at nucleotide

position 139 for A. tenebrosa ortholog reference A.tenebrosa_nvec76000030,

resulting in an amino acid change from Lysine (K) to Glutamic Acid (E).

Synonymous and nonsynonymous mutations (between 0-5 and 0-2, respectively)

were observed in all E. pallida candidate genes (Appendix A: Supplementary Table

2.5) which likely reflects the different sampling locations, Saudi Arabia (NCBI

accession number: PRJNA261862) versus Australia. The GbX membrane binding

motif (MGC) (Blank et al., 2011) was identified in six A. tenebrosa globin-like

proteins and seven E. pallida globin-like proteins. The majority of candidate globin

genes in sea anemones have the membrane binding motif, whereas, the majority of

candidate globin genes in all other cnidarians analysed lacked this motif.

Additionally, the 2/3 intron-exon structure is present in all nine sequences of E.


pallida (Appendix A: Supplementary Table 2.6), with predicted intron start locations

at helix positions B12.2 and G7.0, typical of metazoan globin genes.

2.2.2 Evolutionary and structural analyses

Phylogenetic analysis of globin sequences derived from genome data (Figure

2.1) showed that the majority of anthozoan globin genes fall within their own clade

and are sister to vertebrate GbX gene with moderate bootstrap support. However,

other globin genes from early-diverging lineages are paraphyletic with or fall outside

of vertebrate globin genes. Comparative phylogenetic analysis of transcriptome data

(Figure 2.2) showed that the majority of cnidarian globin-like genes are

monophyletic with vertebrate GbX (strong support) or Ngb (weak support).

However, some cnidarian globin genes fall outside these clades, specifically ortholog

reference nvec7000121 and medusozoan genes.


Figure 2.1: Maximum Likelihood bootstrap phylogenetic tree of identified candidate cnidarian globin genes in genomes of cnidarian species, with supported Bayesian posterior probabilities. Model species

representations of phyla Cnidaria, Ctenophora, Placozoa and Porifera (highlighted in purple, green, brown, and yellow, respectively) with vertebrate globin genes highlighted with red branches, and the

S. minutum outgroup highlighted in grey. Phylogenetic values shown as maximum likelihood bootstrap support (0-100)/Bayesian posterior probabilities (0-1.0). Bootstrap values < 50 and posterior probabilities < 0.5 shown with a ~ symbol and nodes not identical between each method shown with a

- symbol.


Figure 2.2: Maximum Likelihood bootstrap phylogenetic tree of identified candidate cnidarian globin genes in transcriptomes of cnidarian species, with supported Bayesian posterior probabilities.

Cnidarian pentacoordinate and hexacoordinate branches highlighted in green and blue, respectively, with vertebrate branches highlighted in red and the S. minutum outgroup branch highlighted in black. Pentacoordinate cnidarian genes represented in ortholog reference nvec7000121 are associated with

protein model highlighted in green. Hexacoordinate cnidarian genes are associated with protein model highlighted in blue. Phylogenetic values shown as maximum likelihood bootstrap support (0-

100)/Bayesian posterior probabilities (0-1.0). Bootstrap values < 50 and posterior probabilities < 0.5 shown with a ~ symbol and nodes not identical between each method shown with a - symbol.

Collapsed clades represent sequences with the corresponding ortholog reference gene nomenclature as referenced in Appendix A: Supplementary Table 2.3 (expanded clades shown in Appendix A:

Supplementary Figure 2.2).


Topological and ancestral analyses of globin sequences derived from genome

data revealed that Figure 2.1 is an accurate representation of phylogenetic

distribution. Approximately unbiased tests suggest that it is highly unlikely (p-value

≤ 0.07) that cnidarian globin genes are monophyletic with either Ngb or Ngb and

GbX. However, ancestral state inferences revealed that Ngb and cnidarian globin

genes are the favoured ancestral state over GbX.

Alignment of cnidarian globin genes showed that three amino acid residues

were highly conserved; Phenylalanine (F, CD1 position), Histidine/Glutamine (H/Q,

E7 position) and Histidine (H, F8 position). Figure 2.1 and Figure 2.2 revealed the

E7 amino acid variation between ortholog reference nvec7000121 (Q), which we

have reported as pentacoordinate, and all other sequences (H), which we have

reported as hexacoordinate. Interestingly, the presence of pentacoordinate globin

proteins was only identified in the class Anthozoa, suggesting a unique role that has

neither been characterised nor elucidated from any other class in phylum Cnidaria.

Phylogenetic analysis revealed that predicted proteins with pentacoordinate

confirmation have arisen once, but hexacoordinate predicted protein sequences have

undergone an expansion in actiniarian species (Figure 2.2).

Protein models for all validated sequences in A. tenebrosa and E. pallida

showed similar conserved structures between these two species (Figure 2.3A).

Interestingly, the pentacoordinate sequences revealed a forward and reverse position

for the distal Glutamine residue in A. tenebrosa and E. pallida, respectively (Figure

2.3B). The positions of the surrounding residues highlight the significance of steric

hindrance on protein structure, especially for ligand binding to the heme group.


Figure 2.3: Predictive cnidarian globin protein structure with heme pocket residues shown. (A) Structural variation of A. tenebrosa ortholog references A.tenebrosa_nvec7000121 (highlighted green)

and A.tenebrosa_nvec42000019 (highlighted blue) with side chain residue structures for F (CD1 position; phenylalanine), Q/H (E7 position; distal glutamine/histidine) and H (F8 position; proximal

histidine) shown. (B) Structural variation of A. tenebrosa ortholog reference A.tenebrosa_nvec7000121 (highlighted green) and E. pallida ortholog reference

E.pallida_nvec7000121 (highlighted gold) showing forward and reverse position of E7 residue Q, respectively, and with side chain residues surrounding E7 position shown.

2.2.3 Differential gene expression analyses

Tissue and developmental data assemblies passed quality checking with the

exception of two datasets from the N. vectensis development assembly. These

datasets (NCBI Accession: SRX351436 and SRX351430) displayed batch effect

outliers because of the different RNA treatments used, and subsequently were

excluded from downstream analysis. The development specific dataset was further

refined to include only the planula and adult stages to represent the same

developmental stages from E. pallida and N. vectensis.


Tissue specific data revealed four and three globin genes were differentially

expressed in A. tenebrosa and N. vectensis, respectively (Figure 2.4). These cnidarian

globin genes were downregulated/unregulated in the acrorhagi of A. tenebrosa and

the nematosome of N. vectensis. Two globin genes (ortholog references:

tadh6000210, nvec141000032/nvec50000067) were upregulated in tentacle, in both

A. tenebrosa and N. vectensis, while being downregulated in the mesentery filament.

Ortholog reference nvec7000121 was upregulated in mesenteric filament of A.

tenebrosa, whereas, it was upregulated in tentacle of N. vectensis.

Figure 2.4: Heatmap for tissue specific RNA-seq differential gene expression (DGE) analysis with three biological replicates for each tissue type. (A) Analysis of A. tenebrosa tissue types: acrorhagi, tentacle and mesentery filament. (B) Analysis of N. vectensis tissue types: nematosome, tentacle and

mesentery filament.

Development specific data revealed seven and two globin genes were

differentially expressed in N. vectensis and E. pallida, respectively (Figure 2.5). E.

pallida has one globin gene upregulated at the immature stage, and the other

upregulated at the mature stage. The globin sequence from the N. vectensis

transcriptome (ortholog reference: tadh6000210), also found in the tissue specific


data, was present in the development specific transcriptomic data. This ortholog had

the same upregulation in expression for both E. pallida and N. vectensis at the mature

stage. Furthermore, there is a difference in expression pattern for globin genes from

the same clade observed in Figure 2.2 (ortholog references: nvec5000153 and

nvec141000032).

Figure 2.5: Heatmap for development specific RNA-seq differential gene expression (DGE) analysis with two biological replicates for each tissue type. (A) Analysis of E. pallida developmental stages:

immature (larvae) and mature (adult), with three biological replicates for adult stage only. (B) Analysis of N. vectensis developmental stages: immature (planula) and mature (adult).

Across the tissue and developmental analyses, nine of the ten different

orthologs were differentially expressed, with eight differentially expressed in N.

vectensis. Interestingly, only a single cnidarian globin gene (ortholog reference

tadh6000210) was upregulated in tentacle (Figure 2.4) and adult (Figure 2.5) tissues

across each species, and this globin gene clusters closely with vertebrate Ngb (Figure

2.2).


Chapter 3: General Discussion

The globin gene superfamily has been extensively studied in vertebrates, but

has been poorly investigated in early-diverging eumetazoan lineages. Studies in early

branching lineages, such as phylum Cnidaria, can resolve this knowledge gap by

enabling elucidation of the similarities and differences among globin genes between

the sister groups: Cnidaria and Bilateria. This research has in part resolved this

through the investigation of genomic data from multiple cnidarian species, with a

particular focus on order Actiniaria. This project has provided a more detailed view

of the evolution and expression of cnidarian globin genes, as well as the predicted

structure and function of the proteins encoded by these globin genes. This project

also investigated the evolution of globin genes in multiple classes of phylum

Cnidaria, with a major focus on class Anthozoa, as more genomic data exists for this

group. Subsequently, a broad expansion of globin genes was revealed and some

resolution on the ancestry of eumetazoan globins was obtained. By studying the

predicted structure of cnidarian globin proteins, two structural conformations were

identified, which likely have different and possibly unique functions within specific

cnidarian lineages. Consequently, this knowledge can be used as a starting point for

more extensive studies into the globin gene superfamily of non-vertebrate and non-

model species.

Chapter 3: General Discussion 37

3.1 KEY FINDINGS

The expansion of globin genes has been identified in various metazoan

lineages, such as myoglobin in lungfish (Koch et al., 2016) and nerve globins in

nematodes (Hoogewijs et al., 2008), but there have been limited studies in early-

diverging species. Analyses of gene copy number, protein sequences, DGE patterns

and protein modelling suggests that large-scale duplication of cnidarian globin genes

followed by subfunctionalisation and possibly neofunctionalisation events has

occurred in actiniarians. This expansion of globin genes is similar to recent

observations in lungfish myoglobin genes (Koch et al., 2016). However, the large-

scale expansion of globin genes in phylum Cnidaria, but particularly order Actiniaria,

has not been observed in any other Metazoan lineage except for nerve globins

reported in phylum Nematoda (Hoogewijs et al., 2008). Furthermore, based on the

evolution of ancestral vertebrate globin genes suggested by Roesner et al., (2005),

Burmester et al., (2014) and this research, we cannot reject the hypothesis that a

Ngb-like/GbX-like gene was likely the ancestral globin gene in Eumetazoans. In fact,

it is more likely that a globin gene similar to those identified in cnidarians was the

ancestral gene that evolved into the vertebrate Ngb and GbX gene ancestor.

The pentacoordinate and hexacoordinate conformations in vertebrate globin

proteins have different affinities for ligands, and subsequently cnidarian globin

proteins would likely exhibit similar ligand affinities under these different

conformations. Ligands other than oxygen can be toxic at high concentrations, such

as, nitric oxide and carbon monoxide. These compounds can be bound to the heme

pocket of a globin protein, and this subsequently reduces the deleterious impact of

these molecules on the organism (Azarov et al., 2016; Brunori et al., 2005; Dewilde

et al., 2001; Fago et al., 2006). Furthermore, recent studies in carbon monoxide

38 Chapter 3: General Discussion

poisoning (Azarov et al., 2016) and nitrite reduction (Tejero et al., 2015) showed that

the pentacoordinate H64Q Ngb protein was a more effective ligand trap for toxic

compounds than hexacoordinate H64 Ngb. Consequently, the presence of a single

pentacoordinate globin protein found exclusively in class Anthozoa suggests a

unique function likely linked to a detoxification role.

Expression patterns of globin genes in actiniarians revealed some copies

displayed tissue and development specific expression. The upregulation of tentacle

specific globin genes suggests that they may have an alternative function to oxygen

storage and transport as this tissue type is in direct contact with the surrounding

water and is likely to be constantly diffusing gaseous compounds with the

surrounding environment. The requirement for cellular energy to replenish the dense

concentration of cells in the tentacle, however, makes an oxygen storage role for

mitochondrial ATP production and reactive oxygen species detoxification a possible

function for these cnidarian globin genes, a role similar to vertebrate Ngb (Bentmann

et al., 2005; Fordel et al., 2007).

3.2 EVOLUTION OF GLOBIN GENES IN PHYLUM CNIDARIA

Research into the evolution of the globin gene has been extensive, and yet the

ancestry of this ubiquitous gene family in Eumetazoa is still not resolved. The history

of vertebrate globin genes has been partially elucidated with the identification of

three genetically divergent genes; androglobin, neuroglobin and globin-X. By

evaluating early-diverging eumetazoan phyla, this research has revealed the presence

of Ngb-like and GbX-like genes in phylum Cnidaria. The presence of any chimeric

globins (androglobin-like) could not be confirmed. There was limited evidence of the


membrane-bound globin motifs in phylum Cnidaria and phylogenetic analyses

suggest cnidarian globins are sister to vertebrate GbX (GbX-like). Additionally, there

are neither chimeric nor membrane-bound globins in other early-diverging phyla;

Ctenophora, Placozoa and Porifera. Bioinformatic analyses have confirmed the

preliminary research of Lechauve et al., (2013) by also identifying the presence of

Ngb-like genes in cnidarians. This data indicates that a cnidarian-like globin gene

(molecularly similar to Ngb and GbX) is common to all eumetazoans and was likely

the ancestral globin gene in this group. The identification of globin genes in the

early-diverging phylum, Placozoa, also suggests that this ancestral gene arose early

in metazoan evolution. Furthermore, it is likely that gene duplication events followed

by subfunctionalisation and possibly neofunctionalisation of the ancestral gene may

have given rise to the rich diversity of globin protein encoding genes in eumetazoans.

The expansion of globin genes in vertebrates can be attributed to gene

duplication events followed by sub-/neofunctionalisation. The 11 different globin

subfamilies found in vertebrates have different protein sequences, as well as a range

of other properties (Burmester & Hankeln, 2014). This research has identified

sequence variations in cnidarian globin genes to determine gene copy number and to

infer potential duplication events. Within order Actiniaria, up to six duplication

events have been identified (Supplementary Figure 3.1), which is similar to

vertebrate globin evolution for sub-/neofunctionalisation. Furthermore, nine globin

gene copies for E. pallida were validated with two independent duplication events

restricted to this species, as well as, two in N. vectensis and one in N. annamensis

(Supplementary Figure 3.1). Similar observations have been observed in teleost fish,

with two cytoglobin genes (identified as cytoglobin 1 and 2) that are thought to have

different functional roles (Fuchs et al., 2005). Additionally, these genes are assumed


to be the result of a subfunctionalisation event, rather than neofunctionalisation,

based on evidence for selection pressure, mutation rates and expression patterns

(Fuchs et al., 2005). Differential expression of recently duplicated genes in E. pallida

only occurred between immature and adult stages for a single gene, although there is

a lack of knowledge about expression profiles of recently duplicated genes in

different tissues. Consequently, the limited number of recently duplicated genes that

were differentially expressed suggests that the duplication events in E. pallida may

have been recent and that these duplicates have not had time to undergo

diversification of their functional roles. However, it is also probable that older

duplicated globin gene copies in order Actiniaria have undergone

subfunctionalisation, particularly those that show altered tissue and developmental

expression patterns.

Our analysis of differential expression across tissues and development of

globin genes in order Actiniaria has also revealed similarities with the evolution in

bilaterian lineages. For example, Koch et al., (2016) have shown tissue specific

expression variations and statistically significant mitochondrial linked functional

variations among an expanded complement of myoglobin genes in lungfish.

Furthermore, Hoogewijs et al., (2008) have also shown tissue specific expression

variations following the expansion of globin genes in nematodes. Additionally,

developmental expression has been well-characterised for β-hemoglobin genes in

humans, where the embryonic, foetal and adult hemoglobin genes are sequentially

expressed during development (Stamatoyannopoulos, 2005). These three globin

genes have been shown to be differentially expressed during three developmental

stages of human growth, yet they have similar functional roles. Consequently, the

observed expressed patterns of these globin genes in vertebrates suggests that


subfunctionalisation following gene duplication is one of the main driving forces in

the evolution of these genes. The tissue and development expression patterns

observed in A. tenebrosa, E. pallida and N. vectensis also indicate that

subfunctionalisation may be the dominant evolutionary force shaping the expression

of cnidarian globin genes.

3.3 CONVERGENT AMPLIFICATION OF GLOBIN GENES IN

EUMETAZOA

Eumetazoa is a large and diverse group of taxa, and there has been very limited

evidence for individual globin subfamily expansions in many groups. To our

knowledge, there have been three independent gene expansions, Ngb in nematodes,

myoglobin in lungfish and hemoglobin in mammals (Hoffmann et al., 2010;

Hoogewijs et al., 2008; Koch et al., 2016; Stamatoyannopoulos, 2005). There are up

to 33 Ngb gene copies in nematodes (Hoogewijs et al., 2008), seven myoglobin gene

copies in lungfish (Koch et al., 2016), and up to 11 hemoglobin gene copies in

mammals (Hoffmann et al., 2012; Stamatoyannopoulos, 2005). The research

presented here has revealed a convergent expansion of globin genes in actiniarians of

phylum Cnidaria with up to 10 gene copies present. This discovery represents more

evidence for the convergent expansion of globin genes in different eumetazoan taxa.

This research also provides evidence that a cnidarian-like globin gene,

molecularly and phylogenetically similar to vertebrate Ngb and GbX, is most likely

the ancestral gene in eumetazoans. This finding is interesting as it suggests that a

single ancestral gene has undergone gene duplication followed by


subfunctionalisation and neofunctionalisation, resulting in multiple functional roles

to represent the broad repertoire of globin genes found in extant eumetazoan taxa.

3.4 STRUCTURE AND FUNCTION OF GLOBIN PROTEINS IN PHYLUM

CNIDARIA

The structure of globin proteins in vertebrates is well-known, however, there is

no known characterised structure for globin proteins in phylum Cnidaria.

Bioinformatic analyses have determined predictive models for the protein structures

of two actiniarian species, A. tenebrosa and E. pallida, which has given us insights

into the possible structures of these proteins. In vertebrate taxa, the two

conformations, hexacoordinate and pentacoordinate, are typically associated with

different globin protein subfamilies, e.g. Ngb is hexacoordinate and myoglobin is

pentacoordinate. However, there is a lack of knowledge about the structure of non-

vertebrate globins, which can be addressed by discerning protein sequences from

identified globin genes for different groups of cnidarians. In silico protein analyses

suggest that cnidarian sequences have similar structures to hexacoordinate globin

proteins. However, in cnidarians there is a key conserved residue mutation (E7

Histidine to Glutamine) that is known to form pentacoordinate globin proteins in

vertebrates (Azarov et al., 2016). Thus it is expected that cnidarians also have the

pentacoordinate globin protein structure and the functional roles attributed to this

structural form. Furthermore, protein predictions have revealed differences in steric

hindrance between A. tenebrosa and E. pallida pentacoordinate proteins, based on

the reversed distal residue in the heme pocket. The significance of this structural

change has yet to be determined but is likely to have an effect on ligand binding


potentials and affinities of these cnidarian globin proteins. The identification of these

two possible structural conformations in cnidarian globin proteins is a preliminary

step in identifying the functions of these early-diverging globins.

The functional roles of vertebrate globin proteins have been well-characterised,

and it would be congruent that globin proteins in cnidarians would have similar

functions. The most well-known function in vertebrates is the transport and supply of

oxygen to working cells. Nematocysts are important cells in cnidarians used in

intraspecific aggressive encounters, defence against predators, prey capture and

during digestion, and thus the requirement for cellular energy to replenish the dense

concentration of nematocysts (especially in tentacle tissues) would be high. Notably,

upregulation of tentacle globin gene expression is likely from dense concentrations

of nematocysts or their progenitor cells, nematoblasts. This association of cnidarian

neural cell types and the observed expression patterns suggests the possibility of

functionally similar roles to vertebrate Ngb, and provides further evidence for the

identification of Ngb-like genes by Lechauve et al. (2013). Consequently, an oxygen

storage role for mitochondria ATP production and reactive oxygen species

detoxification is a strong possibility for cnidarian globin proteins (Bentmann et al.,

2005; Fordel et al., 2007). Alternately, vertebrate globin proteins have an affinity for

gaseous compounds other than oxygen, such as carbon monoxide and nitric oxide.

Interaction with these alternate gaseous compounds has been shown to reduce the

toxic effect that these molecules can cause, specifically for detoxification to maintain

cellular respiration and signalling (Azarov et al., 2016; Brunori et al., 2005; Flögel et

al., 2001; Kiger et al., 2011 Singh et al., 2013). In sea anemones, NO concentrations

increase due to heat stress (Perez et al., 2006), thus an intertidal species that is

regularly exposed to heat, such as A. tenebrosa, would likely have a globin protein to


reduce the toxicity of NO. Additionally, a recent study in carbon monoxide

poisoning (Azarov et al., 2016) showed that the pentacoordinated H[E7]Q Ngb

protein was a more effective ligand trap for toxic chemicals in vertebrate taxa than

the wildtype hexacoordinate Ngb. Thus, from the in silico protein models, a single

pentacoordinate globin sequence was found exclusively in order Actiniaria, which

suggests a unique functional role more likely linked to detoxification rather than an

oxygen binding role. Consequently, this research has provided preliminary evidence

of a possible neofunctionalisation event exclusive to class Anthozoa.

3.5 EFFECT OF ENVIRONMENT ON GLOBIN GENE EXPRESSION IN

PHYLUM CNIDARIA

The supply of oxygen, typically to prevent hypoxia from environmental

pressures, is the main functional role attributed to the globin superfamily in

vertebrates. Research into the expression of globin genes and proteins in vertebrates

have shown variations in gene sequence that are thought to be linked to the different

environments where species occur (Roesner et al., 2006; Roesner et al., 2008).

Similar mechanisms would likely account for the variation observed for the tissue

and development expression patterns of the three species analysed; A. tenebrosa

inhabits the marine intertidal zone (often exposed to air), N. vectensis inhabits

shallow brackish coastal waters and E. pallida inhabits shallow marine waters. These

analyses only provide a bioinformatic analysis on expression rather than a functional

assay, so this conclusion cannot be validated based on bioinformatics alone.

However, by identifying these expression profiles, a more comprehensive study into

the effect of hypoxia on gene expression and protein abundance can be conducted.


3.6 RESEARCH GAPS AND FUTURE DIRECTIONS

Genomic data was used throughout this project to complete our intended

objectives, however, more analyses of intron-exon structure were not performed.

Using RNA-seq data, published datasets were analysed to identify the evolution and

expression of the globin gene repertoire in cnidarians, and subsequently infer

structural models and functional roles of their corresponding proteins. Gene

validation for N. vectensis and Hydra vulgaris would have enabled us to identify the

intron-exon sequences from their genome datasets, which may have improved our

evolutionary analyses and could have provided further evidence for our conclusions.

Specifically, comparing the intron-exon structure between cnidarian and vertebrate

globin genes would have elucidated a greater understanding of the evolution of this

already highly studied gene superfamily. However, this approach was not considered

due to the lack of validated gene data for the Anthozoan species analysed, and it

would not have been viable in the required timeframe for this project.

Previously published datasets for three Actiniaria taxa were used to identify

and analyse tissue and development specific expression patterns. The bioinformatic

approach used for this analysis required a greater number of RNA-seq data for both

taxa diversity and replicate sampling. Due to budget constraints, further research and

an expansion of genomic resources for this project was not achievable. Expanding

the data for tissue and development specific expression, especially for more closely

related and for highly diverse taxa, would give a more holistic understanding of the

cnidarian globin gene repertoire. Furthermore, by using molecular techniques, such

as real-time PCR, the RNA-seq data used could be validated for basal and stress


responses. This would be particularly beneficial for understanding the response of

individual organisms to globin related functional roles, such as oxygen storage and

detoxification, as well as potential environmental pressures, such as dissolved

oxygen, pH, salinity and temperature, on globin gene expression. Due to the lack of

published data and budget constraints, this approach was also unable to be applied in

this project.

This research was focused on bioinformatic techniques, such as phylogenetics

and predictive protein modelling, but these methods do not address the lack of

knowledge surrounding the biochemical functions of globin proteins in phylum

Cnidaria. The bioinformatic techniques that were used identified and validated a set

of globin genes in two Cnidarian taxa, A. tenebrosa and E. pallida. This suggests that

all other gene candidates identified are likely to be present within each dataset

analysed. Solving the protein structures and functions of the identified cnidarian

globin genes would further develop the knowledge and understanding of the globin

superfamily. Specifically, identifying the effect of various stresses related to the

functional roles of globin proteins, such as hypoxia, and carbon monoxide and nitric

oxide toxicity, would further the knowledge and understanding of cnidarian globins.

This would also determine the similarities and differences between the orthologous

globin proteins within phylum Cnidaria and its sister group, superphylum Bilateria.

Our research has, however, provided the preliminary evidence for understanding the

evolution, expression, structure and function of cnidarian globin genes and proteins.


3.7 CONCLUSION

The globin gene superfamily has been extensively researched, and this project

has expanded this knowledge by analysing globin genes within the early-diverging

eumetazoan phylum, Cnidaria. Bioinformatic approaches were used to elucidate the

evolution, expression, structure and function of cnidarian globin genes and predicted

proteins. A broad expansion of globin genes was identified in four classes of

cnidarians, which have undergone subfunctionalisation events and the possibility of

neofunctionalisation events. This represents the third known large-scale expansion of

a single globin subfamily among eumetazoan taxa. In silico protein analyses have

revealed two structural conformations within the cnidarian repertoire,

pentacoordination which is exclusively found in class Anthozoa and

hexacoordination. Consequently, the functional role of cnidarian globin proteins is

likely to have similar roles as those observed in vertebrates, with a possible unique

role for the pentacoordinate globin protein. Consequently, this project has provided

foundational knowledge for cnidarian globin genes and proteins that future studies

can build upon to expand the knowledge of the well-studied globin gene superfamily.


Bibliography

Azarov, I., Wang, L., Rose, J.J., Xu, Q., Huang, X.N., Belanger, A., … Gladwin,

M.T. (2016). Five-coordinate H64Q neuroglobin as a ligand-trap antidote for

carbon monoxide poisoning. Scientific Translational Medicine, 8(368),

368ra173. https://doi.org/10.1126/scitranslmed.aah6571

Babonis, L.S., Martindale, M.Q., & Ryan, J.F. (2016). Do novel genes drive

morphological novelty? An investigation of the nematosomes in the sea

anemone Nematostella vectensis. BMC Evolutionary Biology 16, 114.

Bashford, D., Chothia, C., & Lesk, A.M. (1987). Determinants of a Protein Fold:

Unique Features of the Globin Amino Acid Sequences. Journal of Molecular

Biology, 196, 199-216.

Baumgarten, S., Simakov, O., Esherickc, L.Y., Liewa, Y.J., Lehnertc, E.M.,

Michella, C.T., … Voolstraa, C.R. (2015). The genome of Aiptasia, a sea

anemone model for coral symbiosis. Proceedings of the National Academy of

Sciences United States of America, 112(38), 11893-11898.

Bentmann, A., Schmidt, M., Reuss, S., Wolfrum, U., Hankeln, T., & Burmester, T.

(2005). Divergent distribution in vascular and avascular mammalian retinae

links neuroglobin to cellular respiration. The Journal of Biological Chemistry,

280, 20660-20665.

Bocahut, A., Derrien, V., Bernad, S., Sebban, P., Sacquin-Mora, S., Guittet, E., &

Lescop, E. (2013). Heme orientation modulates histidine dissociation and ligand

Bibliography 49

binding kinetics in the hexacoordinated human neuroglobin. Journal of

Biological Inorganic Chemistry, 18(1), 111-122.

Borhani, H.A., Berghmans, H., Trashin, S., De Wael, K., Fago, A., Moens, L., …

Dewilde, S. (2015). Kinetic properties and heme pocket structure of two

domains of the polymeric haemoglobin of Artemia in comparison with the

native molecule. Biochimica et Biophysica Acta, 1854(10), 1307-1316.

Bostelaar, T., Vitvitsky, V., Kumutima, J., Lewis, B.E., Yadav, P.K., Brunold, T.C.,

… Banerjee, R. (2016). Hydrogen sulphide oxidation by myoglobin. Journal of

the American Chemical Society, 138, 8476-8488.

Bouchard, J.N., & Yamasaki, H. (2008). Heat Stress Stimulates Nitric Oxide

Production in Symbiodinium microadriaticum: A Possible Linkage between

Nitric Oxide and the Coral Bleaching Phenomenon. Plant Cell Physiology,

49(4), 641-652.

Brekhman, V., Malik, A., Haas, B., Sher, N., & Lotan, T. (2015). Transcriptome

profiling of the dynamic life cycle of the scypohozoan jellyfish Aurelia aurita.

BMC Genomics, 16, 74. https://doi.org/10.1186/s12864-015-1320-z

Brunori, M., Giuffrè, A., Nienhaus, K., Nienhaus, G.U., Scandurra, F.M., &Vallone,

B. (2005). Neuroglobin, nitric oxide, and oxygen: Functional pathways and

conformational changes. Proceedings of the National Academy of Sciences of

the United States of America, 102(24), 8483-8488.

Brusca, R. C., & Brusca, G. J. (2003). Invertebrates (2nd ed.). Sunderland, Mass:

Sinauer Associates.

50 Bibliography

Burmester, T., Ebner, B., Weich, B., & Hankeln, T. (2002). Cytoglobin: a novel

globin type ubiquitously expressed in vertebrate tissues. Molecular Biology and

Evolution, 19(4), 416-421.

Burmester, T., Haberkamp, M., Mitz, S., Roesner, A., Schmidt, M., Ebner, B., …

Hankeln, T. (2004). Neuroglobin and Cytoglobin: Genes, Proteins and

Evolution. Life, 56(11-12), 703-707.

Burmester, T., & Hankeln, T. (2009). What is the function of neuroglobin? Journal

of Experimental Biology, 212(10), 1423-1428.

Burmester, T., & Hankeln, T. (2014). Function and evolution of vertebrate globins.

Acta Physiologica. 211(3), 501-514.

Burmester, T., Welch, B., Reinhardt, S., & Hankeln, T. (2000). A vertebrate globin

expressed in the brain. Nature, 407(6803), 520-523.

Chapman, J.A., Kirkness, E.F., Simakov, O., Hampson, S.E., Mitros, T., Weinmaier,

T., … Steele, R.E. (2010). The dynamic genome of Hydra. Nature. 464(7288),

592-596.

Chen, F., Mackey, A.J., Stoeckert, C.J., & Roos, D.S. (2006). OrthoMCL-DB:

querying a comprehensive multi-species collection of ortholog groups. Nucleic

Acids Research, 34, D363-D368.

Dewilde, S., Kiger, L., Burmester, T., Hankeln, T., Baudin-Creuza, V., Aerts, T., …

Moens, L. (2001). Biochemical Characterization and Ligand Binding Properties

of Neuroglobin, a Novel member of the Globin Family. Journal of Biological

Chemistry, 276(42), 38949-38955.

Bibliography 51

Dickerson, R. E., & Geis, I. (1983). Hemoglobin: structure, function, evolution, and

pathology (Vol. 1983). Benjamin-Cummings Publishing Company.

Ebner, B., Panopoulou, G., Vinogradov, S.N., Kiger, L., Marden, M.C., Burmester,

T., & Hankeln, T. (2010). The globin gene family of the cephalochordate

amphioxus: implications for chordate globin evolution. BMC Evolutionary

Biology, 10. doi: 10.1186/1471-2148-10-370.

Edgar, R.C. (2004). MUSCLE: multiple sequence alignment with high accuracy and

high throughput. Nucleic Acids Research, 32(5), 1792-1797.

Fago, A., Mathews, A.J., Dewilde, S., Moens, L., & Brittain, T. (2006). The

reactions of neuroglobin with CO: Evidence for two forms of the ferrous

protein. Journal of Inorganic Biochemistry, 100(8), 1339-1343.

Flögel, U., Merx, M.W., Gödecke, A., Decking, U.K.M., & Schrader, J. (2001).

Myoglobin: A scavenger of bioactive NO. Proceedings of the National Academy

of Sciences of the United States of America, 98(2), 735-740.

Fordel, E., Thijs, L., Moens, L., & Dewilde, S. (2007). Neuroglobin and cytoglobin

expression in mice: Evidence for a correlation with reactive oxygen species

scavenging. The FEBS Journal, 274(5), 1312-1317.

Freitas, T.A.K., Hou, S., Dioum, E.M., Saito, J.A., Newhouse, J., Gonzalez, G., …

Alam, M. (2004). Ancestral hemoglobins in Archaea. Proceedings of the

National Academy of Sciences of the United States of America, 101(17), 6675-

6680.

52 Bibliography

Freitas, T.A.K., Saito, J.A., Hou, S., & Alam, M. (2013). Globin-coupled sensors,

protoglobins, and the last universal common ancestor. Journal of Inorganic

Chemistry, 99(1), 23-33.

Fu, L., Niu, B., Zhu, Z., Wu, S., & Li, W. (2012). CD-HIT: accelerated for clustering

the next-generation sequencing data. Bioinformatics. 28(23), 3150-3152.

Giuffre, A., Moschetti, T., Vallone, B., & Brunori, M. (2008). Neuroglobin:

Enzymatic reduction and oxygen affinity. Biochemical and Biophysical

Research Communications, 367(4), 893-898.

Haas, B.J., Papanicolaou, A., Yassour, M., Grabherr, M., Blood, P.D., Bowden, J.,

… Regev, A. (2008). De novo transcript sequence reconstruction from RNA-seq

using the Trinity platform for reference generation and analysis. Nature

protocols, 8(8), 1494-1512.

Hardison, R.C. (1996). A brief history of hemoglobins: Plant, animal, protist and

bacteria. Proceedings of the National Academy of Sciences of the United States

of America, 93, 5675-5679.

Hoffmann, F.G., Opazo, J.C., & Storz, J.F. (2010). Gene cooption and convergent

evolution of oxygen transport hemoglobins in jawed and jawless vertebrates.

Proceedings of the National Academy of Sciences of the United States of

America, 107(32), 14274-14279.

Hoffmann, F.G., Opazo, J.C., Hoogewijs, D., Hankeln, T., Ebner, B., Vinogradov,

S.N., … Storz, J.F. (2012). Evolution of the Globin Gene Family in

Deuterostomes: Lineage-Specific Patterns of Diversification and Attrition.

Molecular Biology and Evolution, 29(7), 1735-1745.

Bibliography 53

Hoogewijs, D., De Henau, S., Dewilde, S., Moens, L., Couvreur, M., Borgonie, G.,

… Vanfleteren, J.R. (2008). The Caenorhabditis globin gene family reveals

extensive nematode-specific radiation and diversification. BMC Evolutionary

Biology, 8. https://doi.org/10.1186/1471-2148-8-279

Hoogewijs, D., Ebner, B., Germani, F., Hoffmann, F.G. Fabrizius, A., Moens, L., …

Hankeln, T. (2011). Androglobin: a chimeric globin in metazoans that is

preferentially expressed in Mammalian testes. Molecular Biology and Evolution.

29(4), 1105-1114.

Hundahl, C.A, Elfving, B., Muller, H.K., Hay-Schmidt, A., & Wegener, G. (2013). A

gene-environment study of cytoglobin in the human and rat hippocampus. PLOS

One, 8(5), e63288. doi:10.1371/journal.pone.0063288

Jayaraman, T., Tejero, J., Chen, B.B., Blood, A.B., Frizzell, S., Shapiro, C., …

Gladwin, M.T. (2011). 14-3-3 Binding and Phosphorylation of Neuroglobin

during Hypoxia Modulate Six-to-Five Heme Pocket Coordination and Rate of

Nitrite Reduction to Nitric Oxide. Journal of Biological Chemistry, 286(49),

42679-42689.

Jeffreys, A.J., Wilson, V., Wood, D., & Simons, J.P. (1980). Linkage of Adult α–

and β–Globin Genes in X. laevis and Gene Duplication by Tetraploidization.

Cell, 21(2), 555-564.

Källberg, M., Wang, H., Wang, S., Peng, J., Wang, Z., Lu, H., & Xu, J. (2012).

Template-based protein structure modeling using the RaptorX web server.

Nature Protocols, 7(8), 1511–1522.

54 Bibliography

Kiger, L., Tillman, L., Geuens, E., Hoogewijs, G., Lechauve, C., Moens, L., …

Marden, M.C. (2011). Electron transfer function versus oxygen delivery: A

comparative study for several hexacoordinated globins across the Animal

Kingdom. PLOS One, 6(6). DOI: 10.1371/journal.pone.0020478

Koch, J., Lüdemann, J., Spies, R., Last, M., Amemiya, C.T., & Burmester, T. (2016).

Unusual diversity of myoglobin genes in the lungfish. Molecular Biology and

Evolution 33(12), 3033-3041.

Kriegl, J.M., Bhattacharyya, A.J., Nienhaus, K., Deng, P., Minkow, O., & Nienhaus,

G.U. (2002). Ligand binding and protein dynamics in neuroglobin. Proceedings

of the National Academy of Sciences of the United States of America, 99(12),

7992-7997.

Langmead, B., Trapnell, C., Pop, M., & Salzberg, S.L. (2009). Ultrafast and

memory-efficient alignment of short DNA sequences to the human genome.

Genome Biology, 10, R25. https://doi.org/10.1186/gb-2009-10-3-r25

Lechauve, C., Jager, M., Laguerre, L., Kiger, L., Correc, G., Leroux, C., … Bailey,

X. (2013). Neuroglobins, Pivotal Proteins Associated with Emerging Neural

Systems and Precursors of Metazoan Globin Diversity. Journal of Biological

Chemistry, 288(10), 6957-6967.

Li, B., & Dewey, C.N. (2011). RSEM: accurate transcript quantification from RNA-

Seq data with or without a reference genome. BMC Bioinformatics, 12, 323.

https://doi.org/10.1186/1471-2105-12-323

Mohamed, A.R., Cumbo, V., Harii, S., Shinzato, C., Chan, C.X., Ragan, M.A. …

Miller, D.J. (2016). The transcriptomic response of the coral Acropora digitifera

Bibliography 55

to a competent Symbiodinium strain: the symbiosome as an arrested early

phagosome. Molecular Ecology, 25(13), 3127-3141.

Nienhaus, K., Kriegl, J.M., & Nienhaus, G.U. (2004). Structural Dynamics in the

Active Site of Murine Neuroglobin and Its Effects on Ligand Binding. The

Journal of Biological Chemistry, 279(22), 22944-22952.

Ohno, S. (1969). The role of gene duplication in vertebrate evolution. The biological

basis of medicine, 4, 109-132.

Ota, M., Isogai, Y., & Nishikawa, K. (1997). Structural requirement of highly-

conserved residues in globins. FEBS Letters, 415(2), 129-133.

Parra, G., Bradnam, K., & Korf, I. (2007). CEGMA: a pipeline to accurately annotate

core genes in eukaryotic genomes. Bioinformatics, 23(9), 1061-1067.

Perez, S., & Weis, V. (2006). Nitric oxide and cnidarian bleaching: an eviction notice

mediates breakdown of a symbiosis. The Journal of Experimental Biology, 209,

2804-2810.

Pesce, A., Dewilde, S., Nardini, M., Moens, L., Ascenzi, P., Hankeln, T., …

Bolognesi, M. (2003). Human Brain Neuroglobin Structure Reveals a Distinct

Mode of Controlling Oxygen Affinity. Structure, 11(9), 1087-1095.

Pettersen, E.F., Goddard, T.D., Huang, C.C., Couch, G.S., Greenblatt, D.M., Meng,

E.C., & Ferrin, T.E. (2004). UCSF Chimera—a visualization system for

exploratory research and analysis. Journal of Computational Chemistry, 25(13),

1605-1612.

Pratlong, M., Haguenauer, A., Chabrol, O., Klopp, C., Pontarotti, P., & Aurelle, D.

(2015). The red coral (Corallium rubrum) transcriptome: a new resource for

56 Bibliography

population genetics and local adaptation studies. Molecular Ecology Resources,

15(5), 1205-1215.

Putnam, N.H., Srivastava, M., Hellsten, U., Dirks, B., Chapman, J., Salamov, A., …

Rokhsar, D.S. (2007). Sea Anemone Genome Reveals Ancestral Eumetazoan

Gene Repertoire and Genomic Organization. Science, 317(5834), 86-94.

Ramos-Alvarez, C., Yoo, B., Pietri, R., Lamarre, I., Martin, J., Lopez-Garriga, J., &

Negrerie, M. (2013). Reactivity and Dynamics of H2S, NO, and O2 Interacting

with Hemoglobins from Lucina pectinata. Biochemistry, 52(40), 7007-7021.

Robinson, M.D., McCarthy, D.J., & Smyth, G.K. (2010). A Bioconductor package

for differential expression analysis of digital gene expression data.

Bioinformatics, 26(1), 139-140.

Rodríguez, E., Barbeitos, M.S., Brugler, M.R., Crowley, L.M., Grajales, A., Gusmão,

L., … Daly, M. (2014). Hidden among sea anemones: The first comprehensive

phylogenetic reconstruction of the order Actiniaria (Cnidaria, Anthozoa,

Hexacorallia) reveals a novel group of hexacorals. PLOS One, 9(5), e96998.

Roesner, A., Fuchs, C., Hankeln, T., & Burmester, T. (2005). A Globin Gene of

Ancient Evolutionary Origin in Lower Vertebrates: Evidence for Two Distinct

Globin Families in Animals. Molecular Biology and Evolution, 22(1), 12-20.

Roesner, A., Hankeln, T., & Burmester, T. (2006). Hypoxia induces a complex

response of globin expression in zebrafish (Danio rerio). Journal of

Experimental Biology, 209, 2129-2137.

Bibliography 57

Roesner, A., Mitz, S.A., Hankeln, T., & Burmester, T. (2008). Globins and hypoxia

adaptation in the goldfish, Carassius auratus. The FEBS Journal, 275, 3633-

3643.

Ronquist, F., Teslenko, M., van der Mark, P., Ayres, D.L., Darling, A., Höhna, S., …

Huelsenbeck, J.P. (2012). MrBayes 3.2: Efficient Bayesian phylogenetic

inference and model choice across a large model space. Systematic Biology,

61(3), 539-542.

Ruetz, M., Kumutima, J., Lewis, B.E., Filipovic, M.R., Lehnert, N., Stemmler, T.L.,

& Banerjee, R. (2017). A distal ligand mutes the interaction of hydrogen

sulphide with human neuroglobin. Journal of Biological Chemistry, 292(16),

6512-6528.

Ryan, J.F., Pang, K., Schnitzler, C.E., Nguyen, A., Moreland, R.T., Simmons, D.K.,

… Baxevanis, A.D. (2013). The genome of the ctenophore Mnemiopsis leidyi

and its implications for cell type evolution. Science, 342(6164), 1242592.

Shen, S., Slightom, J.L., & Smithies, O. (1981). A history of the Human Fetal Globin

Gene Duplication. Cell, 26(2), 191-203.

Singh, S., Zhuo, M., Gorgun, F.M., & Englander, E.W. (2013). Overexpressed

neuroglobin raises threshold for nitric oxide-induced impairment of

mitochondrial respiratory activities and stress signalling in primary cortical

neurons. Nitric Oxide, 32, 21-28.

Shimodaira, H. (2002). An approximately unbiased test of phylogenetic tree

selection. Systematic Biology, 51(3). 492-508.

58 Bibliography

Shinzato, C., Shoguchi, E., Kawashima, T., Hamada, M., Hisata, K., Tanaka, M., …

Satoh, N. (2011). Using the Acropora digitifera genome to understand coral

responses to environmental change. Nature, 476(7360), 320-323.

Simão, F.A., Waterhouse, R.M., Ioannidis, P., Kriventseva, E.V., Zdobnov, E.M.

(2015). BUSCO: assessing genome assembly and annotation completeness with

single-copy orthologs. Bioinformatics, 31(19), 3210-3212.

Srivastava, M., Begovic, E., Chapman, J., Putnam, N.H., Hellsten, U., Kawashima,

T., … Rokhsar, D.S. (2008). The Trichoplax genome and the nature of

placozoans. Nature, 454(7207), 955-960

Srivastava, M., Simakov, O., Chapman, J., Fahey, B., Gauthier, M.E.A., Mitros, T.,

… Rokhsar, D.S. (2010). The Amphimedon queenslandica genome and the

evolution of animal complexity. Nature, 466(7307), 720-726.

Stamatoyannopoulos, G. (2005). Control of globin gene expression during

development and erythroid differentiation. Experimental Hematology, 33. 259-

271.

Storz, J.F., Opazo, J.C., & Hoffmann, F.G. (2013). Gene duplication, genome

duplication, and the functional diversification of vertebrate globins. Molecular

Phylogenetics and Evolution, 66(2), 469-478

Tamura, K., Stecher, G., Peterson, D., Filipski, A., & Kumar, S. (2013) MEGA6:

Molecular Evolutionary Genetics Analysis Version 6.0. Molecular Biology and

Evolution, 30(12), 2725-2729.

Technau, U., & Steele, R.E. (2012). Evolutionary crossroads in developmental

biology: Cnidaria. Development, 138, 1447-1458.

Bibliography 59

Teixerira, T., Diniz, M., CaladoR., & Rosa, R. (2013). Coral physiological

adaptations to air exposure: Heat shock and oxidative stress responses in

Veretillum cynomorium. Journal of Experimental Marine Biology and Ecology,

439, 35-41.

Tejero, J., Sparacino-Watkins, C.E., Ragireddy, V., Frizzell, S., & Gladwin, M.T.

(2015). Exploring the Mechanisms of the Reductase Activity of Neuroglobin by

Site-Directed Mutagenesis of the Heme Distal Pocket. Biochemistry, 54(3), 722-

733.

Trapido-Rosenthal, H., Zielke, S., Owen, R., Buxton, L., Boeing, B., Bhagooli, R., &

Archer, J. (2005). Increased Zooxanthellae Nitric Oxide Synthase activity is

associated with coral bleaching. Biology Bulletin, 208, 3-6.

Trifinopoulos, J., Nguyen, L., von Haeseler, A., Minh, B.Q. (2016). W-IQ-TREE: a

fast online phylogenetic tool for maximum likelihood analysis. Nucleic Acids

Research, 44(W1), W232-W235.

Van Der Burg, C.A., Prentis, P.J., Surm, J.M., Pavasovic, A. (2016). Insights into the

innate immunome of actiniarians using a comparative genomic approach. BMC

Genomics, 17, 850. https://doi.org/10.1186/s12864-016-3204-2

Vitvitsky, V., Yadov, P.R., Kurthen, A., & Banerjee, R. (2015). Sulphide oxidation

by a noncanonical pathway in red blood cells generates thiosulfate and

polysulfides. The journal of Biological Chemistry, 290(13), 8310-8320.

Watanabe, S., Takahashi, N., Uchida, H., & Wakasugi, K. (2012). Human

Neuroglobin Functions as an Oxidative Stress-responsive Sensor for

Neuroprotection. Journal of Biological Chemistry, 287(6), 30128-30138.

60 Bibliography

Ye, J., Coulouris, G., Zaretskaya, I., Cutcutache, I., Rozen, S. & Madden, T.L.

(2012). Primer-BLAST: A tool to design target-specific primers for polymerase

chain reaction. BMC Bioinformatics, 13, 134. https://doi.org/10.1186/1471-

2105-13-134

Zapata, F., Goetz, F.E., Smith, S.A., Howison, M., Siebert, S., Church, S.H., …

Cartwright, P. (2015). Phylogenetic analyses support traditional relationships

within Cnidaria. PLOS One, 10(10), e0139068.

Zhang, J. (2003). Evolution by gene duplication: an update. Ecology and Evolution,

18(6), 292-298.

Bibliography 61

Appendices

Appendix A

Supplementary Tables and Figures

Supplementary Table 2.1: Output from OrthoMCL for candidate cnidarian globin genes, with individual gene nomenclature used for all downstream analyses.

Candidate Gene Nomenclature OrthoMCL Group

Genome Reference ID E-value %Ident %Match

A.alata_oanaENSOANP00000016790 OG5_132086 oana|ENSOANP00000016790 2e-20 33 96 A.aurita_nvec3000224_1 OG5_132086 nvec|fgenesh1_pg.scaffold_3000224 1e-25 34 99 A.aurita_nvec141000032_1 OG5_132086 nvec|fgenesh1_pg.scaffold_141000032 6e-16 31 91 A.aurita_nvec141000032_2 OG5_132086 nvec|fgenesh1_pg.scaffold_141000032 2e-25 34 99 A.aurita_nvec3000224_2 OG5_132086 nvec|fgenesh1_pg.scaffold_3000224 4e-18 29 99 A.aurita_oanaENSOANP00000016790 OG5_132086 oana|ENSOANP00000016790 9e-17 33 83 A.buddemeieri_nvec5000153 OG5_132086 nvec|fgenesh1_pg.scaffold_5000153 9e-66 60 99 A.buddemeieri_tadh6000210 OG5_132086 tadh|fgeneshTA2_pg.C_scaffold_6000210 2e-28 40 92 A.buddemeieri_nvec7000121 OG5_146786 nvec|fgenesh1_pg.scaffold_7000121 5e-35 39 99 A.buddemeieri_nvec141000032 OG5_132086 nvec|fgenesh1_pg.scaffold_141000032 6e-67 69 99 A.buddemeieri_nvec76000030 OG5_132086 nvec|fgenesh1_pg.scaffold_76000030 3e-42 47 100 A.buddemeieri_nvec3000224 OG5_132086 nvec|fgenesh1_pg.scaffold_3000224 6e-62 56 100 A.buddemeieri_nvec42000019 OG5_132086 nvec|fgenesh1_pg.scaffold_42000019 2e-63 61 99 A.digitifera_micrACO65508 OG5_132086 micr|ACO65508 8e-24 41 97 A.digitifera_nvec141000032_1 OG5_132086 nvec|fgenesh1_pg.scaffold_141000032 1e-34 43 98 A.digitifera_nvec141000032_2 OG5_132086 nvec|fgenesh1_pg.scaffold_141000032 1e-65 67 100 A.digitifera_nvec76000030 OG5_132086 nvec|fgenesh1_pg.scaffold_76000030 2e-36 42 99 A.digitifera_nvec42000019 OG5_132086 nvec|fgenesh1_pg.scaffold_42000019 8e-24 44 98 A.queenslandica_nvec7000121 OG5_146786 nvec|fgenesh1_pg.scaffold_7000121 3e-18 34 97

63 Appendices

A.tenebrosa_nvec42000019 OG5_132086 nvec|fgenesh1_pg.scaffold_42000019 1e-65 64 99 A.tenebrosa_nvec7000121 OG5_146786 nvec|fgenesh1_pg.scaffold_7000121 2e-34 40 97 A.tenebrosa_tadh6000210 OG5_132086 tadh|fgeneshTA2_pg.C_scaffold_6000210 8e-29 42 92 A.tenebrosa_nvec76000030 OG5_132086 nvec|fgenesh1_pg.scaffold_76000030 3e-42 48 98 A.tenebrosa_nvec3000224 OG5_132086 nvec|fgenesh1_pg.scaffold_3000224 4e-62 57 100 A.tenebrosa_nvec141000032_1 OG5_132086 nvec|fgenesh1_pg.scaffold_141000032 6e-65 68 99 A.tenebrosa_nvec141000032_2 OG5_132086 nvec|fgenesh1_pg.scaffold_141000032 3e-67 70 99 A.veratra_nvec7000121 OG5_146786 nvec|fgenesh1_pg.scaffold_7000121 1e-31 37 97 A.veratra_nvec141000032_1 OG5_132086 nvec|fgenesh1_pg.scaffold_141000032 9e-67 71 99 A.veratra_nvec141000032_2 OG5_132086 nvec|fgenesh1_pg.scaffold_141000032 1e-65 67 98 A.veratra_nvec76000030 OG5_132086 nvec|fgenesh1_pg.scaffold_76000030 4e-47 52 100 A.veratra_nvec3000224 OG5_132086 nvec|fgenesh1_pg.scaffold_3000224 4e-62 58 99 A.veratra_nvec42000019 OG5_132086 nvec|fgenesh1_pg.scaffold_42000019 3e-65 63 99 A.veratra_tadh6000210 OG5_132086 tadh|fgeneshTA2_pg.C_scaffold_6000210 3e-29 40 92 C.fleckeri_nvec7000121 OG5_146786 nvec|fgenesh1_pg.scaffold_7000121 7e-22 34 77 C.polypus_nvec141000032 OG5_132086 nvec|fgenesh1_pg.scaffold_141000032 1e-65 71 99 C.polypus_tadh6000210 OG5_132086 tadh|fgeneshTA2_pg.C_scaffold_6000210 1e-25 40 92 C.polypus_nvec42000019 OG5_132086 nvec|fgenesh1_pg.scaffold_42000019 4e-61 60 98 C.polypus_nvec7000121 OG5_146786 nvec|fgenesh1_pg.scaffold_7000121 1e-29 37 99 C.polypus_nvec76000030 OG5_132086 nvec|fgenesh1_pg.scaffold_76000030 2e-35 49 100 C.rubrum_nvec141000032_1 OG5_132086 nvec|fgenesh1_pg.scaffold_141000032 2e-39 46 99 C.rubrum_nvec141000032_2 OG5_132086 nvec|fgenesh1_pg.scaffold_141000032 1e-19 28 99 C.rubrum_nvec7000121 OG5_146786 nvec|fgenesh1_pg.scaffold_7000121 1e-25 35 81 E.pallida_nvec42000019_1 OG5_132086 nvec|fgenesh1_pg.scaffold_42000019 4e-47 51 97 E.pallida_nvec3000224 OG5_132086 nvec|fgenesh1_pg.scaffold_3000224 5e-63 57 99 E.pallida_tadh6000210_1 OG5_132086 tadh|fgeneshTA2_pg.C_scaffold_6000210 9e-28 42 90 E.pallida_nvec141000032_1 OG5_132086 nvec|fgenesh1_pg.scaffold_141000032 2e-67 73 99 E.pallida_nvec7000121 OG5_146786 nvec|fgenesh1_pg.scaffold_7000121 2e-30 36 98 E.pallida_nvec141000032_2 OG5_132086 nvec|fgenesh1_pg.scaffold_141000032 5e-66 71 99 E.pallida_tadh6000210_2 OG5_132086 tadh|fgeneshTA2_pg.C_scaffold_6000210 9e-24 40 90 E.pallida_nvec141000032_3 OG5_132086 nvec|fgenesh1_pg.scaffold_141000032 5e-38 44 99 E.pallida_nvec42000019_2 OG5_132086 nvec|fgenesh1_pg.scaffold_42000019 2e-62 65 99 H.polyclina_tadh6000210 OG5_132086 tadh|fgeneshTA2_pg.C_scaffold_6000210 3e-10 26 87

64 Appendices

H.polyclina_mdomENSODP00000006771 OG5_132086 mdom|ENSMODP00000006771 3e-8 22 92 H.polyclina_phumPHUM323880 OG5_132086 phum|PHUM323880 4e-8 25 72 H.polyclina_trubENSTRU00000033639 OG5_132086 trub|ENSTRUP00000033639 8e-9 23 85 H.vulgaris_tnigENSTNIP00000020604 OG5_132086 tnig|ENSTNIP00000020604 2e-13 27 70 H.vulgaris_drerENSDARP00000045749 OG5_132086 drer|ENSDARP00000045749 2e-13 27 81 H.vulgaris_nvec50000067 OG5_132086 nvec|fgenesh1_pg.scaffold_50000067 1e-11 25 84 H.vulgaris_tnigENSTNIP00000020604 OG5_132086 tnig|ENSTNIP00000020604 1e-13 29 71 M.leidyi_micrACO65508 OG5_132086 micr|ACO65508 6e-10 31 85 N.annamensis_nvec141000032 OG5_132086 nvec|fgenesh1_pg.scaffold_141000032 6e-62 64 99 N.annamensis_tadh6000210_1 OG5_132086 tadh|fgeneshTA2_pg.C_scaffold_6000210 1e-28 44 92 N.annamensis_tadh6000210_2 OG5_132086 tadh|fgeneshTA2_pg.C_scaffold_6000210 3e-24 40 100 N.annamensis_nvec7000121 OG5_146786 nvec|fgenesh1_pg.scaffold_7000121 2e-30 36 99 N.annamensis_nvec42000019 OG5_132086 nvec|fgenesh1_pg.scaffold_42000019 2e-55 55 99 N.annamensis_nvec76000030 OG5_132086 nvec|fgenesh1_pg.scaffold_76000030 3e-43 48 100 N.annamensis_nvec141000032_1 OG5_132086 nvec|fgenesh1_pg.scaffold_141000032 3e-66 71 99 N.annamensis_nvec141000032_2 OG5_132086 nvec|fgenesh1_pg.scaffold_141000032 2e-67 72 99 N.vectensis_nvec3000224 OG5_132086 nvec|fgenesh1_pg.scaffold_3000224 1e-106 100 100 N.vectensis_nvec141000032 OG5_132086 nvec|fgenesh1_pg.scaffold_141000032 6e-98 100 100 N.vectensis_nvec46000041 OG5_132086 nvec|fgenesh1_pg.scaffold_46000041 2e-77 100 100 N.vectensis_nvec7000121 OG5_146786 nvec|fgenesh1_pg.scaffold_7000121 1e-114 100 100 N.vectensis_nvec42000018 OG5_132086 nvec|fgenesh1_pg.scaffold_42000018 1e-138 100 100 N.vectensis_nvec42000019 OG5_132086 nvec|fgenesh1_pg.scaffold_42000019 1e-104 100 100 N.vectensis_nvec76000030 OG5_132086 nvec|fgenesh1_pg.scaffold_76000030 1e-107 100 100 N.vectensis_nvec5000153 OG5_132086 nvec|fgenesh1_pg.scaffold_5000153 1e-124 100 100 N.vectensis_nvec50000067 OG5_132086 nvec|fgenesh1_pg.scaffold_50000067 1e-105 100 100 N.vectensis_tadh6000210 OG5_132086 tadh|fgeneshTA2_pg.C_scaffold_6000210 1e-23 41 96 P.variabilis_tadh6000210 OG5_132086 tadh|fgeneshTA2_pg.C_scaffold_6000210 3e-25 39 86 P.variabilis_micrACO65508 OG5_132086 micr|ACO65508 2e-18 38 88 T.adhaerens_tadh12000183 OG5_174830 tadh|fgeneshTA2_pg.C_scaffold_12000183 2e-64 100 100 T.adhaerens_tadh42000020 OG5_211503 tadh|fgeneshTA2_pg.C_scaffold_42000020 1e-103 100 100 T.adhaerens_tadh6000210 OG5_132086 tadh|fgeneshTA2_pg.C_scaffold_6000210 7e-91 100 100 T.adhaerens_tadh3000908 OG5_173496 tadh|fgeneshTA2_pg.C_scaffold_3000908 8e-75 100 100 T.adhaerens_tadh3000909 OG5_211503 tadh|fgeneshTA2_pg.C_scaffold_3000909 3e-81 100 100

65 Appendices

Supplementary Table 2.2: Primer sequences and estimated gene sequence length for candidate cnidarian globin genes in A. tenebrosa and E. pallida. Candidate gene nomenclature referenced

from OrthoMCL results detailed in Supplementary Table 2.4.

Candidate Gene ID NCBI Accession Number

Forward Primer Sequence Reverse Primer Sequence Estimated Gene Length

A.tenebrosa_nvec141000032_1 KY810202 TTTTTCCGTCTCGAAGATA CAAAGTGTACACCCTCTTC 579 A.tenebrosa_nvec141000032_2 KY810203 AAACCAAGATCGACCAGTT TACAGATCTAGACCAGGAAAG 588 A.tenebrosa_nvec3000224 KY810201 TCTTTTCAAGTTTTCCTAGCC GGCAAGACTTTTCCAGTTTA 609 A.tenebrosa_nvec42000019 KY810197 GAGTTAAGAATTCAAGAGGC GCTGTTCACACAGATATAAAGA 640 A.tenebrosa_nvec7000121 KY810198 AGTTTTCTTGCTCTGTTCATC CATGCGCATCACTGTTTG 577 A.tenebrosa_nvec76000030 KY810200 CACTGCTTAAAGTCCTCATTAT CCTGTGCGTTCTCATGTA 604 A.tenebrosa_tadh6000210 KY810199 TGATGTCCAAAATACTGATGC CCCTTGTCGATTGATAAAGTAT 648 E.pallida_nvec141000032_1 KY810207 TCCGACTAGGCGAAATTAAA GTTCTTTATTCATGTTTGATGTG 582 E.pallida_nvec141000032_2 KY810209 TATACAAAGAAATCCTCAAGAGA TTAGGTGGTCGATAGTGATG 564 E.pallida_nvec141000032_3 KY810211 CCTGGTTTGCCATATTGATTG AAGATTCTTACATATGACAAGTGG 614 E.pallida_nvec3000224 KY810205 CTGATAGAGAAGTGACGAGAT CGATACCGCTGAACATCAAT 580 E.pallida_nvec42000019_1 KY810204 ACCAACAATCTTCATTGAACT TAGCCATAGATTTTACGTGGA 610 E.pallida_nvec42000019_2 KY810212 TTAATTTGAAGTCTTTCGTGAAG AATTAGACTTTGGCTTTGAGC 590 E.pallida_nvec7000121 KY810208 TAAAATCGTTCACACATCGTT GCTATTCGTACGAGAATGAAA 620 E.pallida_tadh6000210_1 KY810206 TAGGTGTACTGGGAATTTGAT GACAGTAGGTAAAGCAAGAAG 544 E.pallida_tadh6000210_2 KY810210 TGAAGCAATAAGCAGTTCCC CTAAAAAGAGATGTGATTGGCT 555

66 Appendices

Supplementary Table 2.3: Trinity De novo assembled transcriptome statistics for quality check analysis. Abbreviations: n/a, Not Applicable.

Genus Species Accession Number

N50 No. Genes

No. Transcripts

CEGMA Score

BUSCO %

Accession Citation

Actinia tenebrosa SRX1604071 1,995 92,938 114,252 239 97.0 Van Der Burg et al., 2016 Actinia tenebrosa PRJNA350366 1,256 165,401 221,845 241 97.7 n/a Acropora digitifera PRJNA309168 1,160 101,721 133,920 236 93.8 Mohamed et al., 2016 Alatina alata SRX978662 1,044 121,034 141,973 231 91.4 n/a Anthopleura buddemeieri SRX1604661 1,034 150,702 212,774 220 94.6 Van Der Burg et al., 2016 Aulactinia verata SRX1614867 1,333 132,909 174,203 237 97.2 Van Der Burg et al., 2016 Aurelia aurita PRJNA252562 932 99,240 132,259 236 97.1 Brekhman et al 2015 Calliactis polypus SRX1614869 1,516 118,290 146,659 236 96.9 Van Der Burg et al., 2016 Chironex fleckeri SRX891607 1,377 46,983 51,149 200 74.7 n/a Corallium rubrum SRX675792 n/a n/a n/a 244 97.4 Pratlong et al., 2015 Exaiptasia pallida PRJNA261862 1,449 163,275 192,450 245 97.4 Baumgarten et al., 2015 Hydractinia polyclina SRX315374 1,300 135,939 159,235 242 95.8 n/a Nemanthus annamensis SRX1634628 1,699 72,505 88,325 242 97.3 Van Der Burg et al., 2016 Nematostella vectensis PRJEB13676 1,033 301,047 369,434 232 86.8 Babonis et al., 2016 Nematostella vectensis PRJNA213177 1,255 133,272 153,212 222 96.5 n/a Protopalythoa variabilis SRX978667 1,094 118,609 131,993 222 88.9 n/a

67 Appendices

Supplementary Table 2.4. Results of data interrogation for genome and transcriptome datasets. Details represent additional information for individual candidate cnidarian globin genes.

Candidate gene nomenclature referenced from OrthoMCL results detailed in Supplementary Table 2.4.

Species and Candidate Count

Dataset Accession Number

Candidate ID Details

Cnidaria

Acropora digitifera (3) Genome GCA_000222465.2 A.digitifera_micrACO65508 Genome GCA_000222465.2 A.digitifera_nvec141000032_1 Genome GCA_000222465.2 A.digitifera_nvec141000032_2 Hydra vulgaris (4) Genome XM_012702974 H.vulgaris_drerENSDARP00000045749 Genome XM_012711718 H.vulgaris_nvec50000067 Genome XM_004209707 H.vulgaris_tnigENSTNIP00000020604_1 Genome XM_004206290 H.vulgaris_tnigENSTNIP00000020604_2 Nematostella vectensis (9) Genome XM_001629427 N.vectensis_nvec141000032 Genome XM_001641595 N.vectensis_nvec3000224 Genome XM_001636028 N.vectensis_nvec42000018 Genome XM_001636029 N.vectensis_nvec42000019 Genome XM_001635585 N.vectensis_nvec46000041 Genome XM_001635260 N.vectensis_nvec50000067 Genome XM_001640935 N.vectensis_nvec5000153 Genome XM_001640512 N.vectensis_nvec7000121 Genome XM_001633077 N.vectensis_nvec76000030 Acropora digitifera (5) Transcriptome PRJNA309168 A.digitifera_micrACO65508 Transcriptome PRJNA309168 A.digitifera_nvec141000032_1 Transcriptome PRJNA309168 A.digitifera_nvec141000032_2 Transcriptome PRJNA309168 A.digitifera_nvec42000019 Incomplete ORF; Full globin

domain Transcriptome PRJNA309168 A.digitifera_nvec76000030 Actinia tenebrosa (7) Transcriptome SRX1604071 A.tenebrosa_nvec141000032_1 Transcriptome SRX1604071 A.tenebrosa_nvec141000032_2 Transcriptome SRX1604071 A.tenebrosa_nvec3000224 Transcriptome SRX1604071 A.tenebrosa_nvec42000019

68 Appendices

Transcriptome SRX1604071 A.tenebrosa_nvec7000121 Transcriptome SRX1604071 A.tenebrosa_nvec76000030 Transcriptome SRX1604071 A.tenebrosa_tadh6000210 Alatina alata (1) Transcriptome SRX978662 A.alata_oanaENSOANP00000016790 Tentacle only transcriptome Anthopleura buddemeieri (7) Transcriptome SRX1604661 A.buddemeieri_nvec141000032 Transcriptome SRX1604661 A.buddemeieri_nvec3000224 Transcriptome SRX1604661 A.buddemeieri_nvec42000019 Transcriptome SRX1604661 A.buddemeieri_nvec5000153 Transcriptome SRX1604661 A.buddemeieri_nvec7000121 Transcriptome SRX1604661 A.buddemeieri_nvec76000030 Transcriptome SRX1604661 A.buddemeieri_tadh6000210 Aulactinia veratra (7) Transcriptome SRX1614867 A.veratra_nvec141000032_1 Transcriptome SRX1614867 A.veratra_nvec141000032_2 Transcriptome SRX1614867 A.veratra_nvec3000224 Transcriptome SRX1614867 A.veratra_nvec42000019 Transcriptome SRX1614867 A.veratra_nvec7000121 Transcriptome SRX1614867 A.veratra_nvec76000030 Transcriptome SRX1614867 A.veratra_tadh6000210 Aurelia aurita (5) Transcriptome PRJNA252562 A.aurita_nvec141000032_1 Transcriptome PRJNA252562 A.aurita_nvec141000032_2 Transcriptome PRJNA252562 A.aurita_nvec3000224_1 Transcriptome PRJNA252562 A.aurita_nvec3000224_2 Transcriptome PRJNA252562 A.aurita_oanaENSOANP00000016790 Calliactis polypus (5) Transcriptome SRX1614869 C.polypus_nvec141000032 Transcriptome SRX1614869 C.polypus_nvec42000019 Transcriptome SRX1614869 C.polypus_nvec7000121 Transcriptome SRX1614869 C.polypus_nvec76000030 Incomplete ORF; Full globin

domain Transcriptome SRX1614869 C.polypus_tadh6000210 Chironex fleckeri (1) Transcriptome SRX891607 C.fleckeri_nvec7000121 Tentacle only transcriptome Corallium rubrum (3) Transcriptome SRX675792 C.rubrum_nvec141000032_1 Transcriptome SRX675792 C.rubrum_nvec141000032_2 Transcriptome SRX675792 C.rubrum_nvec7000121

69 Appendices

Exaiptasia pallida (9) Transcriptome PRJNA261862 E.pallida_nvec141000032_1 Transcriptome PRJNA261862 E.pallida_nvec141000032_2 Transcriptome PRJNA261862 E.pallida_nvec141000032_3 Transcriptome PRJNA261862 E.pallida_nvec3000224 Transcriptome PRJNA261862 E.pallida_nvec42000019_1 Transcriptome PRJNA261862 E.pallida_nvec42000019_2 Transcriptome PRJNA261862 E.pallida_nvec7000121 Transcriptome PRJNA261862 E.pallida_tadh6000210_1 Transcriptome PRJNA261862 E.pallida_tadh6000210_2 Hydractinia polyclina (4) Transcriptome SRX315374 H.polyclina_mdomENSODP00000006771 Transcriptome SRX315374 H.polyclina_phumPHUM323880 Transcriptome SRX315374 H.polyclina_tadh6000210 Transcriptome SRX315374 H.polyclina_trubENSTRU00000033639 Nemanthus annamensis (8) Transcriptome SRX1634628 N.annamensis_nvec141000032 Transcriptome SRX1634628 N.annamensis_nvec141000032 Transcriptome SRX1634628 N.annamensis_nvec141000032 Transcriptome SRX1634628 N.annamensis_nvec42000019 Transcriptome SRX1634628 N.annamensis_nvec7000121 Transcriptome SRX1634628 N.annamensis_nvec76000030 Transcriptome SRX1634628 N.annamensis_tadh6000210 Transcriptome SRX1634628 N.annamensis_tadh6000210 Nematostella vectensis (10) Transcriptome PRJNA213177 N.vectensis_nvec141000032 Transcriptome PRJNA213177 N.vectensis_nvec3000224 Transcriptome PRJNA213177 N.vectensis_nvec42000018 Transcriptome PRJNA213177 N.vectensis_nvec42000019 Transcriptome PRJNA213177 N.vectensis_nvec46000041 Transcriptome PRJNA213177 N.vectensis_nvec50000067 Transcriptome PRJNA213177 N.vectensis_nvec5000153 Transcriptome PRJNA213177 N.vectensis_nvec7000121 Transcriptome PRJNA213177 N.vectensis_nvec76000030 Transcriptome PRJNA213177 N.vectensis_tadh6000210 Protopalythoa variabilis (2) Transcriptome SRX978667 P.variabilis_micrACO65508 Transcriptome SRX978667 P.variabilis_tadh6000210

70 Appendices

Ctenophora

Mnemiopsis leidyi (1) Genome GCA_000226015.1 M.leidyi_micrACO65508

Placozoa

Trichoplax adhaerens (5) Genome GCA_000150275.1 T.adhaerens_tadh3000908 Genome GCA_000150275.1 T.adhaerens_tadh3000909 Genome GCA_000150275.1 T.adhaerens_tadh6000210 Genome GCA_000150275.1 T.adhaerens_tadh42000020 Genome GCA_000150275.1 T.adhaerens_tadh12000183

Porifera

Amphimedon queenslandica (1)

Genome GCA_000090795.1 A.queenslandica_nvec7000121

71 Appendices

Supplementary Table 2.5: Synonymous and nonsynonymous mutations identified in validated transcriptome contigs for E. pallida species. Abbreviations: Syn, Synonymous; Non-syn, Non-

synonymous; n/a, Not Applicable.

Ortholog Reference ID Syn Count

Non-syn Count

Non-syn Nucleotide position

Non-syn Nucleotide Change

Non-syn Amino Acid Change

E.pallida_nvec141000032_1 2 1 47 G/A R/K E.pallida_nvec141000032_2 2 0 n/a n/a n/a E.pallida_nvec141000032_3 2 0 n/a n/a n/a E.pallida_nvec3000224 1 0 n/a n/a n/a E.pallida_nvec42000019_1 5 2 223; 369 A/T; A/T T/S; E/D E.pallida_nvec42000019_2 3 1 242 G/A S/N E.pallida_nvec7000121 5 0 n/a n/a n/a E.pallida_tadh6000210_1 0 2 7;38 A/C; C/T S/R; A/V E.pallida_tadh6000210_2 4 0 n/a n/a n/a

72 Appendices

Supplementary Table 2.6: Intron-exon structure analysis of nine E. pallida globin genes. Gene, exon and intron lengths are given as nucleotide counts. N/A used to identify introns with large

blocks of ambiguous nucleotides, thus true length of intron could not be determined. Abbreviations: forward, F; reverse, R.

Ortholog Reference

Scaffold Reference

Alignment Direction

Gene Length Exon 1

Intron 1 Exon 2

Intron 2 Exon 3

nvec141000032_1 18385412 F 516 143 219 226 795 147 nvec141000032_2 18385412 F 513 146 1366 226 537 141 nvec141000032_3 18385051 F 558 159 1437 225 343 174 nvec3000224 18385051 R 543 173 911 226 146 144 nvec42000019_1 18387879 F 546 173 2619 217 N/A 156 nvec42000019_2 18387879 F 534 170 N/A 217 N/A 147 nvec7000121 18385098 R 528 155 980 226 470 147 tadh6000210_1 18388191 F 498 161 1076 208 719 129 tadh6000210_2 18385444 R 486 146 N/A 205 260 135

73 Appendices

Supplementary Figure 2.1: Cladogram overview of phylogenetic relationships for early-diverging species, phylum Cnidaria derived from mitochondrial (Rodríguez et al., 2014) and genomic (Zapata et

al., 2015) genes. Red, light green and pink highlighting represents the three most studied Superfamilies of Actiniaria; Actinioidea, Metridioidea and Edwardsioidea, respectively. Candidate

cnidarian globin gene copy number in brackets after species name. Abbreviations: O, Order; C, Class.

75 Appendices

Supplementary Figure 2.2: Maximum Likelihood phylogenetic tree of identified candidate cnidarian globin genes in transcriptomes of cnidarian species, with supported Bayesian posterior probabilities.

Model and non-model representations of vertebrate globin genes, cnidarian classes Anthozoa, Cubozoa, Hydrozoa and Scyphozoa, with S. minutum as the outgroup. Phylogenetic values shown as

maximum likelihood bootstrap support (0-100)/Bayesian posterior probabilities (0-1.0).

76 Appendices

Supplementary Figure 3.1: Maximum Likelihood bootstrap phylogenetic tree of identified candidate cnidarian globin genes in transcriptomes of cnidarian species, with supported Bayesian posterior

probabilities. Blue dots represent gene duplication events within Actiniaria taxa. Red brackets represent individual gene duplication events within specific species. Phylogenetic values shown as maximum likelihood bootstrap support (0-100)/Bayesian posterior probabilities (0-1.0). Bootstrap

values < 50 and posterior probabilities < 0.5 shown with a ~ symbol and nodes not identical between each method shown with a - symbol. Collapsed clades represent sequences with the corresponding

ortholog reference gene nomenclature as referenced in Appendix A: Supplementary Table 2.3 (expanded clades shown in Appendix A: Supplementary Figure 2.2).

77 Appendices

characterisation and evolution of globin like genes … · 2018. 3. 1. · ii characterisation and...

Documents