Chapter 2

Materials and Methods

2.1 Plant materials

The wild type Arabidopsis strain (2n=1 0) used in this study is of Columbia

(Col-O) ecotype. The dyad mutation was originally identified in the Landsberg

erecta (Ler) ecotype and later introgressed into the Col-O background by

repeated backcrossing (Siddiqi eta/., 2000). The dyad plants used in the study

were derived from the backcrossed population.

The F2 population used for microsatellite marker analysis was obtained

from a cross between the strain No-0 (Nossen ecotype) and dyad mutant in the

Col-O background as described (Siddiqi eta/., 2000).

GABI-KAT-206-H06 (also referred to as dyad-2): Col-O ecotype having T-DNA

insertion in the third exon of the SW/1/DYAD gene, obtained from GABI-KAT T­

DNA insertion mutant collection (www.gabi-kat.de/).

CS 3900: An autotetraploid (2n=20) Arabidopsis strain (La-er ecotype) obtained

from the Arabidopsis biological resource center (ABRC). It has a transgenic

kanamycin resistance gene in a quadruplex condition (Luca Comai, personal

communication).

ET 60: An enhancer trap line that contains a single copy insertion of the Ds

transposon in the gene At1g73160 of Arabidopsis (Vijayabhaskar and Siddiqi,

unpublished).

The facultatively apomictic diploid Greenland and triploid Colorado accessions of

Boechera holboellii were a kind gift from Dr. Kim Boutilier (Naumova eta/., 2001 ).

2.2 Bacterial strains used in the study

E. coli (DH5a.): supE44L'llacU 169 ( <j>801aczL'lM 15) hsdR 17 recA 1 endA 1 gyrA96

thi-1 reiA1 (Sambrook eta/., 1989).

E.coli (HB101): supE44hsds20(r8 -m8-) recA13 ara-14 proA2 lacY1 gaiK2 rpsl20

xyl-5 mtl-1 (Sambrook eta/., 1989).

Agrobacterium tumefaciens (AGL 1): It carries a hypervirulent, attenuated

tumor-inducing plasmid pTiBo542 from which the T-region DNA sequences have

been precisely deleted, allowing optimal DNA transformation of many

28

dicotyledonous plants. It also carries an insertion in its recA recombination gene,

which stabilizes the recombinant plasmids (Lazo eta/., 1991 ).

2.3 Plant growth conditions

Plants were grown in pots under fluorescent lights (7000 lux at 20 em) at

20°C with a 16 hr light/8 hour dark cycle in a controlled growth cabinet

(CONVIRON). The synthetic medium for growing plants was prepared by mixing

equal proportions of soilrite: perlite: vermiculite (Keltech Energies Ltd., Karnataka

574 108, India). The soil mix in the pots was drenched in 1X Murashige and

Skoog (MS) nutrient solution (prepared in-house as mentioned at the end of the

chapter) till saturation. In case of the pots that were used for plant transformation,

the soil mix was thoroughly covered and confined within a nylon mesh. The

seeds/seedlings were uniformly sprinkled/transplanted respectively in the pots.

For seed stratification, pots containing seeds were covered with Saran wrap and

kept at 4 oc in a cold room for 4 days after which they were shifted to the growth

chamber. In case of seedling transplantation, the pots were directly placed in the

growth chamber. Thereafter, at regular intervals the plants were irrigated with

distilled water.

Boechera plants were grown in pots containing the same medium and

under identical conditions as described for Arabidopsis.

2.4 Seed germination and growth in petriplates

For germinating seeds in MS agar plates, the seeds were surface

sterilized with double distilled ethanol for 10 min followed by treatment with

0.025% mercuric chloride for 5 min. The seeds were then washed three times

with sterile water to remove the traces of mercuric chloride. Sterilized seeds were

suspended in lukewarm 0.5% top agar and evenly spread on the 1 X MS agar

plates. After plating the seeds, the plates were sealed with parafilm and kept in

the cold room (4°C) for seed stratification. After 4 days the plates were

transferred to the growth chamber. Germination frequencies were counted two

weeks thereafter.

29

A. Normal growth medium (NGM): 1X MS salts+ 2% sucrose+ 0.7% agar.

B. Kanamycin selection medium: NGM supplemented with 50 f.lg/ml of

kanamycin.

C. Napthyl acetamide (NAM) selection medium: NGM supplemented with 3.5

f.!M NAM.

The selection phenotypes of the transformants that are positive for kanamycin

and negative for NAM are described in Chapter 4.

D. Hygromycin selection medium: 0.8% bacto agar, 1 mM KN03, 1% sucrose,

and 20 IJg/ml hygromycin. The transformants that are resistant to hygromycin can

be identified as early as 5 days post transfer by virtue of a well elongated root,

erect hypocotyl, and well spread cotyledonary leaves. The selected

transformants were further transferred to a fresh hygromycin selection medium.

After proper growth and establishment, the seedlings were transferred to soil.

2.5 Emasculation and hand pollination

The flower buds from the plant to be used as a female parent were

emasculated the previous day. Only well-developed, unopened flower buds that

were about to flower the next day were emasculated by carefully removing all the

floral whorls except the pistil using a fine forceps (Dupont #5). Care was taken

not to damage the pistil while emasculation. Opened flowers and already

developed siliques in the inflorescence were clipped off to maintain the identity of

the crossed pistil. The following morning 2-3 well-dehisced anthers containing

good pollen load (from the plant that is to be used as a male parent) were

excised from the flower and gently dusted on to the stigma of the emasculated

pistil. Successful hand pollinated pistils would turn pink and elongate after

pollination.

2.6 Seed set analysis

A F2 segregating population harboring a dyad mutation in the Col-O

ecotype background was used for scoring the frequency of seed set in the dyad

homozygous plants. The fertile segregants were culled from the population.

30

Upon cessation of flowering, watering was withheld to allow the siliques to reach

harvest maturity. Meanwhile the lowest siliques that turn yellow and about to

shatter were split open and the seeds were harvested on a single plant basis.

Likewise all the seeds were harvested at regular intervals to avoid possible seed

loss. Finally the seeds collected from a single plant were pooled to estimate the

total number of seeds/plant.

2. 7 Plant DNA isolation

Genomic DNA for PCR, genotyping, and microsatellite marker analysis

was isolated according to the method described by Dellaporta et at., (1983) with

modifications. 100-500 mg of leaf tissue/inflorescence was collected in a 1.5 ml

eppendorf tubes on a single plant basis. The tissue was snap frozen in liquid

nitrogen and ground to a fine powder using a micro pestle. 200 f..ll of freshly

prepared DNA extraction buffer was added and the tissue was finely

homogenized with the micro pestle. An equal volume of 2X CTAB buffer was

added and the mixture was gently vortexed. The mixture was then incubated at

65°C for 5 minutes in a shaking water bath. After incubation, the sample was

allowed to cool and an equal volume of 24:1 chloroform:isoamyl alcohol was

added, mixed gently, and centrifuged for 10 min at 13,000 rpm. The aqueous

phase containing the DNA was transferred to a fresh eppendorf tube and 2/3

volumes of ice-cold isopropanol was added to precipitate the DNA. The DNA was

pelleted down by centrifugation at 4°C at 13,000 rpm for 20 min. The DNA pellet

was washed with 70% ethanol and air dried for 30 minutes. The dried DNA pellet

was suspended in 50 f..tl of sterile water or TE buffer (pH 8.0) containing DNAse

free RNAse (20 f..lg/ml).

2.8 Genomic DNA isolation for Southern analysis

Around 3-5 grams of fresh tissue was collected on a single plant basis,

frozen in liquid nitrogen and ground to a fine powder using a mortar and pestle.

The powder was immediately transferred to a 30 ml centrifugation tube taking

care not to thaw the tissue while transfer. 3-5 ml of freshly prepared DNA

31

extraction buffer was added and mixed thoroughly. Then an equal volume of 2X

CTAB buffer was added and the samples were incubated at 65°C for 5 min in a

shaking water bath. To this, an equal volume of chloroform:isoamyl alcohol

(24:1) was added and mixed by vortexing. The entire contents were centrifuged

at 8000 rpm for 10 min using a Sorvall centrifuge. The upper aqueous phase

was transferred to a fresh tube and to this 2/3 volumes of ice cold isopropanol

was added to precipitate the DNA. The DNA was pelleted down by centrifugation

at 10,000 rpm for 15 min. The DNA pellet was suspended in 400J.!I of TE buffer

(pH 8) containing DNAse free RNAse (20 J.!g/ml) and incubated at 37°C for 30

min in a water bath. This was followed by addition of an equal volume of 24:1

chloroform:isoamyl alcohol and the tubes were centrifuged at 13,000 rpm for 5

min. The aqueous phase was transferred to a fresh eppendorf tube and the DNA

was precipitated by adding one-tenth volume of 3M sodium acetate (pH 5.5) and

2.5 volumes of ice-cold ethanol. The precipitated DNA was pelleted down by

centrifugation at 13,000 rpm for 15 min. The resultant DNA pellet was washed

twice with 70% ethanol, air dried for 30 min and resuspended in 50 J.!l of sterile

water/TE buffer.

2.9 RNA isolation and eDNA synthesis

Total RNA from the tissue of interest was isolated using TriZol reagent

(Invitrogen) as per manufacturer's guidelines. To remove the genomic DNA

contamination, the RNA was treated with RQ1 RNase-free DNase (1 U,

Promega), for 45 min at 37°C followed by heat inactivation of the enzyme at 75°C

for 15 min. The RT reactions were performed (with 5-1 0 J.!g of RNA) using

superscript RT enzyme (lnvitrogen/GIBCO BRL) according to the manufacturer's

instructions. Oligo dT ( 17mer) primer was used for the first strand eDNA

synthesis.

2.10 Recombinant plasmid preparation

DNA fragments of interest were ligated on to an appropriate plasmid

vector backbone using T 4 DNA ligase (NEB) as per the manufacturer's

32

guidelines. In case of ligations involving pGEM-T or pMosBiue vector, user

manual guidelines for pGEM-T easy vector system (Promega) and pMOS-blue

blunt ended cloning system (Amersham Biosciences) were followed. The

recombinant plasmids after ligation were transformed into the ultracompetent

DH5a E.coli.

2.11 Bacterial transformation

Heat shock transformation was followed for mobilizing the recombinant

plasmids of interest into the E.co/i host. Ultra competent DH5a E.coli cells

(prepared in-house as described (Inoue eta/., 1990)) were used for heat shock

transformation. The ultra competent cells (50 J.!l) were thawed on ice for 3 min

and 3 J.!l of the ligation mixture was added, followed by incubation on ice for 20

min. After incubation, the tube containing the ligation mixture and competent

cells were subjected to heat shock treatment at 42°C for 1 min. After heat shock,

the tubes were placed on ice and incubated for a period of 5 min, and 500-1000

J.!l of LB broth was added followed by incubation at 37°C in a shaking waterbath

for 45 min. Serial dilutions were made and transformed cells were plated on LB

agar plates containing appropriate antibiotics for the selection of transformants.

2.12 Triparental mating

Triparental mating was done to mobilize the binary vector harboring the

construct of interest from E. coli (DH5a) to Agrobacterium (AGL 1) using an E. coli

strain (HB 101) carrying a helper plasmid pRK2013. On day 1, the recipient

Agrobacterium strain was patched onto the TYM agar plates containing

carbenicillin and incubated at 28°C for 2 days. On day 3, the E.coli donor strain

carrying the construct of interest and the helper E. coli strain HB1 01 were patched

on a separate LBA plates containing the donor specific antibiotic selection

marker and kanamycin respectively, and incubated at 3?DC for overnight. On the

morning of Day 4, the Agrobacterium cells and the donor and helper E.coli cells

were harvested from the plates using an inoculation loop and each of the strains

were suspended in 500 J.!l of sterile water in an 1.5 ml eppendorf tubes. The cells

33

were then pelleted at 8000 rpm for a minute. The supernatant was discarded and

the cells were again resuspended in 100 J..!l of sterile water. The recipient, helper,

and the donor strain were mixed in a 3:1:1 ratio in an eppendorf tube containing

200 J..!l of sterile water and vortexed to obtain an uniform cell suspension. About

1 00 J..!l of the cell suspension was pipeted out as a single drop onto a TY A plate

(without any antibiotics). The plate was incubated at 28°C for 24 hrs. After

incubation the cells were harvested from the plate and resuspended in 1 ml of

sterile water. Serial dilutions of the cells were plated on to a TYM plate

containing carbenicillin and donor ·specific antibiotic selection marker and

incubated at 28°C for 2 days. The positive colonies were identified by colony

PCR and purified and stored as glycerol stocks (500 J..!l of Agrobacterium culture

at log phase + 500 J..!l of filter sterilized 30% glycerol).

2.13 Plant transformation

Agrobacterium mediated in planta vaccum infiltration floral dip

transformation was carried out according to Bechtold et a/., (1993) with minor

modifications. Plants were grown in square pots as described earlier.

Agrobacterium cell cultures harboring the construct in the binary vector were

grown in TYM broth with the appropriate antibiotics at 28°C in a rotary shaker till

mid log phase (approx. 40-45 hrs post inoculation). The cells were then pelleted

down at 8000 rpm for 10 min and resuspended in the infiltration media. The

plants at the appropriate stage for transformation as judged by the presence of

maximum number of floral buds both in the primary and secondary

inflorescences were chosen. Elongated siliques in the plants were clipped off

using ophthalmic scissors. The pots along with the plants were inverted and

placed in a 250 ml beaker containing the Agrobacterium cells suspended in the

infiltration medium. The entire setup was then transferred to a closed cabinet

connected to a vacuum unit and subjected to 500-600 mm Hg vaccum for 15-20

min. After vacuum infiltration, excess infiltration media was dripped off and the

pots were placed horizontally in a plastic tray and covered with saran wrap to

maintain humidity. The tray was subsequently transferred to the growth chamber

34

and left for a day or two till the plants recovered from the vacuum shock. After

recovery, the plants were kept upright and watered at regular intervals and grown

till maturity. The seeds collected from the infiltrated plants, on sowing in an

appropriate antibiotic selection medium would give rise to the T1 generation.

2.14 Plasmid isolation

Plasmids from E.coli cells for DNA sequencing reactions, restriction

enzyme digestions and for other molecular biology experiments were extracted

from an overnight grown E.coli cells (3 ml) by the alkali lysis method (Sambrook

eta/., 1989).

2.15 Restriction enzyme digestion

All the restriction enzymes used in this study were obtained from New

England Biolabs (NEB) unless otherwise specified. The reactions were carried

out according to the guidelines specified in the NEB catalogue.

2.16 Polymerase Chain Reaction (PCR)

All the routine PCR reactions were performed in 20 ~I reaction mix

containing 1X PCR buffer, 1.5-2.0 mM MgCiz. 0.2 mM each dNTP, 1 unit of Taq

DNA polymerase and 5 pmoles of appropriate forward and reverse primers. PCR

cycle conditions include an initial denaturation at 94 oc for 2 min followed by 35-

40 cycles of denaturation at 94 oc for 10-15 sec, followed by primer annealing at

55 -58oC for 15-30 sees with an extension at 72oC ranging from 10 sees (for

short fragments like microsatellites) to 3 min (for longer fragments upto 3 kb ).

Error free PCR reactions were carried out using the Eppendorf Triple Master

PCR system as per the user manual guidelines. The amplified PCR products

were resolved on a 0.8-2.0% agarose gel (depending upon the amplified

fragment size) in a 1 X TAE buffer medium using a horizontal gel electrophoresis

system. The PCR products for detecting microsatellite polymorphisms were

resolved on an 8% polyacrylamide gel using 1 X TBE buffer at 150 V for 3 hrs

35

using a vertical gel electrophoresis apparatus. The gels were stained with

ethidium bromide to visualize the polymorphisms.

2.16.1 Inverse PCR (IPCR)

The 3' regulatory region of the BhDYAD gene was cloned by an IPCR

approach. 500 ng of genomic DNA from the B.holboel/ii accessions were

digested with the appropriate restriction enzyme in 50 J..ll reaction volumes. After

ensuring complete digestion, the digested DNA fragments were either directly

used for a ligation reaction after inactivating the enzyme or further purified by a

chloroform extraction. The DNA fragments were then salt precipitated with

sodium acetate: ethanol mixture followed by a 70% ethanol wash and air-dried.

After drying, the pellet was dissolved in 50 J..tl of sterile water. 20 J..tl of the

digested fragments were used for a ligation reaction at 16°C 0/N using a T 4 DNA

ligase (NEB) in 100 J..ll volume to favour intramolecular ligation. 2 J.!l of the ligation

reaction was used for an inverse PCR reaction using appropriate primer

combinations as described in Chapter 5.

2.16.2 Thermal asymmetric interlaced (TAIL)- PCR

TAIL-PCR was used to clone the flanking regions of the T-DNA insertion

in the line DIT23. Three sets of nested primers LB1, LB2, and LB3 (specific toT­

DNA left border region) were designed and used in combination with AD2

arbitrary primer. The TAIL-PCR protocol was as described in Liu eta/., (1995)

with minor modifications.

Step Primary PCR Secondary PCR Tertiary PCR

1 95°C 2:00 94°C 0:10 94°C 0:15

2 94°C 0:30 64°C 1:00 44°C 1:00

3 62°C 1:00 72°C 2:30 72°C 2:30

4 72°C 2:30 94°C 0:10 Go to Step1, 29 times

5 Go to Step 2, 4 cycles 64°C 1:00 72°C 5:00

6 94°C 0:30 72°C 2:30 4°C a::

36

7 25°C 3:00 94°C 0:10

8 Ramp @ 0.3°C/s to 72°C 44°C 1:00

9 72°C 2:30 72°C 2:30

10 94°C 0:10 Go to step1, 14 times

11 68°C 1:00 72°C 5:00

12 72°C 2:30 4°C oc

13 94°C 0:10

14 68°C 1:00

15 72°C 2:30

16 94°C 0:10

17 44°C 1:00

18 72°C 2:30

19 Goto step 10, 14 times

20 72°C 5:00

21 4°C oc

2.16.3 Colony PCR

Colony PCR for E.coli or Agrobacterium clones was performed to identify

the transformant colonies that carry the recombinant plasmid of interest. A few

cells from the colony to be tested were picked up using a 200 J.!l yellow tip and

dipped into a PCR tube containing the PCR reaction mix. The PCR tubes with

the bacterial cells were directly subjected to PCR amplification with appropriate

cycling conditions specific for the cloned DNA sequence. Either a vector specific

primer pair or a vector specific primer in combination with an insert specific

primer was used for identification of the transformant colonies. The amplification

products were resolved on an agarose gel to identify positive transformant

colonies.

2.16.4 PCR purification and gel extraction of the DNA fragments

The DNA fragments either from a PCR reaction or after gel extraction

were purified and eluted using Qiaquick spin column purification procedure

(Qiagen) as per the manufacturer's instructions.

37

2.16.5 Gel documentation

Agarose and DNA polyacrylamide gels stained with ethidium bromide

were documented using the Syngene gel documentation system (Synoptics Inc.

UK).

2.17 Genome walking

Genome walking was carried out to clone the 5' regulatory region of

BhDYAD using the Universal Genome Walker™ kit (Ciontech) as per user

manual guidelines.

2.18 Microsatellite (SSR) marker analysis

A F2 segregating population of dyad resulting from a No-0 x Col-O (dyad)

cross was used for the SSR marker analysis. The dyad (Col-O) and No-0 parental

strains were screened for polymorphisms based on known differences between

the two ecotypes (www.arabidopsis.org) and a set of five polymorphic SSR

markers was selected (refer to Table 3.3 of Chapter 3 for details). F2 dyad plants

were typed with polymorphic microsatellite markers and only those plants that

were heterozygous for a microsatellite marker were chosen. Seeds from

individual dyad plants that were heterozygous for a marker were collected and

germinated in MSA plates. All the progeny arising from a single dyad plant

represents a family. The marker polymorphism data on the progenies from

multiple families for which the mother plants were heterozygous for that marker

were considered together for scoring loss of marker heterozygosity.

2.19 CAPS marker polymorphism

250 1-!g of the PCR amplified products (without purification) of the CAPS

markers KNF and KNEF, were digested with the restriction enzyme HinFI for 3

hrs. The digested products were resolved using 1 X TBE buffer on an 8%

polyacrylamide gel run at 150V for 4 ~ hrs, and stained with ethidium bromide for

5-10 min to visualize the polymorphisms.

38

2.20 DNA sequencing

DNA sequences of the desired DNA fragments of interest were obtained

by cycle sequencing. The sequencing reactions were carried out in 5 f.ll reaction

volumes using the ABI™ Prism Big Dye ready reaction terminator cycle

sequencing kit with appropriate primer and template combinations.

After the sequencing PCR reaction, the amplified products were

processed and purified by salt precipitation. Briefly, 25 f.ll of sodium acetate and

absolute ethanol mix (120 f.ll of 3M Sodium acetate pH 3.5 added to 3 ml of ice

cold absolute ethanol) was added to each well of the PCR plate and allowed to

stand for 10 min. The amplified products were precipitated by centrifuging at

4000 rpm for 20 min at 20°C. The supernatant was removed from the invisible

pellet and 1 00 f.ll of 70% ethanol was added to each well and allowed to stand for

another 10 min. Samples were centrifuged at 4000 rpm for 20 min at 20°C. The

supernatant was removed from the pellet by a reverse spin not exceeding 600

rpm for a brief period of 1 0 sec. Care was taken not to lose the pellet while

reverse spin centrifugation. The plate was air dried for 10-15 min and stored at

4°C for a maximum of 1 or 2 days till use. Prior to keeping the plate in the DNA

sequencer, 10 f.ll of 50% HiFi sequencing grade formam ide was added to each

well. Sequence reads were obtained using the ABI 3700/3730 automated DNA

analyzer (Applied Biosystems Inc.). Chromatograms were edited and analyzed

using the Gene Tool software.

2.21 Probe synthesis

2.21.1 Random priming

Random primer labeling was done using the random priming labeling kit

(BRIT, Jonaki) in 50 J.!l reaction volumes. The DNA template for probe

preparation was heat denatured at 1 oooc in a boiling water bath for 2 minutes

and immediately cooled on ice to prevent renaturation. The denatured template

was added to the reaction mixture containing 0.8 mM of dTTP, dGTP, dCTP and

50 f.lCi of aP32 ATP, random primers and two units of Klenow polymerase. The

39

reaction mixture was incubated for probe synthesis at 37°C for 1 ~ hour. Probe

was then purified as described below.

2.21.2 PCR mediated probe labelling

To increase the incorporation of aP32 dATP/dCTP the reaction was carried out

using 20 flM unlabelled dATP/dCTP depending upon the labelled nucleotide. The

other dNTPs were used at a concentration of 200 flM. 20 flCi of aP32

dATP/dCTP was added to a 40 fll reaction. PCR conditions were similar to that

of normal PCR.

2.22 Probe purification

Unincorporated nucleotides were removed from the labeled probes by a

gravity column using Biogel P-60 (size exclusion chromatography, Pharmacia).

1 Ox1 00 fll fractions were collected from the gravity flow and the peak fractions

were pooled. Incorporation was estimated by counting of Cerenkov radiation

(counts per minute in Tritium mode) in a 1 fll aliquot using a liquid scintillation

counter. The purified probes were stored at -20°C. The probe was heat

denatured at 1 oooc for 5 minutes before snap cooling. Probe concentrations of

106 cpm/ml of hybridization solution were used.

2.23 Gel blot analysis

Genomic DNA was digested in 50 fll reaction volumes with appropriate

restriction enzymes. The restriction enzyme reactions were supplemented with

1 mM spermidine to facilitate complete digestion and the resultant DNA fragments

were separated on a 0.8% agarose gel. Further processing of the gel such as

depurination, denaturation, neutralization and transfer of DNA to Hybond N+

nylon membrane by capillary transfer were performed according to Sambrook et

a/., 1989. After gel transfer the blot was cross-linked by exposing to UV rays

using a UV Strata linker. The blot was then incubated in the prehybridization

solution for 8 hrs at 65°C. After prehybrdization, the prehybridization solution was

40

replaced with a fresh hybridization solution containing the probe of interest and

the blot was incubated in hybridization bags in a water bath maintained at 65oe

for at least 16 hrs. After hybridization, the blot was serially washed with 1 X SSe,

0.1% SDS; 0.5X SSe, 0.1% SDS; and 0.1X SSe, 0.1% SDS at 65oe for 30 min

each. After washing, the blot was covered with saran wrap and exposed to a

phospho imaging screen for 24-48 hrs and scanned using a FujiBAS-1800

Phosphor Imager. L process and Image Gauge programs were used to quantify

background subtracted signals.

2.24 Meiotic chromosome spreads

Meiotic chromosome spreads of male and female meiocytes were carried

out according to the method of Ross eta/., 1996 with minor modifications. The

enzyme digestion mixture contained 0.3% cellulase and 0.3%

pectinase/pectolyase. 3% stock solutions were prepared in 10 mM citrate pH 4.5

/45% glycerol and stored at -20°e. Spreads were stained with DAPI (1 j..tg/ml) and

observed on a Zeiss Axioplan 2 upright microscope with a 365 nm excitation, 420

nm long-pass emission filter and 1 OOX oil objective. The images were captured

using the Axiocam HRe ceo camera with the aid of Axiovision software. The

captured images were edited using the Adobe Photoshop (version 6.0) software.

2.25 Ploidy analysis of the plants

Ploidy of the dyad progeny was determined by chromosome counts either

from male meiocytes or somatic nuclei of the anther tissue. Well spread meiotic

stages at anaphase I, dyad stage, metaphase II and anaphase II stages were

counted for an unbiased determination of the chromosome number.

2.26 Seed size and weight analysis

The dyad seeds were classified and sorted according to size by observation

under a stereomicroscope. Seed weight was estimated by weighing 2 sets of 100

seeds (in each cateogory) in a fine microbalance and calculating the average

weight of a single seed.

41

2.27 Whole mount optical clearing of ovules

Inflorescences were fixed in FAA overnight at 4°C or for a minimum of 2

hours at RT. The fixed inflorescences were then rinsed in 50% acetone and

dehydrated in an acetone series (60%, 70%, 80%, 90%; 95%, 100%) for 45

minutes each. After dehydration, the tissues were cleared in methyl benzoate for

45 minutes followed by overnight clearing either with methyl benzoate:Spurr's

resin (7:1) (for long term storage) or methyl benzoate alone (if long term storage

was not required). The following day the ovules/anthers were dissected on a

glass slide under a stereo dissecting microscope. The dissected tissues were

then mounted on the same medium used for overnight clearing. Images were

observed on a Zeiss Axioplan 2 microscope equipped with DIG optics using 40X

or 1 OOX Apochromat objectives and captured on an Axiocam HRC CCD camera.

2.28 Pollen viability and size measurements - Alexander staining

Vital staining of microspores in the anther was done as described

(Alexander, 1969). The bright field images were observed (X10 objective) and

captured using a Zeiss Axioplan 2 microscope. The pollen diameter was

measured in the captured image using the "measure tool" option of the Axiovision

software.

2.29 In vivo pollen germination -Aniline blue staining

Self-pollinated flowers were fixed in a 9:1 mixture of ethanol and acetic

acid over night. The fixed flowers were then incubated in 90% ethanol (20 min)

followed by 70% ethanol (20 min). The fixed floral tissues were then cleared in

1 N NaOH overnight or for a minimum period of at least 2 hrs. After clearing, the

tissues were stained with 0.1% Aniline blue (in 0.1% K3P04 solution) overnight.

The pistils were then dissected and mounted on a drop of glycerol. Pollen

germination was observed (X10 objective) using the Zeiss Axioplan 2 upright

microscope with a 365 nm excitation, 420 nm long-pass emission filter.

42

2.30 Construction of a negatively selectable DYAD gene cassette

The tms2 gene along with 2' promoter was sub-cloned from the phagemid

pAJ6 (Sundaresan eta/., 1995) into the MCS of the binary vector pBINPLUS as a

Xba 1-Sal I fragment. The 5.8 kb Sal I genomic fragment that complements the

dyad mutant phenotype was previously cloned in pBLUESCRIPT (Agashe eta/.,

2002). From pBLUESCRIPT the 5.8 kb DYAD genomic fragment was released

by Sal I single enzyme digestion and cloned in the binary vector pBINPLUS ·

downstream of the tms2 gene. We obtained clones in both the orientations. For

our studies we used a clone with orientation as depicted in Fig. 4.2 A. The

resultant pBINPLUS vector with the tms2-DYAD cassette was transformed into

the E.coli strain DH5a by heat shock transformation. Subsequently the binary

vector was mobilized from E. coli to the Agrobacterium strain AGL 1 by triparental

mating.

2.31 Cloning of the DYAD promoter

A 1.8 kb DYAD promoter region was amplified from Col-O ecotype plants

using the primers PG2R4 and PDYBAM. The amplified products were cloned into

pGEMT vector (Promega) as per manufacturer's instructions.

2.32 Cloning of the coding region of the DYAD homolog from Boechera

holboellii

The 3 kb genomic coding region of the Arabidopsis DYAD ortholog from

Boechera holboelfii (BhDYAD) was amplified with primer pairs harboring BamH1

site on the 5' end: Bho5BAM and Bho3BAM. The resultant 3kb fragment was

cloned in the pGEMT vector.

2.33 Construction of a binary vector pCAMBIA1300 driving BhDYAD under

Arabidopsis DYAD promoter

BhDYAD was released from pGEMT vector as a 3 kb BamHI fragment

and cloned into the pCAMBIA 1300 vector carrying hygromycin as a plant

selection marker. The orientation of the BhDYAD gene with respect to the OCS

43

terminator was confirmed by PCR amplification using the primers BDY3 and

OCSR. The 1.6 kb DYAD promoter region was released as a Sac I fragment

from the pGEMT vector and inserted upstream of BhDYAD in pCAMBIA1300.

The orientation of the promoter with respect to the BhDYAD genomic sequence

was confirmed by PCR amplification using the primers ISMR4 and BDY1.

2.34 Cloning of BhDYAD eDNA

Well-developed single buds from a diploid Greenland plant were taken for

total RNA isolation using TriZol reagent (Invitrogen) as per manufacturer's

instructions. 4 ~g of the total RNA was used for first strand eDNA synthesis using

the Superscript ™ Choice System (GIBCO BRL). The eDNA was further

amplified for cloning by using the primer pair 5RF3 and Bho3BAM and the primer

pair BhCF and BhCR. The resultant 1.9 kb fragment was cloned in the pGEMT

vector and sequenced.

2.35 Softwares used for DNA and protein sequence analysis

A. Amplify 2.5j3 : Used to design the primers used in this study (William Engels,

Genetics department, University of Wisconsin).

B. Gene Tool: Used for editing and assembling chromatograms after DNA

sequencing. Also used for in silica restriction analysis (Wishart eta/., 2000).

C. DNA Strider: Used for in silica restriction analysis of sequences, in silica

translation of coding regions (Marek, 1988).

D. BlastN and Blast 2N: Used for sequence comparison and alignment of two

DNA sequences (Altschul eta/., 1990).

E. CLUSTALW: Used for pairwise protein and DNA sequence alignments (Higgins, 1994).

2.36 List of oligonucleotide primers used in this study

The DNA sequences are listed in 5'-3' orientation. The oligonucleotides

were synthesized either in-house (CCMB Oligo synthesis facility) or from

Bioserve Biotechnologies (India) Pvt. Ltd., Hyderabad/Sigma Genosys IND

(Sigma Aldrich chemicals Pvt. Ltd., Bangalore).

44

Sequences in italics indicate the restriction enzyme sites wherever applicable.

Oligos used for microsatellite marker polymorphism analysis.

nga 162

nga162F nga162R

nga225

nga225F nga225R

nga168

nga168F nga168R

nga1107

nga1107F nga1107R

nga6

nga6F nga6R

CTCTGTCACTCTTTTCCTCTGG CATGCAATTTGCATCTGAGG

TCTCCCCACTAGTTTTGTGTCC GAAATCCAAATCCCAGAGAGG

GAGGACATGTATAGGAGCCTCG TCGTCTACTGCACTGCCG

CGACGAATCGACAGAATTAGG GCGAAAAAACAAAAAAA TCCA

ATGGAGAAGCTTACACTGATC TGGATTTCTTCCTCTCTTCAC

Oligos used to characterize the TOUSLSED (TSL) locus

TFSP TFOR TREV

GACAATTGCAAGATCCAAGCTTTCAC CTGAGTATCACCACCTTGTCAGGAATC TGCTGTTAGCAAGTGCACTGTTAGCTT

Oligos specific for the NPT/1 (Kanamycin) gene used to test for the presence of T -DNA inserts having this marker.

KANF KANR

GCCAACGCTATGTCCTGATAG GATTGAACAAGATGGATTGCAC

Oligos specific for the tms2 gene (IAAH) used to test for the presence of negatively selectable DYAD gene cassette. Also used to rule out false positives following NAM negative selection.

IAR FIA

AAGCGATCAGGTGTCAGGC GCGTAGTAGGATTTCGACCGA

Oligos used for cloning of the DYAD promoter.

45

PG2R4 PDYBAM

TCTGGGGCTCGTCGACTTTTTGTT ACGGATCCTAGAACAAGAGAAAAACTAAGAGAGATATTT

Oligos for genotyping the dyad allele (CAPs marker).

KNE KNEF KNER KKL KKLF KKLR

CGTCTCTAAGTTGTTTAAGGGGTTA TCACGCAAGTTAATTATGTAAGATGA

AAAGAGAGTAGAACTCGCTCAATGT TATCAACAGCTCGTTACTGGACTG

Oligos for genotyping the dyad-2 allele.

GABILB1 GH06DY1 DyOP5 ISMR4

CCCATTTGGACGTGAATGTAGACAC ATAGAAAGTTCATGAGGTGCGATT GAAGCTAACCAGTGTGGCTCATC TCCGCGAACGTTTACAGTTTAGATACAG

Primers used for TAIL- PCR.

TDNA Left border specific primers. LB1 AACCAGCGTGGACCGCTTGCTG LB2 CAGGGCCAGGCGGTGAAGG LB3 CGATTTCGGAACCACCATCAAAC

Arbitrary primer. AD2 NGTCGA( G/C)(A/T)GANA(A/T)GAA

Primers used to check the zygosity of the ET 60 line.

GLTF Ds5-2 ET60F ET60R

AATGCACCCGAAAGTCTATTTGC CGTTCCGTTTTCGTTTTTTACC CGTTGGTCTTATTGACTTCTAGCTACGAC ACATCCTCGAATTCAAAACTACGAG

Primers used for cloning the BhDYAD eDNA.

5RF3 BH03BAM BhCF BhCR

AGTACGATGCTCGCGAAACGGAATC CGGATCCGGATCTGATGCATCAGTTTCAGGTG AGTGGAGAGGATCGTCGAGAGCA GCATCAGTTTCAGGTGACAGCTTCA

Arabidopsis DYAD gene specific primers used for the amplification and sequencing of BhDYAD.

46

G2F6 G21F1 G23F6 ISMR2 ISMR 1 PG2F6 3RR1 5RF1 G22F5

ATTGGTGGTGAATCCTCTAGTAGCAA CTCTTACCTTTGCTGGAGTCATCAG GACGAGTATTGTACGCCGGTTGAG TTGTTCGTCTGGGTTTTCGAGTGAT GGCAAAGGAGATAACTAATGGAAATCGTA CAACTGTCGACTGAGTATGGAGTTGCC CATGGAAGAGACCTTACCAGTTCACATCA GGAGGAACGAAGATTATCGAGAGCA AACATGTTCCTCTCAGCTAGTTTGTACC

Boechera DYAD gene specific primers used for sequencing and other studies involving the BhOY AD gene.

BOY1 BOY2 BOY3 BOY4 BOYS BOY6 BOY7 BOYS BOY10 BOY11 BCOF BCOR BH03BAM BH05BAM BOYUT3 BOY3UT

CATGAGGTGCGATTCTTCTGTAAAGC CCAAATCACAGAGTCACCTCAAAACAG GGAAGAGGAGGAGCTTGTTA~CATGAC

AGACCAGTGTCACCGATCAGCTTC GTGGCTCCTGGAGGTCAAGATAG GCAACAGAATCAAGCGGTGATG GTTGTTGCAGGTGAGCAAAATCAC ACACACGCGCTCTCTGGTACG AACTCCCTTGGAGAAACGCACTG CAGTATCAGTAGCAGCAGCAAGAG TCTTCGCCATCGTCATCGAC TGCCGACTCTTGTACTGCACAC CGGATCCGGATCTGATGCATCAGTTTCAGGTG CGGATCCGAGCAAAAATCATGAGCGTAAGAT CGATCGGCTAATTACCACAACATTC GCCAAATTATTCCCATATGAATAGTTC

Oligos used for cloning the 4.8 kb BhOY AD gene.

BhPREB GAATTCGGATCCAGGCCTACTATTTGTTTACGACAA BhUTEB GAATTCGGATCCCGATCGGCTAATTACCACAACATTC

Oligos used for amplification of GAPC eDNA as an internal control.

GAPC1 GAPC2

Universal primers

M13F M13R OCSR

CTTGAAGGGTGGTGCCAAGAAGG CCTGTTGTCGCCAACGAAGTCAG

GTAAAACGACGGCCAGT GGAAACAGCTATGACCATG GAACCGAAACCGGCGGTAAGGTAAGG

47

2.37 Media/Reagents - Composition

A. Luria Bertani (LB) medium: For 1 litre- Tryptone (10 g), Yeast extract (5 g),

NaCI (10 g), Agar Agar (1.5%).

B. Tryptone Yeast Mannitol (TYM) medium: For 1 litre- Bacto tryptone (5 g),

Yeast extract (0.5 g), Mannitol (10 g), CaCb (1 mM /litre), Agar Agar (1.5%).

C. Murashige and Skoog (MS) medium 1X: CaCb (4 mM), MgS04 (1.5 mM},

KN03 (18.8 mM), NH4N03 (20.6 mM), KH2P04 (1.25 mM) pH 5.6, Fe-EDTA (20

mM), Minor Salts (1X) (see below for the recipe). pH should be around 5.6-5.7.

D. Fe-EDTA solution: 2.5 g of FeS04.1H20 was dissolved in 400 ml of water. To

this was added 3.36 g of Na-EDTA. The solution was heated in a water bath till it

started to boil. The solution was stirred for 30 minutes while cooling using a

magnetic stirrer and made up the volume to 450 mi. 2.5 ml of this stock solution

was added to a liter of 1X MS solution.

E. Minor nutrients (1000X Stock): H3B03 (70 mM), MnCh (14 mM), CuS04 (0.5

mM), ZnS04 (1 mM), NaMo04 (0.2 mM), NaCI (10 mM), CoCI2 (0.01 mM). 1 ml of

this mix was added to 1 litre of the MS solution to make 1 X minor nutrients.

F. Infiltration medium (for Agrobacterium mediated plant transformation):

Y:z X MS solution, 2% sucrose, 0.05 J.lm Benzyl amino purine, 200 J.llllitre Silwet

(surfactant).

' G. Denaturation solution: 1.5 M NaCI and 0.5 N NaOH.

H. Depurination solution: 0.125 N HCI.

I. Neutralizing solution: 1.5 M Nacl, 0.5 M Tris-CI pH 7.4.

J. Hybridization solution: Equal volumes of 14% SDS and 1M Sodium

phosphate buffer (1M).

K. 10X TBE: For 1 litre- Tris (108 g), 40 ml of 0.5 M EDTA (pH 8.0), Boric acid

(55.6 g).

48

L. SOX TAE: For 1 litre - Tris (242 g), 57.1 ml glacial acetic acid and 100 ml of

0.5 M EDTA (pH 8.0).

M. Spurr's resin: 4 vinyl-cyclohexane-dioxide - 22.8% (v/v), DER-736 resin -

13.09% (v/v), 2-nonelyl-succinic-anhydride - 62.96% (v/v), Dimethyl amino

ethanol - 1.12% (v/v).

N. Alexander's stain: 95 % alcohol -10 ml, Malachite green- 10 mg (1 ml of

1% solution in 95% alcohol), Distilled water - 50 ml, Glycerol - 25 ml, Phenol - 5

g, Chloral hydrate - 5 g, Acid Fuchsin- 50 mg (5 ml of 1 % solution in water),

Orange G - 5 mg (0.5 ml of 1% solution in water), Acetic acid - 2 mi. The pH of

the final staining solution was adjusted to 2.3.

0. DNA extraction buffer: 100 mM Tris (pH-8.0), 50 mM EDTA (pH-8.0), 500

mM NaCI, 10 mM 2-mercaptoethanol and 1.4 % SDS.

P. CTAB buffer: 2% CTAB, 100 mM Tris (pH-8.0), 20 mM EDTA (pH-8.0) and

1.4 M NaCI.

Q. Carnoy's solution: 6:3:1 (Ethanol: Chloroform: Acetic acid).

R. 8% PFA: 100 ml PBS solution was adjusted to pH 11 with NaOH and heated

to 60°C in a water bath. In a fume hood, 8 g of paraformaldehyde was added to

the heated solution and stirred till it dissolved. The solution was cooled on ice

and the pH readjusted to 7 with H2S04.

S. FAA: 4% freshly prepared paraformaldehyde (PFA), 5% acetic acid and 50%

ethanol.

49