51

Chapter 4

Establishment of in vitro hepatotoxicity model

4.1 Introduction

Various toxicants have been used to establish the hepatocyte damage model

like CCl4, tert-butyl hydrogen peroxide, APAP, etc., however, once-popular industrial

chemical CCl4 does not occur naturally and now strictly regulated in many countries.

Today, the scientific database on the effects of haloalkanes is so vast that it is no

longer employed for such purposes, although it is used only as a model of

experimental liver injury. On the contrary, APAP is a widely used hepatotoxicant for

establishment of hepatotoxicity as a clinically relevant model to study the

hepatoprotective effect of phytoextracts (Chen et al. 2012). APAP is an analgesic and

antipyretic drug known to cause hepatotoxicity in experimental animals and humans

doses above recommended (Gyamlani & Parikh 2002). A mechanistic insight into the

pathophysiology of APAP-induced liver injury involves the cascade of destruction

(Figure 2.1) including injury to parenchymal cells leading to formation of reactive

metabolites, GSH depletion, mitochondrial membrane damage and protein-metabolite

adduct formation, which leads to extensive necrosis (Hinson et al. 2010; Jaeschke et

al. 2002).

Oxidative stress is postulated to be important in the propagation of APAP

induced toxicity (Chen et al. 2012). APAP gets converted to its metabolically active

form NAPQI, which reacts very rapidly with GSH and gets detoxified (Figure 2.2).

With depletion of GSH, which is the cofactor for GSH-Px, a major mechanism of

52

peroxide detoxification, is compromised that leads to increase in intracellular

peroxide levels and increased oxidative stress via a Fenton mechanism. Fenton

reaction involves the reduction of peroxide by ferrous ions forming the highly reactive

hydroxyl radical which may in turn oxidize lipids leading to initiation of lipid

peroxidation as well as oxidation of proteins and nucleic acids. Further, it has been

reported that oxidative stress occurs in the liver following a toxic dose of APAP, and

that the site of oxidative stress correlates with site of the toxicity (Hinson et al. 1998),

and only the cells that undergo necrotic changes contain APAP-protein adducts

(Roberts et al. 1991) consistent with a hypothesis that reactive oxygen and nitrogen

species are critical for development of APAP toxicity. By each mechanism, it is

envisioned that increased superoxide production is a critical event.

To study the effect of phytoextract for protection against APAP-induced

toxicity, initial stages of cellular toxicity are most relevant in vitro as HepG2 cell line

is a cellular model that mimic parenchyma cells of human liver. Various

concentrations of APAP were evaluated to establish the toxicity model. The

assessment of hepatocyte dysfunction includes cytotoxicity assessment by MTT

assay, various biochemical parameters namely AST, ALT, GGT and ALP as the

indices of hepatic injury. Various antioxidant defence mechanisms operates within the

hepatocytes as excessive generation of ROS play a central role in APAP toxicity that

can be studied to evaluate the extent of injury and following reversal by the

phytoextract. However, in the current study, the generation of ROS was detected

directly by employing a sensitive and automated flow cytometric technique using an

intracellular dye DCFDA. Further, the cell cycle analysis was performed to evaluate

the effect of APAP on different phases of cell cycle and monitor the level of apoptosis

occurring as a consequence of APAP toxicity. This work was also performed

employing flow cytometer involving the use of propidium iodide (PI) as a fluorescent

dye which enters the cell on permeabilization and intercalates within the strands of the

nuclear DNA quantitatively. Besides, the necrosis caused due to APAP induced

hepatocyte injury was visualized by fluorescence imaging using EB/AO staining.

Collectively, all these parameters were evaluated to establish the APAP-

induced hepatotoxicity model on HepG2 cell line.

53

4.2 Materials and methods

4.2.1 Chemicals and reagents

Culture media & solutions

Dulbecco’s minimal essential media (DMEM), Dulbecco’s phosphate buffered saline

(DPBS), fetal bovine serum – South American origin (FBS), dimethyl sulfoxide

(DMSO) and Trypsin – EDTA were purchased from Cell Clone (Mumbai, India).

Antibiotic/antimycotic solution (PenStrep) was purchased from Sigma Aldrich

Corporation (St. Louis, United States).

Dyes and stains

AO, PI, EB dyes and DNase-free RNase A were purchased from Sigma Aldrich

Corporation, (St. Louis, United States); whereas Triton X-100 was purchased from

Fisher Scientific UK Ltd, (Loughborough, United Kingdom) and APAP from S D

Fine-chem (Mumbai, India).

Kits

DCFDA cellular ROS detection kit was purchased from Abcam plc (Cambridge,

United Kingdom). The diagnostic kits of AST, ALT, GGT and ALP were purchased

from Crest Biosystems, (Coral Clinical Systems, Goa, India). Gene Jet RNA

purification kit and Revertaid First Strand cDNA synthesis kit were purchased from

Thermo Fisher Scientific Company (Waltham, United States).

4.2.2 Maintenance of HepG2 cell line

HepG2 cell line obtained as a gift from Regenerative Medicine Lab, Reliance Life

Sciences, Mumbai was grown in 10% FBS in DMEM containing 100 U/mL penicillin

54

and 100 mg/mL streptomycin at 37°C in a humidified CO2 incubator. Cells were

frozen (1-1.5 × 106 cells/ vial) from passage number 25-28 using the freezing medium

(10% DMSO in FBS), which were thawed as per the requirement of the experiments.

HepG2 cell line used for experimentation were within passage numbers 25-29, to

ensure consistency and to avoid time-dependent genotype variation.

4.2.3 Characterization of HepG2 cell line

Morphological observation

Morphological characterization of HepG2 cell line was carried out by seeding (1.5 ×

106 cells) the cells in T75 flask, the cells were observed unstained under Carl-Zeiss

phase-contrast microscope at various magnifications at 80% confluence.

Molecular characterization of HepG2 cell line by PCR of liver-

specific genes

Prior to using HepG2 cell line for establishment of APAP-induced hepatotoxicity

model, molecular characterization was performed to check whether HepG2 cells

expressed hepatic specific genes to validate the cell line. For the experiment, total

RNA was isolated from the cells using the Gene Jet RNA purification kit according to

the manufacturer instructions. To perform cDNA amplification and hybridization

Revertaid First Strand cDNA synthesis kit was used. PCR mix (10x PCR buffer 2.5

µl, 2 mM dNTPs 2.5 µl, 100% DMSO 1.5 µl, 5 u/µl Taq polymerase, water 0.3 µl,

100 ng/µl forward primer 1 µl, 100 ng/µl reverse primer 1µl and c-DNA 3 µl) and

Applied Biosystems® 2720 Thermal Cycler (Lab India) were used to detect the PCR

products of reverse-transcribed cDNA samples according to the manufacturer's

instructions with incubation conditions as shown in Table 4.1. Expressions of human

glyceraldehyde-3-phosphate dehydrogenase (GAPDH) – a housekeeping gene,

transthyretin (TTR), albumin (ALB), alpha-fetoprotein (AFP), alpha-1-antitrypsin

(AAT) and glucose-6-phosphate dehydrogenase (G6P) mRNAs were determined by

55

using specific primers and separated on 1% agarose gel using horizontal gel

electrophoresis (Technosource Pvt. Ltd.).

Table 4.1 PCR conditions for molecular characterization of HepG2 cell line

Gene PCR

condition

(°C)

Primer sequence

(5 ꞌ-3ꞌ)

Product

size

(bp)

Reference

*GAPDH 94, 58, 68 FP:5-CGGAGTCAACGGATTTGGTCGTAT-3ꞌ

RP:5-AGC CTT CTC CAT GGT GGT-3ꞌ

307 (Khanjani

et al. 2014)

TAT 94, 60, 70 FP:5’TGAGCAGTCTGTCCACTGCCT3ꞌ

RP:5’ATGTGAATGAGGAGGATCTGAG3ꞌ

358 (Chen et al.

2007)

TTR 94, 60, 70 FP:5’GGTGAATCCAAGTGTCCTCTGAT3ꞌ

RP:5’GTGACGACAGCCGTGGTGGAA3ꞌ

352 (Pan et al.

2008)

ALB 94, 60, 70 FP:5’CCTTGGTGTTGATTGCCTTTGCTC3ꞌ

RP:5’CATCACATCAACCTCTGGTCTCACC3ꞌ

308 (Pan et al.

2008)

HNF4α 94, 50, 72 FP:5’CCAAGTACATCCCAGCTTTC3ꞌ

RP:5’CTTTGACCCAGATGCCAA3ꞌ

295 (Chen et al.

2010)

AFP 94, 55, 72 FP:5’TGAAATGACTCCAGTAAACCC3ꞌ

RP:5’AATGAGAAACTCTTGCTTCATC3ꞌ

199 (Pan et al.

2008)

AAT 94, 58, 72 FP:5’TCGCTACAGCCTTTGCAATG-3ꞌ

RP:5’TTGAGGGTACGGAGGAGTTCC-3ꞌ

142 (Song et al.

2009)

G6P 94, 52, 72 FP:5’TCAGCTCAGGTGGTCCTCTT3ꞌ

RP:5’CCTCCTTAGGCAGCCTTCTT3 ꞌ

291 (Chen et al.

2007)

*GAPDH – a house keeping gene was used as an internal control

4.2.4 Establishment of hepatotoxicity model on HepG2 cell line

Determination of APAP toxicity

Before establishment of the model, the seeding density of HepG2 cells was

determined. 200 µL HepG2 cell suspension (5 × 103, 1 ×104 and 5 × 104 cells/well)

56

were seeded in 96-well plates and the plates were incubated for 24 h at 37°C. At the

end of incubation period, 20 μL MTT solution (0.5 mg/mL in PBS) was added to each

well and incubated for 4 h. The supernatant was removed, 150 μL DMSO was added

to each well and kept on shaker for 15 min. The plates were incubated for 10 min.

Optical densities were measured in an ELISA plate reader at 570 nm and 655 nm. The

cell density for the following experiments were selected based on the maximum

reproducibility. Based on results, cytotoxicity of APAP was assessed. 200 µl HepG2

cell suspension (5 x 104 cells/well) was seeded in the 96 well-culture plate in media

containing APAP (2.5 mM – 22.5 mM) prepared in serum free media, for 24 h. After

the treatment, 20 μL of MTT solution was added and incubated for 4 h. Following

incubation, the supernatant was discarded and formazan crystals were dissolved in

100 μL DMSO. The toxicity models were established by measuring the absorbance at

570 nm & 655 nm to determine IC50 values.

Estimation of enzymes for establishment of models

To establish a functional model of hepatotoxicity, assessment of hepatocyte

dysfunction was performed by evaluating the leakage of intracellular enzymes.

Briefly, 1ml HepG2 cell suspension (0.3 × 106 cells/well) was seeded in 24 well plate

for 24 h, and incubated with 20 mM APAP for next 24 h. The supernatant of the

treatment was collected in sterile vials and stored at -20°C till used for estimation of

AST, ALT, ALP and GGT. The non-treated cell control was maintained for all the

enzymes.

Detection of morphological changes related to APAP-induced

hepatotoxicity by AO/EB fluorescent staining

To observe the necrotic damage to hepatocytes associated with APAP induced

hepatotoxicity, AO/EB staining was performed. 3 ml HepG2 cell suspension (1.5 ×

106 cells/well) were grown in 35 mm dish for 24 h and treated with 200 µl APAP (20

mM). After 24 h, the media was removed and the cells were washed with 1x DPBS in

the culture dish. EB dye (100 μg/ml) and AO dye (100 μg/ml) mixed 1:1 were added

to cells and observed under fluorescent microscope for morphological examination.

57

Detection of intracellular ROS

Intracellular ROS was detected by means of an oxidation-sensitive fluorescent probe

DCFDA. For analysis, the cells grown in 35 mm dish (1.5 × 106 cells/well) were

treated with 20 mM APAP as described earlier. The medium was removed, the cells

were washed with 1x DPBS and trypsinized. Next, the cells were incubated with 20

µM DCFDA at room temperature for 1 h and the events were recorded by measuring

fluorescent intensity in FACScan flow cytometer (BD Biosciences, San Jose, United

States).

Cell cycle analysis

Cell cycle analysis was carried out using PI staining solution (0.1% TritonX-100,

10µg/ml PI and 100 µg/ml DNase-free RNase A in DPBS) and analyzed by FACScan

flow cytometer (BD Biosciences, San Jose, United States). For the experiment, the

cells grown in 35 mm dish (1.5 × 106 cells/well) were treated with 20 mM APAP.

Next, the medium was removed, the cells were washed with 1x DPBS and harvested

by trypsinization. The cells were washed with 1x DPBS and fixed with ice-cold 70%

ethanol for 1 h at 4°C. Subsequently, the cells were washed and suspended in PI

staining solution and incubated at room temperature for 1 h before analysis.

4.2.5 Statistical analysis

All the experiments were performed in triplicates and data are expressed as mean ±

standard error. The IC50 value of APAP was obtained by performing regression

analysis of the data points from MTT assay. Student’s paired t-test was employed to

compare the data from control and damaged groups for enzyme analysis, and

detection of ROS. One way ANOVA followed by Bonferroni’s posttest was employed

for cell cycle analysis.

58

4.3 Results

4.3.1 HepG2 cell line maintained morphological

characteristics and expressed hepatic specific genes

HepG2 cell line is an adherent epithelial culture which show cuboidal morphology

under the phase contrast microscope and display a property of growing in clusters

(Figure 4.1 a). The size of the HepG2 cell line is 20 µm consistent with the reported

size (Migita et al. 2010). The cells take approximately 3 days to become 80%

confluent when grown under normal growth culture conditions with the split ratio of

1:3. Molecular characterization of HepG2 cell line demonstrated expression of liver

specific genes; TTR (352 bp), ALB (308 bp), AFP (199 bp), AAT (142 bp) and G6P

(291 bp) genes, validated by the expression of GAPDH (307 bp) – a house keeping

gene (Figure 4.1 b).

4.3.2 20 mM APAP-induced hepatotoxicity on HepG2 cell line

The density of HepG2 cell line in a 96 well culture plate was standardized at 5 × 104

cells/well for 24 h. The lower densities resulted in dispersed growth in the culture

vessel with difference in optical density at 655nm and 570 nm, less than one (Figure

4.2). The toxicity of APAP was determined by MTT assay and it was observed that

APAP showed toxicity on HepG2 cell line from 0.25 mM to 22.5 mM concentrations

(Figure 4.3) with IC50 value of 18.81 mM.. 20 mM APAP toxicity translated in

multiple fold release of AST, ALT, GGT and ALP (Figure 4.2) with significant

difference in release profiles of AST, ALT and ALP between control and damaged

cells (Figure 4.4), establishing the model. Hence, based on this data 20 mM APAP

induced toxicity model was standardized and taken for further study.

59

Figure 4.1 Characterization of HepG2 cell line

(a) morphology of HepG2 cell line under phase-contrast microscope (b) PCR products: lane

1: GeneRulerTM 100bp DNA ladder lane 2: GAPDH (307 bp), lane 3:TTR (352 bp), lane 4:

Albumin (308 bp), lane 5: AFP (199 bp), lane 6: AAT (142 bp), lane 7: G6P (291 bp)

60

Figure 4.2 Cell titration assay: HepG2 cell line

Figure 4.3 Cell viability (MTT assay) of HepG2 cell line exposed to different

concentrations of APAP for 24 h

Table 4.2 AST, ALT, GGT and ALP release profiles of HepG2 cell line exposed

to 20 mM APAP for 24 h

Treatment Dose Levels of liver enzymes (U/L)

AST ALT GGT ALP

Normal 0.58 ± 0.11 1.38 ± 0.07 0.71 ± 0.48 0.55 ± 0.05

Damaged (APAP) 20 mM 8.87 ± 0.46a 8.66 ± 1.27a 4.35 ± 1.73a 4.01 ± 0.4a

Fold release 15 6 6 10

ap < 0.05, when compared to the control within each respective column by student’s paired t-

test.

61

Figure 4.4 Graphical representation of effect of 20 mM APAP-induced toxicity

on release of ASt, ALT, GGT and ALP

**p<0.01, ***p<0.005, analyzed by student’s paired t-test

62

4.3.3 Fluorescence microscopy revealed extensive cellular

damage as a result of APAP-induced toxicity

APAP resulted in extensive cellular damage resulting in DNA fragmentation,

membrane damage and leakage of cellular contents (Figure 4.5). The apoptotic bodies

were also observed.

4.3.4 20 mM APAP-induced toxicity lead to extensive

generation of ROS

The ROS generated in HepG2 cell line upon APAP toxicity was determined by

DCFDA dye. 20 mM APAP leads to the excessive generation of ROS in HepG2 cell

line (Figure 4.6 a & b), from 2.75 ± 0.05% in control cells against 37.35 ± 1.15% in

damaged cells, increasing more than13 folds. This multiple fold increase of ROS

differed significantly from that of control cells (Figure 4.6 c), supporting the

hypothesis that overdose of APAP leads to excessive generation of ROS resulting in

oxidative burst and toxicity within HepG2 cell line.

4.3.5 20 mM APAP-induced toxicity resulted in alteration of cell

cycle pattern

Toxicity caused due to APAP also results in alteration of cell cycle. As depicted in

Figure 4.7 b & c, toxicity of 20 mM APAP resulted in shift in phases of cell cycle

population from reducing 69.13 ± 3.24% cells in G1 phase to 37.65 ± 9.22%, 13.7 ±

0.27% cells in S phase to 10.07 ± 2.63% and 15.03 ± 2.05 from G2/M phase to 6.02 ±

0.19%, however increasing the population in G0 phase from 1.79 ± 1.05% to 45.15 ±

12.12% indicating increase in cell death along with loss of healthy cells.

63

Figure 4.5 AO/EB staining of HepG2 cell line exposed to 20 mM APAP (100×)

(a) Control cells; (b) cells exposed to 20 mM APAP (dotted arrow: DNA fragmentation, plain

arrow: red apoptotic bodies, dotted dashed arrow: cellular leakage)

Figure 4.6 Generation of ROS in HepG2 cell line exposed to 20 mM APAP

(a) Control cells; (b) cells exposed to 20 mM APAP; (c) graphical representation of ROS

generated in control and exposed cells; where ***p<0.005 calculated by student’s paired t-test

64

Figure 4.7 Cell cycle analysis of HepG2 cell line exposed to 20 mM APAP

(a) Control cells; (b) exposed cells (c) graphical representation of cell cycle analysis of

control and damaged cells; where *p<0.05,**p<0.01, ***p<0.001 calculated by two way

ANOVA followed by Bonferroni’s post test

65

4.4 Discussion

The HepG2 cell line was characterized for expression of various hepatocyte

specific functions to establish identity and stability and the molecular characterization

revealed that the results were consistent with the function of hepatocytes. HepG2 cell

line expressed mRNA for TTR (Costa et al. 1989) and albumin, the proteins secreted

by hepatocytes. AFP mRNA expressed by HepG2 cell line synthesizes a 65 kDa

glycoprotein while AAT expressed is an acute phase protein, the primary functions of

which is to protect the lungs from damage by the enzyme elastase. Besides its role as

a glycolytic enzyme, mammalian G6P secreted by hepatocytes, expressed in HepG2

cell line, function as a tumor-secreted cytokine and an angiogenic factor that

stimulates endothelial cell motility. Lastly, used as an internal control, GAPDH is a

"housekeeping gene", the product is well known as one of the key enzymes involved

in glycolysis catalyzing an important energy-yielding step in carbohydrate

metabolism. The expression of these genes by HepG2 cell line complemented with its

morphological appearance of cuboidal epithelium-typical of hepatocytes,

characterized the cell line for its molecular and morphological abilities to represent

the functional hepatocytes in vitro. The HepG2 cell line was further used to establish

the toxicity model of APAP. Acetaminophen gained widespread popularity in the

1960s as a less toxic, analgesic antipyretic agent than aspirin. Ironically,

acetaminophen is now the second leading cause of toxic drug ingestions in the United

States (Gyamlani & Parikh 2002) and a commonest drug taken in overdose in the

United Kingdom, accounting for 48% of all poisoning admissions to hospital and an

estimated 100–200 deaths per year (Wallace et al. 2002), thus the toxic effects of

APAP on liver have been known for years and been studied extensively (Saito et al.

2010; Lee et al. 2012).

Furthermore, APAP treatment has been used as a model to induce fatty liver for

studying possible interacting effects of a compound or a treatment. The effects of

APAP on hepatocytes, depending on dose and exposure time, are manifested

histologically as centrilobular necrosis that can be fatal. Hepatic necrosis of the liver

is a multi-factorial phenomenon thought to be caused by impairment of cellular

66

membrane, excessive generation of ROS, impaired synthesis or depletion of GSH

further elevating oxidative stress. It is well known that APAP is converted by

cytochrome P450 mixed function oxygenases in smooth endoplasmic reticulum of

liver into toxic metabolite, mainly NAPQI (Jaeschke et al. 2002). It is also due to the

toxic effects of reactive radicals NAPQI formed under the action of CYP450 enzyme

system. NAPQI gets detoxified by reduced GSH which gets oxidized. At overdoses,

depletion of GSH results in deleterious sequence of events as a result of excessive

generation of ROS succeeded by DNA fragmentation and necrosis. The metabolic

effects of APAP inside mitochondria have been described and it has been found that

formation of mitochondrial pore is also associated with mitochondrial permeability

transition (Imaeda et al. 2009). However, estimation of the presence or absence of

hepatic dysfunction is complicated by the large functional reserve of the hepatocytes

and its power to regenerate rapidly. Most common liver indices for hepatocyte

damage are levels of AST, AST, ALP and GGT. The enzyme AST is widely reported

in a variety of tissue sources; although the major source of ALT is of hepatic origin

and elevated levels are associated with hepatitis, cirrhosis, and obstructive jaundice.

Most of the ALP in normal adult’s serum is from the liver or biliary tract. The leakage

of these enzymes is indicative of cellular damage and loss of functional integrity of

cell membrane in liver. GGT one of a large group of enzymes known as peptidases

catalyzes the transfer of gamma glutamyl groups from peptides or peptide like

compounds to an acceptor peptide molecule. Although renal tissue has the highest

level of GGT, the major source of the enzyme present in serum is of hepatic origin.

Elevated levels of AST, ALT and GGT in association with ALP successfully

established the toxicity model. The results of biochemical parameters analysed by

student’s paired t-test, illustrated the alteration of enzyme levels in APAP treated

cells, indicative of APAP induced damage to the hepatocytes. Table 4.2 shows that

APAP causes a significant increase in AST level from control 0.58 ± 0.11 IU/L to

8.87 ±0.46 IU/L (p<0.005) after APAP intoxication. Further Table 4.2 reveals that

APAP causes a significant increase in ALT level from control 1.38 ± 0.07 IU/L to

8.66 ± 1.27 IU/L (p<0.005) after inducing toxicity. ALP level in the control group

increased from 0.55 ± 0.05 IU/L to 4.01 ± 0.4 IU/L (p<0.01) whereas APAP also

caused an increase in GGT level from control 0.71 ± 0.48 IU/L to 4.35 ± 1.73 IU/L on

toxicity as shown in Table 4.2.

67

Extensive literature is available on APAP induced toxicity models established

on animals using these parameters (Kiran et al. 2012; Tatiya et al. 2012; Gutierrez &

Navarro 2010; Patel et al. 2010; Bairwa et al. 2010; Parameswari et al. 2013; Begum

et al. 2011). These reports show 2-3 fold release of these enzymes to establish the

models. Typically, in Wistar rats, the APAP dose of 3 g/ kg body weight results in 2

fold increase in the levels of these enzymes whereas the HepG2 cell line model was

more sensitive and we could establish the model with release of over 8 fold enzymes,

clinically more relevant. The difference in the expression could be due to the

difference in activity of GSH S- transferase, which is approximately 10 to 20 times

higher in rats than that in humans (Neuwelt et al. 2009). Therefore, active metabolites

produced in vivo in rat are immediately detoxified by GSH conjugation, making the

prediction of drug-induced hepatotoxicity in human more difficult by using either rat

models, which exemplifies the advantage of using cells derived from humans.

A literature survey on HepG2 cell line revealed that, the normal levels of AST

and ALT has been reported (Mostafavi-Pour et al. 2013; Jeong et al. 2013; Pareek et

al. 2013; Naiyer Shahzad 2013) to vary between 10 to 20 U/L whereas, in the current

work, the values range between 0.5 to 1.5 U/L. In depth investigation of these reports

indicates that the major difference lies in the protocol employed. In the current work,

the serum-free medium was used to prepare the APAP stocks which were fed to cells

during the treatment period. This was done majorly to avoid interferences coming

from the serum, as it is known that the serum contains various proteins including

these enzymes which might result in misinterpretation of data. Also, the proteins in

FBS may also bind APAP changing the chemistry further adding to the complexity in

data analysis. However, in the work cited, the media used has been reported to contain

sera along with nutrient medium. The estimated values of AST and ALT, in the media

containing FBS were found to be 9.3 ± 2.5 U/L and 8.5 ± 1.2 U/L respectively which

indicates that FBS contributes to the levels of enzyme estimated. Associating

together, we can say that the excessive release of enzyme resulting in significant

difference from control cells, established a functional model of hepatotoxicity.

Cytological assessment by fluorescent microscopy showed morphological

changes of cell and mode of cell death induced by 20 mM APAP treated HepG2 cell

line compared to control after 24 h. Extensive necrosis characteristic of APAP

68

toxicity was evident in HepG2 cell line when stained by AO/EB dual staining method.

The leakage of cellular contents was evident under the fluorescence microscope as a

translucent green cytoplasmic fluid released from cells. The DNA fragmentation,

which as discussed earlier is an important event in APAP toxicity (Figure 2.1) was

also visible, as bright green fluorescent circular structures against green cytoplasm

within the cells as early signs of apoptosis. Along with necrotic damage, late

apoptosis was observed as orange and red stained bodies (Agarwala, et al. 2013).

Thus, cytotoxicity measured by MTT assay together with AO/EB dual staining, was

in agreement with earlier reports on cytotoxicity assessments.

Further, Figure 4.6 shows that 20 mM APAP caused a significant increase in

ROS level in HepG2 cell line from control 2.75 ± 0.05% to 37.35 ± 1.15% upon

toxicity (p<0.005) to almost 15 times in 24 h. The MPT that occurs on APAP toxicity,

leads to formation of O2.- resulting in formation of peroxynitrite and tyrosine nitration

(Ben-Shachar et al. 2012). The toxicity of APAP in overdose has been shown to be

initiated by increased formation of NAPQI which depletes cellular GSH (Kucera et al.

2012), the absence of which render the cell remarkably susceptible to oxidative stress

(Bessems & Vermeulen 2001; James et al. 2003). Detoxification of peroxides by

GSH-Px, a major mechanism of peroxide detoxification is also compromised under

such conditions; leading to further increase in intracellular peroxide levels and

increased oxidative stress via Fenton mechanism (Hinson et al. 2010). Thus, in view

of the hypothesis that increased ROS production is a critical event, generation of

cellular ROS was estimated and excessive generation of ROS on 20 mM APAP

toxicity detected by flow cytometer testified the stated hypothesis.

DNA synthesis, mitosis, and cytokinesis are important cellular processes

required for cell division and the maintenance of cellular homeostasis; they are

governed by many extra- and intra-cellular stimuli. Progression of normal cell

division depends on cyclin interaction with cyclin-dependent kinases (Cdk) and the

degradation of cyclins before chromosomal segregation through ubiquitination.

Multiple checkpoints exist and are conserved in the cell cycle in higher eukaryotes to

ensure that if one fails, others will take care of genomic integrity and cell survival.

Many genes act as either positive or negative regulators of checkpoint function

through different kinase cascades, delaying cell cycle progression to repair the DNA

69

lesions and breaks, and assuring equal segregation of chromosomes to daughter cells

(Alabsi et al. 2012). There are two requirements for successful long-term cell

proliferation. One is that the steps of the chromosome replication–division cycle occur

in a correct and fixed order: deoxyribonucleic acid (DNA) replication (S phase)

always precedes chromosome segregation (mitosis or M phase), followed by cell

division (cytokinesis). The second is that this sequence of chromosomal events

repeats with a period equal to the mass doubling time. The correct sequence of events

is a robust characteristic of the chromosome cycle. If any event is blocked, then

usually none of the following events takes place and cell enters G0 phase or

senescence.

APAP toxicity in HepG2 cell line resulted in alteration of cell cycle. The

normal cell cycle includes G1 phase, S phase, G2 phase and M phase. PI staining

technique used in cell cycle analysis includes intercalation of PI dye in the DNA of

cells quantitatively. At 70-75% confluence, the cells are in their log phase with

maximum cells in G1 phase of cell cycle, followed by S-phase of DNA synthesis and

G2/M phase. As the DNA content is same in G2 and M phase, PI staining cannot

distinguish between the two phases, hence it is additively called G2/M phase. The cell

cycle analysis is carried out using flow cytometer which separates the cells based on

size (forward scatter) and complexity (side scatter). Typically, when cells undergo

apoptotic event, the cells shrink in size, resulting in reduction of its diameter. This

phenomenon is captured using this instrument which gives rise to an extra peak of

smallest cells to the extreme left of other peaks which is labelled G0 phase, which

signifies apoptosis. As is known, APAP toxicity leads to apoptotic death of cells in

HepG2 cultures (Manov et al. 2014), the detection of this phase of cell cycle proved

crucial. Compared to normal cell cycle of HepG2 cell line, the toxicity altered the

phases with 25 times (p<0.005) increase in the apoptotic event of total cell population

also altering other phases demonstrating the effect APAP generated on cell cycle.

Combining all the data of various parameters analysed, a functional

hepatotoxicity model was establish using APAP.