chapter 2 materials and methods - shodhganga : a reservoir...
TRANSCRIPT
Chapter 2
Materials and Methods
2.1 Plant materials
The wild type Arabidopsis strain (2n=1 0) used in this study is of Columbia
(Col-O) ecotype. The dyad mutation was originally identified in the Landsberg
erecta (Ler) ecotype and later introgressed into the Col-O background by
repeated backcrossing (Siddiqi eta/., 2000). The dyad plants used in the study
were derived from the backcrossed population.
The F2 population used for microsatellite marker analysis was obtained
from a cross between the strain No-0 (Nossen ecotype) and dyad mutant in the
Col-O background as described (Siddiqi eta/., 2000).
GABI-KAT-206-H06 (also referred to as dyad-2): Col-O ecotype having T-DNA
insertion in the third exon of the SW/1/DYAD gene, obtained from GABI-KAT T
DNA insertion mutant collection (www.gabi-kat.de/).
CS 3900: An autotetraploid (2n=20) Arabidopsis strain (La-er ecotype) obtained
from the Arabidopsis biological resource center (ABRC). It has a transgenic
kanamycin resistance gene in a quadruplex condition (Luca Comai, personal
communication).
ET 60: An enhancer trap line that contains a single copy insertion of the Ds
transposon in the gene At1g73160 of Arabidopsis (Vijayabhaskar and Siddiqi,
unpublished).
The facultatively apomictic diploid Greenland and triploid Colorado accessions of
Boechera holboellii were a kind gift from Dr. Kim Boutilier (Naumova eta/., 2001 ).
2.2 Bacterial strains used in the study
E. coli (DH5a.): supE44L'llacU 169 ( <j>801aczL'lM 15) hsdR 17 recA 1 endA 1 gyrA96
thi-1 reiA1 (Sambrook eta/., 1989).
E.coli (HB101): supE44hsds20(r8 -m8-) recA13 ara-14 proA2 lacY1 gaiK2 rpsl20
xyl-5 mtl-1 (Sambrook eta/., 1989).
Agrobacterium tumefaciens (AGL 1): It carries a hypervirulent, attenuated
tumor-inducing plasmid pTiBo542 from which the T-region DNA sequences have
been precisely deleted, allowing optimal DNA transformation of many
28
dicotyledonous plants. It also carries an insertion in its recA recombination gene,
which stabilizes the recombinant plasmids (Lazo eta/., 1991 ).
2.3 Plant growth conditions
Plants were grown in pots under fluorescent lights (7000 lux at 20 em) at
20°C with a 16 hr light/8 hour dark cycle in a controlled growth cabinet
(CONVIRON). The synthetic medium for growing plants was prepared by mixing
equal proportions of soilrite: perlite: vermiculite (Keltech Energies Ltd., Karnataka
574 108, India). The soil mix in the pots was drenched in 1X Murashige and
Skoog (MS) nutrient solution (prepared in-house as mentioned at the end of the
chapter) till saturation. In case of the pots that were used for plant transformation,
the soil mix was thoroughly covered and confined within a nylon mesh. The
seeds/seedlings were uniformly sprinkled/transplanted respectively in the pots.
For seed stratification, pots containing seeds were covered with Saran wrap and
kept at 4 oc in a cold room for 4 days after which they were shifted to the growth
chamber. In case of seedling transplantation, the pots were directly placed in the
growth chamber. Thereafter, at regular intervals the plants were irrigated with
distilled water.
Boechera plants were grown in pots containing the same medium and
under identical conditions as described for Arabidopsis.
2.4 Seed germination and growth in petriplates
For germinating seeds in MS agar plates, the seeds were surface
sterilized with double distilled ethanol for 10 min followed by treatment with
0.025% mercuric chloride for 5 min. The seeds were then washed three times
with sterile water to remove the traces of mercuric chloride. Sterilized seeds were
suspended in lukewarm 0.5% top agar and evenly spread on the 1 X MS agar
plates. After plating the seeds, the plates were sealed with parafilm and kept in
the cold room (4°C) for seed stratification. After 4 days the plates were
transferred to the growth chamber. Germination frequencies were counted two
weeks thereafter.
29
A. Normal growth medium (NGM): 1X MS salts+ 2% sucrose+ 0.7% agar.
B. Kanamycin selection medium: NGM supplemented with 50 f.lg/ml of
kanamycin.
C. Napthyl acetamide (NAM) selection medium: NGM supplemented with 3.5
f.!M NAM.
The selection phenotypes of the transformants that are positive for kanamycin
and negative for NAM are described in Chapter 4.
D. Hygromycin selection medium: 0.8% bacto agar, 1 mM KN03, 1% sucrose,
and 20 IJg/ml hygromycin. The transformants that are resistant to hygromycin can
be identified as early as 5 days post transfer by virtue of a well elongated root,
erect hypocotyl, and well spread cotyledonary leaves. The selected
transformants were further transferred to a fresh hygromycin selection medium.
After proper growth and establishment, the seedlings were transferred to soil.
2.5 Emasculation and hand pollination
The flower buds from the plant to be used as a female parent were
emasculated the previous day. Only well-developed, unopened flower buds that
were about to flower the next day were emasculated by carefully removing all the
floral whorls except the pistil using a fine forceps (Dupont #5). Care was taken
not to damage the pistil while emasculation. Opened flowers and already
developed siliques in the inflorescence were clipped off to maintain the identity of
the crossed pistil. The following morning 2-3 well-dehisced anthers containing
good pollen load (from the plant that is to be used as a male parent) were
excised from the flower and gently dusted on to the stigma of the emasculated
pistil. Successful hand pollinated pistils would turn pink and elongate after
pollination.
2.6 Seed set analysis
A F2 segregating population harboring a dyad mutation in the Col-O
ecotype background was used for scoring the frequency of seed set in the dyad
homozygous plants. The fertile segregants were culled from the population.
30
Upon cessation of flowering, watering was withheld to allow the siliques to reach
harvest maturity. Meanwhile the lowest siliques that turn yellow and about to
shatter were split open and the seeds were harvested on a single plant basis.
Likewise all the seeds were harvested at regular intervals to avoid possible seed
loss. Finally the seeds collected from a single plant were pooled to estimate the
total number of seeds/plant.
2. 7 Plant DNA isolation
Genomic DNA for PCR, genotyping, and microsatellite marker analysis
was isolated according to the method described by Dellaporta et at., (1983) with
modifications. 100-500 mg of leaf tissue/inflorescence was collected in a 1.5 ml
eppendorf tubes on a single plant basis. The tissue was snap frozen in liquid
nitrogen and ground to a fine powder using a micro pestle. 200 f..ll of freshly
prepared DNA extraction buffer was added and the tissue was finely
homogenized with the micro pestle. An equal volume of 2X CTAB buffer was
added and the mixture was gently vortexed. The mixture was then incubated at
65°C for 5 minutes in a shaking water bath. After incubation, the sample was
allowed to cool and an equal volume of 24:1 chloroform:isoamyl alcohol was
added, mixed gently, and centrifuged for 10 min at 13,000 rpm. The aqueous
phase containing the DNA was transferred to a fresh eppendorf tube and 2/3
volumes of ice-cold isopropanol was added to precipitate the DNA. The DNA was
pelleted down by centrifugation at 4°C at 13,000 rpm for 20 min. The DNA pellet
was washed with 70% ethanol and air dried for 30 minutes. The dried DNA pellet
was suspended in 50 f..tl of sterile water or TE buffer (pH 8.0) containing DNAse
free RNAse (20 f..lg/ml).
2.8 Genomic DNA isolation for Southern analysis
Around 3-5 grams of fresh tissue was collected on a single plant basis,
frozen in liquid nitrogen and ground to a fine powder using a mortar and pestle.
The powder was immediately transferred to a 30 ml centrifugation tube taking
care not to thaw the tissue while transfer. 3-5 ml of freshly prepared DNA
31
extraction buffer was added and mixed thoroughly. Then an equal volume of 2X
CTAB buffer was added and the samples were incubated at 65°C for 5 min in a
shaking water bath. To this, an equal volume of chloroform:isoamyl alcohol
(24:1) was added and mixed by vortexing. The entire contents were centrifuged
at 8000 rpm for 10 min using a Sorvall centrifuge. The upper aqueous phase
was transferred to a fresh tube and to this 2/3 volumes of ice cold isopropanol
was added to precipitate the DNA. The DNA was pelleted down by centrifugation
at 10,000 rpm for 15 min. The DNA pellet was suspended in 400J.!I of TE buffer
(pH 8) containing DNAse free RNAse (20 J.!g/ml) and incubated at 37°C for 30
min in a water bath. This was followed by addition of an equal volume of 24:1
chloroform:isoamyl alcohol and the tubes were centrifuged at 13,000 rpm for 5
min. The aqueous phase was transferred to a fresh eppendorf tube and the DNA
was precipitated by adding one-tenth volume of 3M sodium acetate (pH 5.5) and
2.5 volumes of ice-cold ethanol. The precipitated DNA was pelleted down by
centrifugation at 13,000 rpm for 15 min. The resultant DNA pellet was washed
twice with 70% ethanol, air dried for 30 min and resuspended in 50 J.!l of sterile
water/TE buffer.
2.9 RNA isolation and eDNA synthesis
Total RNA from the tissue of interest was isolated using TriZol reagent
(Invitrogen) as per manufacturer's guidelines. To remove the genomic DNA
contamination, the RNA was treated with RQ1 RNase-free DNase (1 U,
Promega), for 45 min at 37°C followed by heat inactivation of the enzyme at 75°C
for 15 min. The RT reactions were performed (with 5-1 0 J.!g of RNA) using
superscript RT enzyme (lnvitrogen/GIBCO BRL) according to the manufacturer's
instructions. Oligo dT ( 17mer) primer was used for the first strand eDNA
synthesis.
2.10 Recombinant plasmid preparation
DNA fragments of interest were ligated on to an appropriate plasmid
vector backbone using T 4 DNA ligase (NEB) as per the manufacturer's
32
guidelines. In case of ligations involving pGEM-T or pMosBiue vector, user
manual guidelines for pGEM-T easy vector system (Promega) and pMOS-blue
blunt ended cloning system (Amersham Biosciences) were followed. The
recombinant plasmids after ligation were transformed into the ultracompetent
DH5a E.coli.
2.11 Bacterial transformation
Heat shock transformation was followed for mobilizing the recombinant
plasmids of interest into the E.co/i host. Ultra competent DH5a E.coli cells
(prepared in-house as described (Inoue eta/., 1990)) were used for heat shock
transformation. The ultra competent cells (50 J.!l) were thawed on ice for 3 min
and 3 J.!l of the ligation mixture was added, followed by incubation on ice for 20
min. After incubation, the tube containing the ligation mixture and competent
cells were subjected to heat shock treatment at 42°C for 1 min. After heat shock,
the tubes were placed on ice and incubated for a period of 5 min, and 500-1000
J.!l of LB broth was added followed by incubation at 37°C in a shaking waterbath
for 45 min. Serial dilutions were made and transformed cells were plated on LB
agar plates containing appropriate antibiotics for the selection of transformants.
2.12 Triparental mating
Triparental mating was done to mobilize the binary vector harboring the
construct of interest from E. coli (DH5a) to Agrobacterium (AGL 1) using an E. coli
strain (HB 101) carrying a helper plasmid pRK2013. On day 1, the recipient
Agrobacterium strain was patched onto the TYM agar plates containing
carbenicillin and incubated at 28°C for 2 days. On day 3, the E.coli donor strain
carrying the construct of interest and the helper E. coli strain HB1 01 were patched
on a separate LBA plates containing the donor specific antibiotic selection
marker and kanamycin respectively, and incubated at 3?DC for overnight. On the
morning of Day 4, the Agrobacterium cells and the donor and helper E.coli cells
were harvested from the plates using an inoculation loop and each of the strains
were suspended in 500 J.!l of sterile water in an 1.5 ml eppendorf tubes. The cells
33
were then pelleted at 8000 rpm for a minute. The supernatant was discarded and
the cells were again resuspended in 100 J..!l of sterile water. The recipient, helper,
and the donor strain were mixed in a 3:1:1 ratio in an eppendorf tube containing
200 J..!l of sterile water and vortexed to obtain an uniform cell suspension. About
1 00 J..!l of the cell suspension was pipeted out as a single drop onto a TY A plate
(without any antibiotics). The plate was incubated at 28°C for 24 hrs. After
incubation the cells were harvested from the plate and resuspended in 1 ml of
sterile water. Serial dilutions of the cells were plated on to a TYM plate
containing carbenicillin and donor ·specific antibiotic selection marker and
incubated at 28°C for 2 days. The positive colonies were identified by colony
PCR and purified and stored as glycerol stocks (500 J..!l of Agrobacterium culture
at log phase + 500 J..!l of filter sterilized 30% glycerol).
2.13 Plant transformation
Agrobacterium mediated in planta vaccum infiltration floral dip
transformation was carried out according to Bechtold et a/., (1993) with minor
modifications. Plants were grown in square pots as described earlier.
Agrobacterium cell cultures harboring the construct in the binary vector were
grown in TYM broth with the appropriate antibiotics at 28°C in a rotary shaker till
mid log phase (approx. 40-45 hrs post inoculation). The cells were then pelleted
down at 8000 rpm for 10 min and resuspended in the infiltration media. The
plants at the appropriate stage for transformation as judged by the presence of
maximum number of floral buds both in the primary and secondary
inflorescences were chosen. Elongated siliques in the plants were clipped off
using ophthalmic scissors. The pots along with the plants were inverted and
placed in a 250 ml beaker containing the Agrobacterium cells suspended in the
infiltration medium. The entire setup was then transferred to a closed cabinet
connected to a vacuum unit and subjected to 500-600 mm Hg vaccum for 15-20
min. After vacuum infiltration, excess infiltration media was dripped off and the
pots were placed horizontally in a plastic tray and covered with saran wrap to
maintain humidity. The tray was subsequently transferred to the growth chamber
34
and left for a day or two till the plants recovered from the vacuum shock. After
recovery, the plants were kept upright and watered at regular intervals and grown
till maturity. The seeds collected from the infiltrated plants, on sowing in an
appropriate antibiotic selection medium would give rise to the T1 generation.
2.14 Plasmid isolation
Plasmids from E.coli cells for DNA sequencing reactions, restriction
enzyme digestions and for other molecular biology experiments were extracted
from an overnight grown E.coli cells (3 ml) by the alkali lysis method (Sambrook
eta/., 1989).
2.15 Restriction enzyme digestion
All the restriction enzymes used in this study were obtained from New
England Biolabs (NEB) unless otherwise specified. The reactions were carried
out according to the guidelines specified in the NEB catalogue.
2.16 Polymerase Chain Reaction (PCR)
All the routine PCR reactions were performed in 20 ~I reaction mix
containing 1X PCR buffer, 1.5-2.0 mM MgCiz. 0.2 mM each dNTP, 1 unit of Taq
DNA polymerase and 5 pmoles of appropriate forward and reverse primers. PCR
cycle conditions include an initial denaturation at 94 oc for 2 min followed by 35-
40 cycles of denaturation at 94 oc for 10-15 sec, followed by primer annealing at
55 -58oC for 15-30 sees with an extension at 72oC ranging from 10 sees (for
short fragments like microsatellites) to 3 min (for longer fragments upto 3 kb ).
Error free PCR reactions were carried out using the Eppendorf Triple Master
PCR system as per the user manual guidelines. The amplified PCR products
were resolved on a 0.8-2.0% agarose gel (depending upon the amplified
fragment size) in a 1 X TAE buffer medium using a horizontal gel electrophoresis
system. The PCR products for detecting microsatellite polymorphisms were
resolved on an 8% polyacrylamide gel using 1 X TBE buffer at 150 V for 3 hrs
35
using a vertical gel electrophoresis apparatus. The gels were stained with
ethidium bromide to visualize the polymorphisms.
2.16.1 Inverse PCR (IPCR)
The 3' regulatory region of the BhDYAD gene was cloned by an IPCR
approach. 500 ng of genomic DNA from the B.holboel/ii accessions were
digested with the appropriate restriction enzyme in 50 J..ll reaction volumes. After
ensuring complete digestion, the digested DNA fragments were either directly
used for a ligation reaction after inactivating the enzyme or further purified by a
chloroform extraction. The DNA fragments were then salt precipitated with
sodium acetate: ethanol mixture followed by a 70% ethanol wash and air-dried.
After drying, the pellet was dissolved in 50 J..tl of sterile water. 20 J..tl of the
digested fragments were used for a ligation reaction at 16°C 0/N using a T 4 DNA
ligase (NEB) in 100 J..ll volume to favour intramolecular ligation. 2 J.!l of the ligation
reaction was used for an inverse PCR reaction using appropriate primer
combinations as described in Chapter 5.
2.16.2 Thermal asymmetric interlaced (TAIL)- PCR
TAIL-PCR was used to clone the flanking regions of the T-DNA insertion
in the line DIT23. Three sets of nested primers LB1, LB2, and LB3 (specific toT
DNA left border region) were designed and used in combination with AD2
arbitrary primer. The TAIL-PCR protocol was as described in Liu eta/., (1995)
with minor modifications.
Step Primary PCR Secondary PCR Tertiary PCR
1 95°C 2:00 94°C 0:10 94°C 0:15
2 94°C 0:30 64°C 1:00 44°C 1:00
3 62°C 1:00 72°C 2:30 72°C 2:30
4 72°C 2:30 94°C 0:10 Go to Step1, 29 times
5 Go to Step 2, 4 cycles 64°C 1:00 72°C 5:00
6 94°C 0:30 72°C 2:30 4°C a::
36
7 25°C 3:00 94°C 0:10
8 Ramp @ 0.3°C/s to 72°C 44°C 1:00
9 72°C 2:30 72°C 2:30
10 94°C 0:10 Go to step1, 14 times
11 68°C 1:00 72°C 5:00
12 72°C 2:30 4°C oc
13 94°C 0:10
14 68°C 1:00
15 72°C 2:30
16 94°C 0:10
17 44°C 1:00
18 72°C 2:30
19 Goto step 10, 14 times
20 72°C 5:00
21 4°C oc
2.16.3 Colony PCR
Colony PCR for E.coli or Agrobacterium clones was performed to identify
the transformant colonies that carry the recombinant plasmid of interest. A few
cells from the colony to be tested were picked up using a 200 J.!l yellow tip and
dipped into a PCR tube containing the PCR reaction mix. The PCR tubes with
the bacterial cells were directly subjected to PCR amplification with appropriate
cycling conditions specific for the cloned DNA sequence. Either a vector specific
primer pair or a vector specific primer in combination with an insert specific
primer was used for identification of the transformant colonies. The amplification
products were resolved on an agarose gel to identify positive transformant
colonies.
2.16.4 PCR purification and gel extraction of the DNA fragments
The DNA fragments either from a PCR reaction or after gel extraction
were purified and eluted using Qiaquick spin column purification procedure
(Qiagen) as per the manufacturer's instructions.
37
2.16.5 Gel documentation
Agarose and DNA polyacrylamide gels stained with ethidium bromide
were documented using the Syngene gel documentation system (Synoptics Inc.
UK).
2.17 Genome walking
Genome walking was carried out to clone the 5' regulatory region of
BhDYAD using the Universal Genome Walker™ kit (Ciontech) as per user
manual guidelines.
2.18 Microsatellite (SSR) marker analysis
A F2 segregating population of dyad resulting from a No-0 x Col-O (dyad)
cross was used for the SSR marker analysis. The dyad (Col-O) and No-0 parental
strains were screened for polymorphisms based on known differences between
the two ecotypes (www.arabidopsis.org) and a set of five polymorphic SSR
markers was selected (refer to Table 3.3 of Chapter 3 for details). F2 dyad plants
were typed with polymorphic microsatellite markers and only those plants that
were heterozygous for a microsatellite marker were chosen. Seeds from
individual dyad plants that were heterozygous for a marker were collected and
germinated in MSA plates. All the progeny arising from a single dyad plant
represents a family. The marker polymorphism data on the progenies from
multiple families for which the mother plants were heterozygous for that marker
were considered together for scoring loss of marker heterozygosity.
2.19 CAPS marker polymorphism
250 1-!g of the PCR amplified products (without purification) of the CAPS
markers KNF and KNEF, were digested with the restriction enzyme HinFI for 3
hrs. The digested products were resolved using 1 X TBE buffer on an 8%
polyacrylamide gel run at 150V for 4 ~ hrs, and stained with ethidium bromide for
5-10 min to visualize the polymorphisms.
38
2.20 DNA sequencing
DNA sequences of the desired DNA fragments of interest were obtained
by cycle sequencing. The sequencing reactions were carried out in 5 f.ll reaction
volumes using the ABI™ Prism Big Dye ready reaction terminator cycle
sequencing kit with appropriate primer and template combinations.
After the sequencing PCR reaction, the amplified products were
processed and purified by salt precipitation. Briefly, 25 f.ll of sodium acetate and
absolute ethanol mix (120 f.ll of 3M Sodium acetate pH 3.5 added to 3 ml of ice
cold absolute ethanol) was added to each well of the PCR plate and allowed to
stand for 10 min. The amplified products were precipitated by centrifuging at
4000 rpm for 20 min at 20°C. The supernatant was removed from the invisible
pellet and 1 00 f.ll of 70% ethanol was added to each well and allowed to stand for
another 10 min. Samples were centrifuged at 4000 rpm for 20 min at 20°C. The
supernatant was removed from the pellet by a reverse spin not exceeding 600
rpm for a brief period of 1 0 sec. Care was taken not to lose the pellet while
reverse spin centrifugation. The plate was air dried for 10-15 min and stored at
4°C for a maximum of 1 or 2 days till use. Prior to keeping the plate in the DNA
sequencer, 10 f.ll of 50% HiFi sequencing grade formam ide was added to each
well. Sequence reads were obtained using the ABI 3700/3730 automated DNA
analyzer (Applied Biosystems Inc.). Chromatograms were edited and analyzed
using the Gene Tool software.
2.21 Probe synthesis
2.21.1 Random priming
Random primer labeling was done using the random priming labeling kit
(BRIT, Jonaki) in 50 J.!l reaction volumes. The DNA template for probe
preparation was heat denatured at 1 oooc in a boiling water bath for 2 minutes
and immediately cooled on ice to prevent renaturation. The denatured template
was added to the reaction mixture containing 0.8 mM of dTTP, dGTP, dCTP and
50 f.lCi of aP32 ATP, random primers and two units of Klenow polymerase. The
39
reaction mixture was incubated for probe synthesis at 37°C for 1 ~ hour. Probe
was then purified as described below.
2.21.2 PCR mediated probe labelling
To increase the incorporation of aP32 dATP/dCTP the reaction was carried out
using 20 flM unlabelled dATP/dCTP depending upon the labelled nucleotide. The
other dNTPs were used at a concentration of 200 flM. 20 flCi of aP32
dATP/dCTP was added to a 40 fll reaction. PCR conditions were similar to that
of normal PCR.
2.22 Probe purification
Unincorporated nucleotides were removed from the labeled probes by a
gravity column using Biogel P-60 (size exclusion chromatography, Pharmacia).
1 Ox1 00 fll fractions were collected from the gravity flow and the peak fractions
were pooled. Incorporation was estimated by counting of Cerenkov radiation
(counts per minute in Tritium mode) in a 1 fll aliquot using a liquid scintillation
counter. The purified probes were stored at -20°C. The probe was heat
denatured at 1 oooc for 5 minutes before snap cooling. Probe concentrations of
106 cpm/ml of hybridization solution were used.
2.23 Gel blot analysis
Genomic DNA was digested in 50 fll reaction volumes with appropriate
restriction enzymes. The restriction enzyme reactions were supplemented with
1 mM spermidine to facilitate complete digestion and the resultant DNA fragments
were separated on a 0.8% agarose gel. Further processing of the gel such as
depurination, denaturation, neutralization and transfer of DNA to Hybond N+
nylon membrane by capillary transfer were performed according to Sambrook et
a/., 1989. After gel transfer the blot was cross-linked by exposing to UV rays
using a UV Strata linker. The blot was then incubated in the prehybridization
solution for 8 hrs at 65°C. After prehybrdization, the prehybridization solution was
40
replaced with a fresh hybridization solution containing the probe of interest and
the blot was incubated in hybridization bags in a water bath maintained at 65oe
for at least 16 hrs. After hybridization, the blot was serially washed with 1 X SSe,
0.1% SDS; 0.5X SSe, 0.1% SDS; and 0.1X SSe, 0.1% SDS at 65oe for 30 min
each. After washing, the blot was covered with saran wrap and exposed to a
phospho imaging screen for 24-48 hrs and scanned using a FujiBAS-1800
Phosphor Imager. L process and Image Gauge programs were used to quantify
background subtracted signals.
2.24 Meiotic chromosome spreads
Meiotic chromosome spreads of male and female meiocytes were carried
out according to the method of Ross eta/., 1996 with minor modifications. The
enzyme digestion mixture contained 0.3% cellulase and 0.3%
pectinase/pectolyase. 3% stock solutions were prepared in 10 mM citrate pH 4.5
/45% glycerol and stored at -20°e. Spreads were stained with DAPI (1 j..tg/ml) and
observed on a Zeiss Axioplan 2 upright microscope with a 365 nm excitation, 420
nm long-pass emission filter and 1 OOX oil objective. The images were captured
using the Axiocam HRe ceo camera with the aid of Axiovision software. The
captured images were edited using the Adobe Photoshop (version 6.0) software.
2.25 Ploidy analysis of the plants
Ploidy of the dyad progeny was determined by chromosome counts either
from male meiocytes or somatic nuclei of the anther tissue. Well spread meiotic
stages at anaphase I, dyad stage, metaphase II and anaphase II stages were
counted for an unbiased determination of the chromosome number.
2.26 Seed size and weight analysis
The dyad seeds were classified and sorted according to size by observation
under a stereomicroscope. Seed weight was estimated by weighing 2 sets of 100
seeds (in each cateogory) in a fine microbalance and calculating the average
weight of a single seed.
41
2.27 Whole mount optical clearing of ovules
Inflorescences were fixed in FAA overnight at 4°C or for a minimum of 2
hours at RT. The fixed inflorescences were then rinsed in 50% acetone and
dehydrated in an acetone series (60%, 70%, 80%, 90%; 95%, 100%) for 45
minutes each. After dehydration, the tissues were cleared in methyl benzoate for
45 minutes followed by overnight clearing either with methyl benzoate:Spurr's
resin (7:1) (for long term storage) or methyl benzoate alone (if long term storage
was not required). The following day the ovules/anthers were dissected on a
glass slide under a stereo dissecting microscope. The dissected tissues were
then mounted on the same medium used for overnight clearing. Images were
observed on a Zeiss Axioplan 2 microscope equipped with DIG optics using 40X
or 1 OOX Apochromat objectives and captured on an Axiocam HRC CCD camera.
2.28 Pollen viability and size measurements - Alexander staining
Vital staining of microspores in the anther was done as described
(Alexander, 1969). The bright field images were observed (X10 objective) and
captured using a Zeiss Axioplan 2 microscope. The pollen diameter was
measured in the captured image using the "measure tool" option of the Axiovision
software.
2.29 In vivo pollen germination -Aniline blue staining
Self-pollinated flowers were fixed in a 9:1 mixture of ethanol and acetic
acid over night. The fixed flowers were then incubated in 90% ethanol (20 min)
followed by 70% ethanol (20 min). The fixed floral tissues were then cleared in
1 N NaOH overnight or for a minimum period of at least 2 hrs. After clearing, the
tissues were stained with 0.1% Aniline blue (in 0.1% K3P04 solution) overnight.
The pistils were then dissected and mounted on a drop of glycerol. Pollen
germination was observed (X10 objective) using the Zeiss Axioplan 2 upright
microscope with a 365 nm excitation, 420 nm long-pass emission filter.
42
2.30 Construction of a negatively selectable DYAD gene cassette
The tms2 gene along with 2' promoter was sub-cloned from the phagemid
pAJ6 (Sundaresan eta/., 1995) into the MCS of the binary vector pBINPLUS as a
Xba 1-Sal I fragment. The 5.8 kb Sal I genomic fragment that complements the
dyad mutant phenotype was previously cloned in pBLUESCRIPT (Agashe eta/.,
2002). From pBLUESCRIPT the 5.8 kb DYAD genomic fragment was released
by Sal I single enzyme digestion and cloned in the binary vector pBINPLUS ·
downstream of the tms2 gene. We obtained clones in both the orientations. For
our studies we used a clone with orientation as depicted in Fig. 4.2 A. The
resultant pBINPLUS vector with the tms2-DYAD cassette was transformed into
the E.coli strain DH5a by heat shock transformation. Subsequently the binary
vector was mobilized from E. coli to the Agrobacterium strain AGL 1 by triparental
mating.
2.31 Cloning of the DYAD promoter
A 1.8 kb DYAD promoter region was amplified from Col-O ecotype plants
using the primers PG2R4 and PDYBAM. The amplified products were cloned into
pGEMT vector (Promega) as per manufacturer's instructions.
2.32 Cloning of the coding region of the DYAD homolog from Boechera
holboellii
The 3 kb genomic coding region of the Arabidopsis DYAD ortholog from
Boechera holboelfii (BhDYAD) was amplified with primer pairs harboring BamH1
site on the 5' end: Bho5BAM and Bho3BAM. The resultant 3kb fragment was
cloned in the pGEMT vector.
2.33 Construction of a binary vector pCAMBIA1300 driving BhDYAD under
Arabidopsis DYAD promoter
BhDYAD was released from pGEMT vector as a 3 kb BamHI fragment
and cloned into the pCAMBIA 1300 vector carrying hygromycin as a plant
selection marker. The orientation of the BhDYAD gene with respect to the OCS
43
terminator was confirmed by PCR amplification using the primers BDY3 and
OCSR. The 1.6 kb DYAD promoter region was released as a Sac I fragment
from the pGEMT vector and inserted upstream of BhDYAD in pCAMBIA1300.
The orientation of the promoter with respect to the BhDYAD genomic sequence
was confirmed by PCR amplification using the primers ISMR4 and BDY1.
2.34 Cloning of BhDYAD eDNA
Well-developed single buds from a diploid Greenland plant were taken for
total RNA isolation using TriZol reagent (Invitrogen) as per manufacturer's
instructions. 4 ~g of the total RNA was used for first strand eDNA synthesis using
the Superscript ™ Choice System (GIBCO BRL). The eDNA was further
amplified for cloning by using the primer pair 5RF3 and Bho3BAM and the primer
pair BhCF and BhCR. The resultant 1.9 kb fragment was cloned in the pGEMT
vector and sequenced.
2.35 Softwares used for DNA and protein sequence analysis
A. Amplify 2.5j3 : Used to design the primers used in this study (William Engels,
Genetics department, University of Wisconsin).
B. Gene Tool: Used for editing and assembling chromatograms after DNA
sequencing. Also used for in silica restriction analysis (Wishart eta/., 2000).
C. DNA Strider: Used for in silica restriction analysis of sequences, in silica
translation of coding regions (Marek, 1988).
D. BlastN and Blast 2N: Used for sequence comparison and alignment of two
DNA sequences (Altschul eta/., 1990).
E. CLUSTALW: Used for pairwise protein and DNA sequence alignments (Higgins, 1994).
2.36 List of oligonucleotide primers used in this study
The DNA sequences are listed in 5'-3' orientation. The oligonucleotides
were synthesized either in-house (CCMB Oligo synthesis facility) or from
Bioserve Biotechnologies (India) Pvt. Ltd., Hyderabad/Sigma Genosys IND
(Sigma Aldrich chemicals Pvt. Ltd., Bangalore).
44
Sequences in italics indicate the restriction enzyme sites wherever applicable.
Oligos used for microsatellite marker polymorphism analysis.
nga 162
nga162F nga162R
nga225
nga225F nga225R
nga168
nga168F nga168R
nga1107
nga1107F nga1107R
nga6
nga6F nga6R
CTCTGTCACTCTTTTCCTCTGG CATGCAATTTGCATCTGAGG
TCTCCCCACTAGTTTTGTGTCC GAAATCCAAATCCCAGAGAGG
GAGGACATGTATAGGAGCCTCG TCGTCTACTGCACTGCCG
CGACGAATCGACAGAATTAGG GCGAAAAAACAAAAAAA TCCA
ATGGAGAAGCTTACACTGATC TGGATTTCTTCCTCTCTTCAC
Oligos used to characterize the TOUSLSED (TSL) locus
TFSP TFOR TREV
GACAATTGCAAGATCCAAGCTTTCAC CTGAGTATCACCACCTTGTCAGGAATC TGCTGTTAGCAAGTGCACTGTTAGCTT
Oligos specific for the NPT/1 (Kanamycin) gene used to test for the presence of T -DNA inserts having this marker.
KANF KANR
GCCAACGCTATGTCCTGATAG GATTGAACAAGATGGATTGCAC
Oligos specific for the tms2 gene (IAAH) used to test for the presence of negatively selectable DYAD gene cassette. Also used to rule out false positives following NAM negative selection.
IAR FIA
AAGCGATCAGGTGTCAGGC GCGTAGTAGGATTTCGACCGA
Oligos used for cloning of the DYAD promoter.
45
PG2R4 PDYBAM
TCTGGGGCTCGTCGACTTTTTGTT ACGGATCCTAGAACAAGAGAAAAACTAAGAGAGATATTT
Oligos for genotyping the dyad allele (CAPs marker).
KNE KNEF KNER KKL KKLF KKLR
CGTCTCTAAGTTGTTTAAGGGGTTA TCACGCAAGTTAATTATGTAAGATGA
AAAGAGAGTAGAACTCGCTCAATGT TATCAACAGCTCGTTACTGGACTG
Oligos for genotyping the dyad-2 allele.
GABILB1 GH06DY1 DyOP5 ISMR4
CCCATTTGGACGTGAATGTAGACAC ATAGAAAGTTCATGAGGTGCGATT GAAGCTAACCAGTGTGGCTCATC TCCGCGAACGTTTACAGTTTAGATACAG
Primers used for TAIL- PCR.
TDNA Left border specific primers. LB1 AACCAGCGTGGACCGCTTGCTG LB2 CAGGGCCAGGCGGTGAAGG LB3 CGATTTCGGAACCACCATCAAAC
Arbitrary primer. AD2 NGTCGA( G/C)(A/T)GANA(A/T)GAA
Primers used to check the zygosity of the ET 60 line.
GLTF Ds5-2 ET60F ET60R
AATGCACCCGAAAGTCTATTTGC CGTTCCGTTTTCGTTTTTTACC CGTTGGTCTTATTGACTTCTAGCTACGAC ACATCCTCGAATTCAAAACTACGAG
Primers used for cloning the BhDYAD eDNA.
5RF3 BH03BAM BhCF BhCR
AGTACGATGCTCGCGAAACGGAATC CGGATCCGGATCTGATGCATCAGTTTCAGGTG AGTGGAGAGGATCGTCGAGAGCA GCATCAGTTTCAGGTGACAGCTTCA
Arabidopsis DYAD gene specific primers used for the amplification and sequencing of BhDYAD.
46
G2F6 G21F1 G23F6 ISMR2 ISMR 1 PG2F6 3RR1 5RF1 G22F5
ATTGGTGGTGAATCCTCTAGTAGCAA CTCTTACCTTTGCTGGAGTCATCAG GACGAGTATTGTACGCCGGTTGAG TTGTTCGTCTGGGTTTTCGAGTGAT GGCAAAGGAGATAACTAATGGAAATCGTA CAACTGTCGACTGAGTATGGAGTTGCC CATGGAAGAGACCTTACCAGTTCACATCA GGAGGAACGAAGATTATCGAGAGCA AACATGTTCCTCTCAGCTAGTTTGTACC
Boechera DYAD gene specific primers used for sequencing and other studies involving the BhOY AD gene.
BOY1 BOY2 BOY3 BOY4 BOYS BOY6 BOY7 BOYS BOY10 BOY11 BCOF BCOR BH03BAM BH05BAM BOYUT3 BOY3UT
CATGAGGTGCGATTCTTCTGTAAAGC CCAAATCACAGAGTCACCTCAAAACAG GGAAGAGGAGGAGCTTGTTA~CATGAC
AGACCAGTGTCACCGATCAGCTTC GTGGCTCCTGGAGGTCAAGATAG GCAACAGAATCAAGCGGTGATG GTTGTTGCAGGTGAGCAAAATCAC ACACACGCGCTCTCTGGTACG AACTCCCTTGGAGAAACGCACTG CAGTATCAGTAGCAGCAGCAAGAG TCTTCGCCATCGTCATCGAC TGCCGACTCTTGTACTGCACAC CGGATCCGGATCTGATGCATCAGTTTCAGGTG CGGATCCGAGCAAAAATCATGAGCGTAAGAT CGATCGGCTAATTACCACAACATTC GCCAAATTATTCCCATATGAATAGTTC
Oligos used for cloning the 4.8 kb BhOY AD gene.
BhPREB GAATTCGGATCCAGGCCTACTATTTGTTTACGACAA BhUTEB GAATTCGGATCCCGATCGGCTAATTACCACAACATTC
Oligos used for amplification of GAPC eDNA as an internal control.
GAPC1 GAPC2
Universal primers
M13F M13R OCSR
CTTGAAGGGTGGTGCCAAGAAGG CCTGTTGTCGCCAACGAAGTCAG
GTAAAACGACGGCCAGT GGAAACAGCTATGACCATG GAACCGAAACCGGCGGTAAGGTAAGG
47
2.37 Media/Reagents - Composition
A. Luria Bertani (LB) medium: For 1 litre- Tryptone (10 g), Yeast extract (5 g),
NaCI (10 g), Agar Agar (1.5%).
B. Tryptone Yeast Mannitol (TYM) medium: For 1 litre- Bacto tryptone (5 g),
Yeast extract (0.5 g), Mannitol (10 g), CaCb (1 mM /litre), Agar Agar (1.5%).
C. Murashige and Skoog (MS) medium 1X: CaCb (4 mM), MgS04 (1.5 mM},
KN03 (18.8 mM), NH4N03 (20.6 mM), KH2P04 (1.25 mM) pH 5.6, Fe-EDTA (20
mM), Minor Salts (1X) (see below for the recipe). pH should be around 5.6-5.7.
D. Fe-EDTA solution: 2.5 g of FeS04.1H20 was dissolved in 400 ml of water. To
this was added 3.36 g of Na-EDTA. The solution was heated in a water bath till it
started to boil. The solution was stirred for 30 minutes while cooling using a
magnetic stirrer and made up the volume to 450 mi. 2.5 ml of this stock solution
was added to a liter of 1X MS solution.
E. Minor nutrients (1000X Stock): H3B03 (70 mM), MnCh (14 mM), CuS04 (0.5
mM), ZnS04 (1 mM), NaMo04 (0.2 mM), NaCI (10 mM), CoCI2 (0.01 mM). 1 ml of
this mix was added to 1 litre of the MS solution to make 1 X minor nutrients.
F. Infiltration medium (for Agrobacterium mediated plant transformation):
Y:z X MS solution, 2% sucrose, 0.05 J.lm Benzyl amino purine, 200 J.llllitre Silwet
(surfactant).
' G. Denaturation solution: 1.5 M NaCI and 0.5 N NaOH.
H. Depurination solution: 0.125 N HCI.
I. Neutralizing solution: 1.5 M Nacl, 0.5 M Tris-CI pH 7.4.
J. Hybridization solution: Equal volumes of 14% SDS and 1M Sodium
phosphate buffer (1M).
K. 10X TBE: For 1 litre- Tris (108 g), 40 ml of 0.5 M EDTA (pH 8.0), Boric acid
(55.6 g).
48
L. SOX TAE: For 1 litre - Tris (242 g), 57.1 ml glacial acetic acid and 100 ml of
0.5 M EDTA (pH 8.0).
M. Spurr's resin: 4 vinyl-cyclohexane-dioxide - 22.8% (v/v), DER-736 resin -
13.09% (v/v), 2-nonelyl-succinic-anhydride - 62.96% (v/v), Dimethyl amino
ethanol - 1.12% (v/v).
N. Alexander's stain: 95 % alcohol -10 ml, Malachite green- 10 mg (1 ml of
1% solution in 95% alcohol), Distilled water - 50 ml, Glycerol - 25 ml, Phenol - 5
g, Chloral hydrate - 5 g, Acid Fuchsin- 50 mg (5 ml of 1 % solution in water),
Orange G - 5 mg (0.5 ml of 1% solution in water), Acetic acid - 2 mi. The pH of
the final staining solution was adjusted to 2.3.
0. DNA extraction buffer: 100 mM Tris (pH-8.0), 50 mM EDTA (pH-8.0), 500
mM NaCI, 10 mM 2-mercaptoethanol and 1.4 % SDS.
P. CTAB buffer: 2% CTAB, 100 mM Tris (pH-8.0), 20 mM EDTA (pH-8.0) and
1.4 M NaCI.
Q. Carnoy's solution: 6:3:1 (Ethanol: Chloroform: Acetic acid).
R. 8% PFA: 100 ml PBS solution was adjusted to pH 11 with NaOH and heated
to 60°C in a water bath. In a fume hood, 8 g of paraformaldehyde was added to
the heated solution and stirred till it dissolved. The solution was cooled on ice
and the pH readjusted to 7 with H2S04.
S. FAA: 4% freshly prepared paraformaldehyde (PFA), 5% acetic acid and 50%
ethanol.
49