chapter 2 materials & methods -...

Chapter 2p

MATERIALS & METHODS

Materials and Methods

48

2.1. Chemicals and reagents

Chemicals and reagents used for the present study were purchased from the following

companies as per details given below.

Sigma-Aldrich, Missouri, USA

Dimethyl Sulfoxide (DMSO), N, N, N′, N′-Tetramethylethylenediamine (TEMED),

Acrylamide, N, N′- Methylenebisacrylamide, Ammonium Persulphate (APS), TRIZMA

Base, Glycine, Sodium Dodecyl Sulfate (SDS), Coomassie Brilliant Blue (CBB) R-250,

Coomassie Brilliant Blue (CBB) G-250, Ethylenediaminetetraacetic Acid, Sodium Salt

(EDTA), Triton X-100, Ethidium Bromide, Agarose, Phenylmethylsulfonyl Fluoride

(PMSF), Polyoxyethylenesorbitan Monolaurate (Tween 20), Bovine Serum Albumin

(BSA, fraction V), Phenol, 8-Hydroxyquinoline, HSRT100 Enhanced Avian HS RT-

PCR Kit, RNase A, GenElute HP Plasmid Midi Prep Kit, SigmaSpin Post-Reaction

Clean-Up Columns, 2-Mercaptoethanol, Bromophenol Blue (BPB), Sodium Acetate,

Sucrose, Ponceau Red S Solution, Taq DNA polymerase, PCR primers,

Deoxyribonucleotide 5′-Triphosphate (dNTP), 10X PCR Buffer, Mineral Oil, 1-anilino

8-naphthalene sulfonic acid (ANS), guanidine hydrochloride (Gdn-HCl), Urea,

Potassium Iodide, Cesium Chloride, Sodium dihydrogen phosphate Monohydrate, di-

sodium hydrogen phosphate Dihydrate, Nickel (II) sulphate hexahydrate, Magnesium

chloride anhydrous, Imidazole, Isopropyl β-D-1-thiogalactopyranoside (IPTG),

Ampicillin sodium salt, Kanamycin sulphate and molecular size standards for size

exclusion chromatography.

GIBCO Life Technologies, USA

Sodium Bicarbonate, Dithiothreitol (DTT), 3-[N-Morpholino] propanesulfonic acid

(MOPS) and Phenylmethylsulfonyl Fluoride (PMSF).


49

MERCK, India

Methanol, Isopropanol, Ethanol, Acetic Acid, Hydrochloric Acid, Sulphuric Acid,

ortho-Phosphoric acid, Hydrogen Peroxide (30%), Chloroform, Isoamyl Alcohol,

Formaldehyde (35%), Sodium Hydroxide, Sodium Carbonate, Agar, Ammonium

Acetate, Disodium Hydrogen Phosphate 2-Hydrate, Potassium Dihydrogen Phosphate-

2-Hydrate, Potassium Chloride, Sodium Citrate, Magnesium Chloride, Sodium

Chloride, Magnesium Acetate, Glycerol, Sodium Dihydrogen Phosphate-2-Hydrate,

Calcium Chloride Fused, Sodium Chloride, Absolute Ethanol, Sodium Thiosulfate,

Potassium Hydrogen Phosphate and Glycerol.

MP Biomedicals, Inc, USA

L-Arginine Free Base, Ethanolamine, Glutathione Oxidized Hydrate and Glutathione

Reduced.

Roche Molecular Biochemicals, Indiana, USA

BM Chemiluminescence Western Blotting Kit (Mouse/Rabbit).

QIAGEN, Hilden, Germany

MinElute Gel Extraction Kit, MinElute PCR Purification Kit, Plasmid Midi Kit and Ni-

NTA agarose.

Novagen, WI, USA

pET Expression System 26b, 28a and RosettaTM

(DE3) Competent Cells.

Konica Minolta, Tokyo, Japan

X-ray films.

Indo-Chem Laboratories, Pune, India

Supreme (X-ray Liquid Developer, High Contrast).

Fermentas International Inc., Ontario, Canada

Restriction Enzymes and O'GeneRuler 1 Kb DNA Ladder.


50

New England Biolabs, Massachusetts, USA

Restriction Enzymes and Prestained Broad Range Protein Marker.

Bangalore Genei (BG), Bengaluru, India

Restriction Enzymes, Genei Protein Estimation Kit (by Bradford method), Protein

Molecular Weight Marker (14-97 kDa), 100 bp DNA Ladder, 1Kb DNA Ladder and

500 bp DNA Ladder.

Promega Corporation, Wisconsin, USA

Rabbit Reticulocyte Lysate (nuclease treated), pGEM®-T easy Vector System and T4

DNA ligase.

Stratagene, California, USA

PfuUltraTM

High-Fidelity DNA Polymerase.

Millipore Corporation, Massachusetts, USA

Immobilon™-NC HAHY Membrane, Millex-HV Filter Unit and Millex-GV Filter Unit,

Amicon Ultracel- 10K, Ultrafiltration Membranes NMWL: 30,000 and Ultrafiltration

Membranes NMWL: 10,000.

PALL Life Sciences, MI, USA

Nanosep Centrifugal devices 10K and Acrodisc 25 mm Syringe Filter w/ 0.2 µm Sterile.

Tarsons Products Pvt. Ltd., Kolkata, India

General Plasticware.

Borosil Glass Works Ltd., Mumbai, India

General glassware.

HiMedia Laboratories Pvt. Ltd., Mumbai, India

Luria-Bertani Broth, Miller.

MWG Biotech, North Carolina, USA and Ocimum Biosolutions, Hyderabad, India

PCR primers


51

Jena Bioscience GmbH (Germany), Emerald BioSystems, Inc., (WA, USA) and

HAMPTON RESEARCH CORP. (CA, USA).

Solutions for crystal growth.

Antibodies

i) Primary Antibodies

Cell Signalling Technology, Inc. MA, USA

Anti-Phospho-eIF-2α (Ser51) Rabbit polyclonal antibody

Anti-eIF-2α Rabbit Polyclonal Antibody

Santa Cruz Biotechnology, Inc. CA, USA

His-probe (H-15) Rabbit Polyclonal Antibody

ii) Secondary Antibodies

Sigma-Aldrich, USA.

Goat anti-rabbit IgG HRP conjugate.

Roche Molecular Biochemicals (Germany)

Goat anti-rabbit/mouse IgG HRP conjugate (Provided with Western blotting kit).

2.2. Instruments and Softwares

Instruments: Gel Doc XR Gel Documentation System (Bio-Rad Laboratories, California

USA), Technegene Thermal Cycler (Techne Corporation, Minnesota, USA), MyCycler

Thermal Cycler System (Bio-Rad Laboratories, California, USA), Dry Bath, (Advanced

Technologies Corp., Pune, India), ElectraPAGE-100 and ElectraGEL-200, Regulated

Power Supply Units (Techno Source, Mumbai, India), Model HFC 286 HERAfreeze

−86 Basic Freezer, (Kendro Laboratory Products, Hanau, Germany), Vertical Laminar

Air Flow (Microfilt, Pune, India), VorTech Bench Top Mixer (Techne Corporation,

Minnesota, USA), Vestfrost −20 °C Refrigerator (Vestfrost, Esbjerg, Denmark),

Biofuge pico Benchtop Centrifuge (Kendro Laboratory Products, Hanau, Germany),


52

Model 3700, Compact High Speed Refrigerated Centrifuge (Kubota Corporation,

Osaka, Japan), Orion 3 Star pH Benchtop (Thermo Electron, Massachusetts, USA),

Microwave Oven (Kenstar, India), Shaking Water Bath (Julabo Labortechnik,

Germany) SpinIt Magnetic Stirrer (MultiLab, Chennai, India), Model BL120H,

Electronic Balance (Shimadzu Corporation, Kyoto, Japan), Model CP124S, Analytical

Balance (Sartorius, Germany), Model GM312, Analytical Balance (Sartorius,

Germany), Model 8050, Pharmacia FPLC System (GE healthcare, Inc, UK), Stirred

Ultrafiltration Cell (Millipore Corporation, MA, USA), LS-50B Spectroflurometer

(PerkinElmer, MA, USA), FLS920 Spectrometer (Edinburgh Instruments, Livingston,

UK), and Jasco 815-150S Spectropolarimeter connected to a Peltier Type CD/FL Cell

circulating water bath (Jasco, Tokyo, Japan).

Softwares: Quantity One (Bio-Rad Laboratories, California, USA), Microsoft Office

Excel 2003/2007 (Microsoft Corporation, Washington, USA), CDPro

(http://lamar.colostate.edu/~sreeram/CDPro/main.html) and Origin 6.1 (OriginLab

Corporation, MA, USA).

2.3. Experimental Procedures

2.3.1. Reagents and buffers

a) Common reagents and buffers used in DNA work

Ethidium bromide (EtBr, 10 mg/mL)

EtBr 0.2 gm

Distilled Water 20 mL


53

The solution was mixed thoroughly and stored in a dark bottle at 4 °C.

1X TE buffer

Tris-Cl (pH 8.0) 10 mM

EDTA 1 mM

It was sterilized by autoclaving for 20 min at 15 psi on liquid cycle. The solution was

stored at 4 °C.

50X TAE buffer

Tris base 242 gm

Glacial acetic acid 57.1 mL

0.5 M EDTA (pH 8.0) 100 mL

The solution was stored at 4 °C.

6X Loading dye

Bromophenol Blue 0.25%

Xylene Cyanol 0.25%

Glycerol in water 30%


3 M Sodium acetate

Sodium acetate 40.8 gm

Distilled Water 80 mL

The pH was adjusted to 5.2 with acetic acid and the volume was made up to 100 mL

with autoclaved distilled water. The solution was filter sterilized through 0.22 µ


54

membrane and stored at 4 °C.

Composition of buffer P1 (resuspension buffer)

Tris-Cl, pH 8.0 50 mM

EDTA 10 mM

RNAse A 100 µg/mL


Composition of buffer P2 (lysis buffer)

NaOH 200 mM

SDS 1% (w/v)

The solution was stored at room temperature.

Composition of buffer P3 (neutralization buffer)

Potassium acetate 3 M

The pH was adjusted to 5.5 with glacial acetic acid and the solution was stored at 4 °C.

Competent cell preparation (Hanahan, 1983)

Composition of Transformation buffer-1 (Tfb-1)

Potassium acetate 30 mM

Potassium chloride 100 mM

Calcium chloride 10 mM

Glycerol 15%

Manganese chloride 50 mM

The solution was filtered through 0.45 µ membrane and stored at 4 °C.


55

Composition of Tfb-2

MOPS Sodium salt 10 mM

Potassium chloride 10 mM

Calcium chloride 75 mM

Glycerol 15%

The solution was filtered through 0.45 µ membrane and later stored at 4 °C.

Luria-Bertani (LB) broth, Miller

25 gm of LB was dissolved in 1000 mL of distilled water and autoclaved at 121 °C, 15

psi for 20 min. It was stored at room temperature.

LB agar plates

25 gm of LB was dissolved in 1000 mL of distilled water and 20 gm of agar was further

added to it. It was autoclaved at 121 °C, 15 psi for 20 min. Later it was cooled to 60 °C

and plates were poured. LB Ampicillin and LB Kanamycin plates were similarly

prepared by adding respective antibiotics in appropriate concentration to freshly

autoclaved LB agar after it had cooled down to 55-60 °C. Plates were subsequently

stored at 4 °C.

List of antibiotics

Antiboitics Solubility Stock solution Final concentration

Ampicillin Water 100 mg/mL 50-100 µg/mL

Chloramphenicol Ethanol 34 mg/mL 34 µg/mL

Kanamycin Water 30 mg/mL 25-30 µg/mL


56

Primers Primer Sequence (5′ to 3′)

HRI 1.9 kb FP/PCR GGAATTCCATATGCTGGGGGGCAGCGCCG

HRI 1.9 kb FP/PCR GGAATTCCATGGTGGGGGGCAGCGCCG

HRI 1.9 kb FP/PCR TATGTACGAATTCATGCAGGGGGGCAGCGCCG

HRI 1.9 kb RP/PCR CCTGGCTCGAGGGCAGGGAGCTCTCCG

HRI 1.2 kb FP/PCR ATTCCATATGGAGTTTGAAGAGCTCTCCATC

HRI 1.2 kb RP/PCR CCGCTCGAGGAAGAGCTCACTCTGC

eIF2 alpha FP/PCR GGCAATTCCCATGGCGGGTCTAAGTTGTAG

eIF2 alpha RP/PCR CCTTGCTCGAGATCTTCAGCTTTGGCTTCC

b) Common reagents and buffers used in protein work

Protein solubilisation, purification and refolding

Inclusion body solubilisation buffer

Tris HCl 50 mM

NaCl 100 mM

NaN3 0.1 % w/v

Triton X-100 0.5 % v/v

DTT 1.0 mM

PMSF 0.1 mM

Buffers used for Ni-NTA affinity chromatography

Buffer A pH 8.0

Gdn-HCl 6 M

NaH2PO4 0.1 M

Tris HCl (pH 8.0) 0.01 M

pH was adjusted to 8.0 using 1N NaOH.


57

Buffer B pH 8.0

Urea 8 M

NaH2PO4 0.1 M

Tris HCl (pH 8.0) 0.01 M

pH was adjusted to 8.0 using 1N NaOH.

Refolding buffer

Ethanolamine 0.02 M

EDTA 1.0 mM

L-Arginine 0.5 M

Glutathione reduced (GSSH) 5 mM

Glutathione oxidized (GSSG) 0.5 mM

GSSH and GSSG were added after the buffer was chilled to 4 °C.

1X Phosphate buffered saline (PBS) pH 7.4

NaCl 8 gm

KCl 0.2 gm

Na2HPO4 1.44 gm

KH2PO4 0.24 gm

The components were dissolved in 800 mL distilled water and pH was adjusted to 7.4

with 1 N HCl. The final volume was made to 1 litre.


58

In vitro eIF-2α kinase assay

Protein kinase assay mixture

Tris-Cl 20 mM

KCl 40 mM

(CH3COO)2Mg 2 mM

ATP 0.5 mM

Hemin preparation (1 mM)

13.02 mg hemin chloride was dissolved in 1 mL 1 N NaOH. The solution was added

with 1mL of 1 M Tris-HCl (pH-7.5) and 17 mL of ethylene glycol. pH was adjusted to

7.5 using 1 N HCl and final volume was made to 20 mL using ethylene glycol. Solution

was then filter sterilized and stored at -20° C.

PMSF

100 mM PMSF was prepared in isopropanol.

Protein estimation (Bradford, 1976)

Bradford’s reagent (5X)

50 mg of Coomassie Brilliant Blue-G 250 was dissolved in 25 mL of ethanol. 50 mL of

ortho-phosphoric acid was added to it with constant stirring and the volume was made

to 100 mL by adding deionized water in a drop-wise manner. The solution was stored in

dark at 4° C.


59

Chemicals for denaturing polyacrylamide gel electrophoresis (SDS PAGE)

Gel solution

Acrylamide 29.2 gm

Bis-acrylamide 0.8 gm

Distilled water was added to a final volume of 100 mL and the gel solution was filtered

through 0.45 µ membrane. The gel solution was stored in a dark bottle at 4 °C.

1.5 M Tris-Cl, pH 8.8

Tris-Cl 6.05 gm

Distilled water 70 mL

The pH was adjusted to 6.8 with 1N HCl and the volume made up to 100 mL with

distilled water. It was sterilized by autoclaving for 20 min at 15 psi on liquid cycle and

stored at 4 °C.

0.5 M Tris-Cl, pH 6.8

Tris-Cl 6.05 gm


The pH was adjusted to 6.8 with 1N HCl and the volume made up to 100 mL with

distilled water. It was sterilized by autoclaving for 20 min at 15 psi on liquid cycle and

stored at 4 °C.

10% Sodium dodecyl sulphate (SDS)

SDS 10 gm


The volume was made up to 100 mL with autoclaved distilled water and stored at room


60

temperature.

10% Ammonium persulphate (APS)

APS 100 mg

Distilled water 1.0 mL

This solution was prepared fresh before use.

2X Sample buffer (Laemmli, 1970)

0.5 M Tris-Cl pH 6.8 2.5 mL

Glycerol 2.0 mL

10% SDS 4.0 mL

0.05% Bromophenol blue 0.5 mL

β-mercaptoethanol (to be added fresh) 1.0 mL

The solution was stored at -20 °C.

5X Sample buffer (Laemmli, 1970)

0.5 M Tris-Cl pH 6.8 6.25 mL

SDS 1.0 gm

Sucrose 2.0 gm

β-mercaptoethanol 2.5 mL

Bromophenol Blue (BPB) 0.125 % (w/v)

Distilled water 1.25 mL

The solution was stored at -20 °C.


61

5X Tank buffer

Tris-Cl 15 gm

Glycine 72 gm

SDS 5 gm

Dissolved in 1000 mL distilled water and the buffer was stored at room temperature.

1X Tank buffer

5X Tank buffer 200 mL


The buffer was stored at room temperature.

Composition for SDS PAGE

SDS PAGE (Separating gel)

Gel percentage 12% 10% 7.5%

Distilled Water 3.318 mL 3.984 mL 4.818 mL

1.5 M Tris-Cl pH 8.8 2.5 mL 2.5 mL 2.5 mL

10% SDS 0.1 mL 0.1 mL 0.1 mL

30% Gel Solution 4.0 mL 3.333 mL 2.5 mL

TEMED 0.0075 mL 0.0075 mL 0.0075 mL

10% APS 0.075 mL 0.075 mL 0.075 mL

10 mL 10 mL 10 mL


62

SDS PAGE (Stacking gel)

Gel percentage 4%

Distilled Water 5.990 mL


10% SDS 0.1 mL

30% Gel Solution 1.333 mL

TEMED 0.0075 mL

10% APS 0.075 mL

10 mL

Composition for Native Polyacrylamide Gel Electrophoresis (Native PAGE)

Native PAGE (Separating gel)

Gel percentage 8 %

Distilled Water 4.6 mL



TEMED 0.006 mL

10% APS 0.1 mL

10 mL


63

4 % Stacking gel

Gel percentage 4%

Distilled Water 3.05 ml

0.5 M Tris-Cl pH 6.8 1.25 mL


TEMED 0.0075 mL

10% APS 0.038 mL

10 mL

Gel Staining

Coomassie Brilliant Blue- R 250 stain

0.125 % Coomassie Brilliant Blue-R 250 in methanol : Acetic acid : Distilled water

(50:10:40)

Destainer I

Methanol 50 %

Glacial acetic acid 10 %

Distilled water 40 %

Destainer II

Methanol 10 %

Glacial acetic acid 10 %

Distilled water 80 %


64

Gel storage solution

7 % Glacial acetic acid in distilled water

Chemicals for Western blot (Towbin et al., 1979) and chemiluminescence

5X Transfer buffer

Tris-Cl 15 gm

Glycine 72 gm

Dissolved in 500 mL autoclaved distilled water and was stored at 4 °C.

1X Transfer buffer

5X Transfer buffer 300 mL

Methanol 60 mL


The solution was stored 4 °C.

10X Tris-buffered saline (TBS)

Tris-Cl 15.125 gm

Sodium chloride 21.9 gm


The pH was adjusted to 7.5 with 35% HCl and the volume made up to 250 mL with

autoclaved distilled water. Stored at room temperature.

1X Tris-buffered saline (TBS)

10X TBS 10 mL



65

The solution was stored at room temperature.

1X Tris-buffered saline Tween 20 (TBST)

10X TBS 10 mL


Tween 20 100 µl

The solution was mixed thoroughly and stored at room temperature.

Blocking reagent

1 % Blocking reagent (provided in Western blotting kit) in TBST.

5 % BSA in TBST.

Develepor (X-ray liquid developer, high contrast)

Developer 10 mL


The solution was mixed thoroughly and stored at room temperature in a dark bottle.

Detection solution [BM chemiluminescence western blotting kit (mouse/rabbit)]

Substrate Solution A 990 µl

Substrate Solution B 10 µl

The solution was mixed thoroughly and prepared fresh before use.

Fixer

Sodium thiosulphate 20 gm



66

The solution was mixed thoroughly and stored at room temperature in a dark bottle.

Materials used in crystallization studies

The following chemicals were used extensively in crystallization trials: sodium

cacodylate buffer, 3-(N-morpholino) propanesulfonic acid MOPS buffer, N-(2-

ethanesulfonic acid (HEPES) buffer, tri-sodium citrate, lithium sulphate,

polyethylene glycol (PEG 20K, 8K, 4K, 1K), 2-methylpentane 2,4-diol (MPD)

and isopropanol. Multi-well trays used in the crystallization experiments were

purchased from Hampton research and Corning Inc. All chemicals used were of

analytical grade.

2.3.2. Methodology

a) DNA work

Competent cell preparation and transformation

Competent cells [E. coli DH5α, BL21 (DE3) and Rosetta (DE3)] were prepared

according to Hanahan, (1983).

Competent cells were taken from −70 °C and thawed in ice. Appropriate amount

of DNA (10-20 ng) was added into 50 µl of competent cells, mixed and kept on ice for

30 min with intermittent tapping. After 30 min of incubation, cells were given a heat

shock at 42 °C for 90 sec and placed on ice for 2 min. 1 mL LB was added to the tube

and was incubated at 37 °C for 1 h. After incubation, the tube was centrifuged for 5 min

at 3000 rpm. The supernatant was discarded leaving around 100 µl of LB in which the

cells were resuspended and spread plated on LB agar (Ampicillin or Kanamycin) plate.

The plate was incubated at 37 °C for 16 to 18 h. Colonies were screened.


67

Plasmid isolation

Plasmid miniprep was done by alkaline lysis method (Birnboim and Doly,

1979). Bacteria were lysed by treatment with a solution containing 1% sodium dodecyl

sulfate (SDS) and 0.2 N NaOH. The mixture was neutralized with potassium acetate,

causing the covalently closed plasmid DNA to re-anneal rapidly. Most of the

chromosomal DNA and bacterial protein precipitates were removed by centrifugation.

The plasmid DNA from the supernatant was then concentrated by ethanol precipitation

and dissolved in appropriate volume of TE buffer. Plasmid midiprep was done using

GenElute HP Plasmid Midi Prep Kit (Sigma-Aldrich, USA) according to manufacturer's

protocol. DNA was quantified by taking O.D. at 260 and 280 nm. 1 O.D. at 260 nm is

equal to 50 µg/mL of DNA and 260/280 ratio denotes the purity of the plasmid

preparation.

Restriction digestion

All restriction digestions of the plasmids were performed in the appropriate

buffer according to manufacturer’s instructions.

Purification of DNA fragment from agarose gel

The plasmid digested with restriction enzymes was electrophoresed on 0.8 %

agarose gel and the desired fragments were excised and the DNA was eluted and

purified using QIAGEN gel extraction kit.

Plasmid constructs

Rabbit HRI full length (1.9 kb) was PCR amplified using primers 5′-GGAAT

TCCATATGCTGGGGGGCAGCGCCG-3′ and 5′-CCTGGCTCGAGGGCAGGGAGC

TCTCCG-3′ and HRI kinase domain (1.2 kb) was PCR amplified using primers 5′-

ATTCCATATGGAGTTTGAAGAGCTCTCCATC-3′ and 5′-CCGCTCGAGGAAGA


68

GCTCACTCTGC-3′ (Nde1 and Xho1 sites are underlined). Kinase domain of HRI (1.2

kb) was PCR amplified using primers 5′-ATTCCATATGGAGTTTGAAGAGCTCTCC

ATC-3′ and 5′-CCGCTCGAGGAAGAGCTCACTCTGC-3′. The PCR product was

cloned into pET 28a expression vector. Rabbit HRI cDNA cloned in pSP64 was used as

the template (Chen et al., 1991).

Human eIF2α (heIF2α) (945 bp) was PCR amplified using specific primers 5′-

GGCAATTCCCATGGCGGGTCTAAGTTGTAG-3′ and 5′-CCTTGCTCGAGATCTT

CAGC TTTGGCTTCC-3′ (Nco1 and Xho1 sites are underlined) from K562 cDNA and

cloned into the pET 26b expression vector.

PfuUltra High-fidelity DNA polymerase was used for all PCR reactions. The

authenticity of the clones were confirmed by sequencing the DNA.

b) Protein work

Bacterial expression, isolation of inclusion bodies and purification of HRI and

human eIF2α

HRI (full length HRI and HRI catalytic domain) and heIF2α cloned in pET 28a

and pET 26b vectors, respectively, were transformed into Rosetta (DE3) cells for

expression. In brief, a 5 mL culture in LB with 30 µg/mL kanamycin was grown

overnight at 37 °C and 2 mL of this was transferred to 100 mL LB containing 30 µg/mL

kanamycin and grown for 2-3 hours (h) at 37 °C. 5 mL of this 2-3 h grown culture was

then transferred into 500 mL LB-kanamycin (30 µg/mL), grown at 37 °C, and induced

by adding a final concentration of 1 mM IPTG at A600=0.6 O.D. The induced culture

was grown further for 4 h, followed by centrifugation at 8000 rpm at 4 °C, to obtain the

bacterial pellet. Frozen cell pellets (~ 14 g) were gently suspended in 50 mM Tris-HCl

(pH 8.0), 1 mM EDTA (pH 8.0), 0.5 % Triton X-100, 1 mM DTT and 100 mM NaCl,


69

followed by addition of 0.1 mM of PMSF. The cells were lysed by lysozyme (0.3 mg/g

of cell pellet) and the suspension was stirred for 20 min. The suspension was stored at

37 °C till the lysate became clear. To break the DNA in lysate, it was sonicated at 15

pulses of 15 s each keeping the lysate on ice. The samples were centrifuged at 10000 g

for 20 min at 4 °C, and the cell pellet containing inclusion bodies were washed twice

with 50 mM Tris-HCl (pH 8.0), 1 mM EDTA (pH 8.0), 0.5 % Triton X-100 and 100

mM NaCl. The inclusion bodies were solubilized by suspending them in solubilization

buffer (buffer A) (100 mM NaH2PO4, 10 mM Tris HCl pH 8.0 and 6 M Gdn-HCl) and

stirring for 2-3 h at room temperature. The solubilized sample was centrifuged at 4 °C

for 30 min at 11000 rpm. The supernatant obtained was loaded onto a pre-equilibrated

(buffer A) Ni-NTA agarose column (Qiagen) followed by a wash [100 mM NaH2PO4,

10 mM Tris HCl, 8 M urea pH 8.0 (buffer B) containing 25 mM imidazole]. The

affinity bound protein was eluted with buffer B containing 400 mM imidazole.

Classical Size Exclusion Column Chromatography: Size exclusion chromatography

was done using Superose TM

12 Prep grade (GE healthcare, Inc, UK) to evaluate the

oligomeric state of the purified protein. The mobile phase used was 10mM phosphate

buffer containing 145 mM NaCl, pH7.4. The column was calibrated with the following

molecular size standards: carbonic anhydrase (29 kDa), albumin (66 kDa), alcohol

dehydrogenase (150 kDa), β-amylase (200 kDa), apoferritin (443 kDa), and

thyroglobulin (669 kDa). 1mg sample of protein solution was applied to the column.

Refolding of HRI and heIF2α

The purified protein was run on a 10 % SDS-PAGE to check its purity before

initiating refolding. The purified protein was concentrated by ultrafiltration using an

Amicon YM 10 membrane (for heIF2α and HRI kinase domain) or YM 30 membrane

(Millipore) (for full length HRI) up to 4 mL and subjected to DTT reduction (1 mM) for


70

2 h at RT, followed by buffer exchange with 10 mM hydrochloric acid (HCl) containing

6 M urea. The refolding of HRI and heIF2α was carried out by rapid dilution method

(1:50) (White et al., 2004). The refolding buffer contained 0.02 M ethanolamine, 1 mM

EDTA, 0.5 M L-arginine, 5 mM reduced glutathione and 0.5 mM oxidized glutathione

pH 8.0. Refolding was checked at pH 11.0 also. The sample was added drop-wise with

stirring at 4 °C and left static for 36 h. During refolding, the concentration of protein

was 20 µg/mL. The refolded sample was ultrafiltered using the Amicon membranes

(YM 10 or YM 30) and the retentate (10 mL) was centrifuged at 12000 rpm for 20 min

at 4 °C. The supernatant was dialyzed against 1x PBS pH 7.4 followed by centrifugation

at 11000 rpm for 20 min at 4 °C. The supernatant was checked by running it on 10 %

SDS-PAGE. The refolded protein was stored on ice for few days to remove the

unfolded aggregates if any, by centrifugation at 11000 rpm for 20 min at 4 °C and

finally the protein was stored at -70 °C.

Estimation of protein content by Bradford's (micro assay) method

(Bradford, 1976)

Concentrations of the refolded protein samples were determined by using Genei

Protein Estimation Kit. The absorbance of the mixture was measured at 595 nm.

In vitro protein kinase (functional) assay

The in vitro kinase assay was conducted as described previously (Chen et al.,

1989) with some modifications. Briefly, the kinase reaction mixture (20 µl) containing

20 mM Tris-HCl, pH 7.6, 2 mM magnesium acetate, 40 mM KCl, 3 µg (His)6-tagged

heIF2α, 0.5 µg (His)6-tagged HRI and 0.5 mM ATP was incubated at 30 °C for 20 min

under aerobic conditions. After incubation, the reaction was terminated by the addition

of Laemmli sample buffer (Laemmli, 1970) and then heated for 5 min at 95 °C and

subjected to 10% SDS-PAGE. Proteins were electrophoretically transferred onto a


71

nitrocellulose membrane (Towbin et al., 1979). Blot was then processed for

immunoreactions using anti-Phospho-eIF2α (Ser51) antibody and HRP-conjugated

secondary antibody. Blot was developed using the chemiluminescence detection kit, and

the result was analyzed using Bio-Rad gel documentation system (USA).

c) Biophysical studies

Steady-state fluorescence spectroscopy

The intrinsic fluorescence of the protein was analyzed at 30 °C in PerkinElmer

LS-50B spectroflurometer equipped with a thermostatically controlled sample holder.

The protein solution (0.04 mg/mL) was excited at 295 nm and the emission was

recorded in the range of wavelengths 300-400 nm. Both the excitation and emission

spectra were obtained setting the slit width at 7 nm, and scan speed 100 nm min-1

.

Appropriate reaction mixtures (i.e., either buffer alone or buffer with denaturant) were

used for base line correction.

Steady-state fluorescence quenching

Fluorescence measurements were performed for native and 6 M Gdn-HCl

denatured protein with different quenchers like acrylamide (5 M), (neutral quencher),

iodide (5 M) and cesium ions (5 M) (charged quenchers) as described above.

Fluorescence titration was performed by adding small amounts of quencher stock

solutions to the protein sample (0.04 mg/mL) prepared in 50 mM phosphate buffer, pH

7.2. Sodium thiosulfate (0.2 M) was added to the iodide stock solution to prevent the

formation of tri-iodide (I-3

). Relative fluorescence intensities were measured at the

wavelength corresponding to the emission maximum of the protein and volume

correction for fluorescence intensities was done before analyzing the quenching data

(Lakowicz, 1983).


72

Fluorescent life-time spectroscopy

Life-time fluorescence measurements were carried out on an FLS920

spectrometer supplied by Edinburgh Instruments. A picosecond pulsed light emitting

diode (model EPLED-295) of pulse width 747.8 ps and band width 10.4 nm was used

for excitation and a single photon counting photomultiplier was used for detection of

fluorescence. The diluted Ludox solution was used for measuring Instrument Response

Function (IRF). Protein sample at a concentration of 0.1 mg/mL was employed for this

experiment. The sample was excited at 295 nm and emission was recorded at the

emission maxima. Slit widths of 10 nm each were used on the excitation and emission

monochromators. The resultant decay curve was analyzed by a multiexponential

iterative fitting program provided by Edinburgh Instruments.

Hydrophobic dye binding studies

8-Anilino-1-naphthalene sulfonic acid (ANS) emission spectra were recorded in

the range 430-550 nm with excitation at 375 nm using slit widths of 7 nm for emission

and excitation monochromators in a steady-state spectrofluorimeter. The protein

samples (0.01 mg/mL) were incubated for 4 h at pH 7.4 and pH 10 and the fluorescence

spectra were recorded. Since the fluorescence intensity was very high and beyond the

limit of calculation, the protein concentration was reduced to 0.005 mg/mL for pH 2.0

incubated heIF2α. The spectrum of ANS in respective buffers of different pH was

subtracted from the combined protein-ANS spectrum to yield the final spectrum.

Circular dichroism measurements

CD measurements were performed in a Jasco 815-150S (Jasco, Tokyo, Japan)

spectropolarimeter connected to a Peltier Type CD/FL Cell circulating water bath

(Jasco, Tokyo, Japan). Far-UV CD measurements were recorded using 0.1 mg/mL

protein with a 1 mm path length cell. Near-UV measurements were made at 1.0 mg/mL


73

protein concentration with a 10 mm path length cell. Each spectrum was the average of

three scans. To study the effect of denaturants, the protein samples were incubated in 0-

6 M Gdn-HCl. Effect of pH on the secondary structure was studied by incubating the

protein samples in 50 mM buffers in pH range 2.0-10.0. All the incubations were done

for 4 h. The effect of temperature on the protein was studied by two methods. In one

method, the protein samples were incubated at different temperatures ranging from 25

to 90 °C and each scan was independently recorded. In the other method, the

temperature of the protein samples was increased at the rate of 2 °C/min for the

temperature ranging from 25 to 90 °C and the ellipticity was recorded at 210 nm. The

Tm of the protein sample was determined. All data were collected by subtracting the

respective buffer base line.

Crystallization

The first step that is considered crucial in protein structure determination is the

growth of diffraction quality crystals. In the absence of any single concrete theory

behind crystallization, we have treated the protein crystallization as a trial and error

procedure invoking experience and crystallization reports as guiding principles. It is

accepted that the presence of impurities, ionic strength, pH, temperature, precipitating

agent and several unspecified factors play a role in crystallization process.

Among various crystallization techniques known, hanging-drop vapour-

diffusion method is widely adopted and has produced more crystallized proteins than all

other methods combined. This method is simple, consumes less protein and it is easy to

monitor the progress of crystallization. In a typical experimental set up using 24-well

multiwall trays, 1-2 µl of protein solution was placed on a siliconized cover slip, mixed

with 1-2 µl of the precipitant solution and allowed to slowly equilibrate against 500-

1000 µl of reservoir solution of the precipitant. The concentrated solutions of pure


74

protein were prepared in milli-Q water or buffers before setting up crystallization. The

concentration of protein was estimated as described by Bradford (1976). Different

precipitants such as ammonium sulfate, PEGs of different molecular weights, 2-

methylpentane-2, 4-diol (MPD) and isopropanol were commonly tried in the

crystallization experiments and some of them were found effective.

chapter 2 materials & methods -...

Documents