Microsatellite instability

Presenter Dr Dhanya A N Moderator Dr Rashmi M V

Contents

• Background• Terminologies • Short sequence repeats • Types of short sequence repeats • Mutation at microsatellite • DNA methyl mismatch repair • Uses of microsatellite • Microsatellite instability

Conti..

• Mechanism of MSI in HNPCC and colorectal cancer

• Histopathology of MSI associated CRC • Immunohistochemistry • MSI assay • Prognosis • Summary • References

Background Gene • DNA- Deoxyribonucleic acid• Double helix• Made up of pairs of nucleotides (A”, “C”, “G” and “T)• DNA is packed tightly around the histone and formed

into chromosome which is present inside the nucleus • DNA codes for amino acids to form proteins by

transcription and translation, which are building blocks of body

Terminologies

• Allele - An allele is an alternative form of a gene (one

member of a pair) that is located at a specific position on a

specific chromosome.

• Homozygous - when identical alleles of the gene are present

on both chromosomes

• Heterozygous -  when two different alleles of the gene are

present on both chromosomes

• Epigenetics - the study of heritable chemical

modification of DNA or chromatin that does

not alter the DNA sequence itself.

– DNA methylation

– Histone acetylation

– mi RNA

DNA methylation

Histone acetylation

Micro RNA

Mutations 1.Point mutations - that causes a

single nucleotide base

substitution in the genetic

material

– Transition – purine by purine

or pyrimidine by pyrimidine

– Transversion – purine by

pyrimidine and vice versa

2. Frame shift mutations is a genetic mutation caused

by insertions or deletions of a

number of nucleotides in a DNA

sequence, due to the triple nature

of gene expression by codons, the

insertion or deletion can change

the reading frame, resulting in a

completely different  translation

 from the original. 

• Loss of heterozygosity - (LOH) is the loss of

function of one allele of a gene in which the

other allele was already inactivated.

Genomic instability

• Chromosomal instability when karyotype

shows abnormal karyotyping in the form of

abnormal number of chromosome

• Microsatellite instability

Definition

• Short sequence repeat (SSR) - These are gene

loci harbor short or long stretches of repeated

nucleotide sequence.

• SSR constitute around 3% of human genome

Types of SSR

1. Microsatellite : when the repeat units consists of 1

to 6 nucleotides, they are commonly seen in non

coding region.

• These repeat sequences are present in everyone at the same

chromosomal locations, but where the number of repeat units

varies from person to person. (polymorphism)

• Dinucleotide repeats are the most common, followed

by mononucleotide and then by trinucleotide.

• Among dinucleotide, most frequent dinucleotide

will be (GT)n, followed by (AT)n.

• Most common trinucleotide repeats will be (TAA)n

• Human genome contains 50,000 to 1,00,000

microsatellite.

They are polymorphic among individuals but are unique

and uniform in length in every tissue in each person

2. Minisatelliete : the repeats are longer consists

of 6-100 nucleotides

3. Satellite DNA :

• Repeat sequence > 100 nucleotide, often

found near the region of the centromere

Microsatellite

Properties of microsatellite

• Locus specific

• Co dominant -  when the contributions of both alleles are

visible in the phenotype.

• Highly polymorphic – provide variable pattern

• Flanking region is highly conserved/ constant in related

species

• PCR based - Can be obtained from small amounts of tissues

Co dominant

Microsatellites are classified according to the type of repeat

sequence

1.Perfect- the repeat sequence is not interrupted

by any base not belonging to the repeat sequence

e.g. TATATATATATATATA.

2.Imperfect- there is a pair of bases between the repeated

sequence that does not match the repeat sequence

e.g. TATATATACGTATATA

3. Interrupted- there is a small sequence within the

repeated sequence that does not match the repeat sequence

e.g. TATATACGTGTATATATATA

4. Composite- the sequence contains two adjacent

distinctive sequence-repeats

e.g. TATATATATAGTGTGTGTGT

Microsatellite mutations

• Since it’s a region of repetitive sequence of nucleotide,

while replication and recombination they are very much

prone to mutations

• Mainly 2 types of mutations occur at this region

– Unequal crossing over

– Replication slippage

Unequal crossing over • Microsatellite repetitive regions forms a hairpin during synapsis, • During crossing over unequal length of each chromosome will

be exchanged • One chromosome will receive a larger fragment because of the

larger number of microsatellite repeatsThe homologues chromosome receive a smaller number of repeats

Unequal crossing over

Replication slippage

• During DNA replication DNA polymerase slippage can occur in

which one DNA strand temporarily dissociates from the other and

rapidly rebinds in a different position, leading to base-pairing errors

and forms IDL, and continue the lengthening of the new strand

• An increase in the number of repeats (i.e. additions) occur if IDL is

on daughter strand or a decreased number of repeats (i.e. deletions)

occur if IDL occurs on parent strand

Replication slippage

DNA methyl mismatch repair mechanism

• Three important proteins - MutS, MutL, MutH

• The important genes responsible for the MMR proteins

are PMS2, MLH1, MSH2 PMS1, and MLH3, MSH6.

• After replication the parent strand will be methylated and

daughter strand is not methylated, so the MMR protein

can recognize the parent strand

• MutS will identify the mismatch nucleotide error

• MutL will recognize the parent strand and brings the

mismatch strand closer to it for cleaving

• MutH will act as endonuclease and forms a nick

• Then UvrD protien acts as helicase and separates the

DNA strand and cleave the mutated strand

• The gap is filled with new nucleotides by DNA

polymerase enzyme and ligase enzyme

Methyl mismatch repair

Advantages of microsatellite

1. Gene mapping

2. Molecular forensics

3. Parentage testing

4. Analysis of genetic structure of populations

5. Assessment of phylogenetic relationships

Microsatellite instability

• It is caused by mutational inactivation of genes

involved in DNA repair

• DNA polymerase sometimes makes errors

incorporating the correct number of bases

during replication of long repetitive DNA

sequences, such as microsatellites.

• The MMR system consists of a family of

proteins that detect DNA replication errors, in

which the newly synthesized strand has

incorporated the wrong nucleotide

• Mutation rate ranging from 1 in 10² to 1 in 106

nucleotides per gene per cell

• These errors can be recognized and repaired by

the MMR system.

• The important genes responsible for the MMR

factors are PMS2, MLH1, MSH2 PMS1, and

MLH3, MSH6

• Any mutations that occurs to these genes will lead

to non functional MMR, that lead to increase or

decrease of microsatellite. This is the basis of MSI

MMR gene mutations

Hereditary

• Germ line mutation

– Point mutation

– Frame shift mutation

Sporadic/ Epigenetic mutation

• Hyper methylation – of cytosine at CpG region

Microsatellite instability

• Microsatellite instability is associated with many tumor

conditions

– HNPCC/ Colorectal carcinoma

– Endometrial carcinoma

– Stomach carcinoma

– Ovarian carcinoma

– Urinary tract cancer

– Small intestine carcinoma

Microsatellite instability in HNPCC/lynch syndrome and colorectal carcinoma

MSI in HNPCC/ Lynch syndrome

• HNPCC is caused by inherited mutation in genes that

encode proteins responsible for the detection,

excision, repair of errors that occur during DNA

replication

• Majority will have MSH2 or MLH1 gene mutation or

epigenetic silencing.

MSI in colorectal carcinoma

• Two molecular pathways are involved in CRC

– APC/β-catenin pathway – 80% sporadic colon tumors

includes mutation of APC gene early in the neoplastic

process

– Microsatellite instability pathway –20% sporadic

associated with defects in DNA MMR and

accumulation of mutated microsatellite repeats

APC/β-catenin pathway

• APC promotes degradation of β catenin

• Loss of APC lead to accumulation of β catenin

• β catenin translocate to nucleus bind to DNA binding

factor TCF, transcription of MYC and cyclin D1 genes

which lead to cell proliferation

• Along with this, mutation of K-RAS promote the growth

and inhibit cell apoptosis

• Tumor suppressor genes SMAD2, SMAD4 also

mutate which inhibit the TGF β signaling which lead

to unrestrained cell growth

• Tp53 mutation also occurs in the later stage of cancer

• Epigenetic mutation, Hyper methylation occurs at

CpG areas of tumor suppressor genes

APC/β-catenin pathway

Microsatellite instabilitypathway

• Microsatellite sometimes also seen in coding region and

encodes typeII TGF β receptor, because TGF β inhibits

the cell division and also encodes pro apoptotic protein

BAX which regulates the cell division

• Any mutation in microsatellite, abnormal typeII TGF β

receptor and BAX protein formed lead to cell proliferation

• Mutation in DNA MMR genes MHL1, MSH2,

MSH6, PMS1, PMS2 lead to abnormal MMR

system proteins lead to microsatellite instability

• Hypermethylation at CpG island of MLH1

reduces its expression and repair function

• It is associate with BRAF gene mutation

Microsatellite instability

When to perform MSI testing ?

• Amsterdam criteria

• Bethesda criteria

Amsterdam Criteria

1. At least 3 relatives with CRC (one must be a first-degree relative of the other two) or a Lynch syndrome–associated cancer*

2. CRC involving at least 2 successive generations3. One or more cancer cases before age 50 years4. Familial adenomatous polyposis should be

excluded5. Tumors should be verified by histologic

examination

Bethesda criteria

1. Colorectal cancer diagnosed in an individual who is younger than 50 y.

2. Presence of multiple, synchronous or metachronous Lynch syndrome-associated tumors, regardless of age.

3. Colorectal cancer with MSI-high histology diagnosed in a patient who is younger than 60 y.

4. Colorectal cancer diagnosed in 1 or more first

degree relatives with a Lynch syndrome-related

tumor, with 1 of the cancers being diagnosed in a

patient younger than 50 y.

5. Colorectal cancer diagnosed in 2 or more first

or second-degree relatives with LS-related

tumors, regardless of age.

• The CRC occur due to MSI will have unique clinical

and pathological features

– more likely to arise in the proximal colon,

– less likely to be invasive, less aggressive

– less likely to have mutations in KRAS or p53,

– younger patients

– has a better prognosis

Histopathology Signet Ring Cells:

• The presence of tumor cells with an intracytoplasmic mucin-filled vacuole causing lateral compression of the nucleus, whether within extracellular mucin lakes or infiltrating directly in stroma.

Mucinous (Colloid) Histology:

• Extracellular mucin accumulation bounded either by neoplastic epithelium or by host stroma

Medullary carcinoma

• The presence of an expansile appearance to the advancing tumor margin when viewed at low power

• subtype of poor differentiation, consisting of nests, trabecula, and sheets of small- to medium-sized tumor cells with scant to abundant eosinophilic cytoplasm, frequent mitotic figures and a distinct stromal population of small lymphocytes

Necrotic

• characteristic

necrotic debris in glandular lumina, so-called “dirty necrosis”

Host responseCrohn-like Lymphoid Reaction

• Composed of lymphoid

follicles of different sizes with germinal centers at the tumor edge

• In subserosal or pricolonic fat• Two or more large lymphoid

aggregates in a section are required for the this feature

• Resemble crohn trans mural inflammation

Tumor intramural infiltrating lymphocytes • The presence of

small round lymphocytes within the tumor epithelium

Immunohistochemistry (IHC)

• Immunohistochemical analysis is done using

antibodies against the MLH1, MSH2, and MSH6

and PMS1 proteins to identify carriers of MMR gene

mutations.

• Immunohistochemical staining can be performed on

formalin-fixed, paraffin-embedded tissue sections

IHC staining for the mismatch repair proteins is interpreted as

follows:

• Loss of MLH1 and PMS2 protein staining may indicate MLH1

mutation

• Loss of PMS2 protein staining usually indicates a PMS2

mutation

• Loss of MSH2 and MSH6 protein staining usually indicates a

MSH2 mutation.

• Loss of MSH6 protein staining usually indicates a MSH6

mutation.

Limitations of IHC

• Requires well experienced pathologists

• Difficult in interpretation, may vary the results

• Improper or patchy staining

• Defective MMR gene may still be antigenic

• Less sensitive

MSI analysis

DNA isolation

• Genomic DNA of normal and tumor

tissue was isolated from the paraffin-embedded

material by taking tissue punches (diameter, 0.6 mm)

from tumor and normal areas selected on the basis of

a HE-stained slide.

DNA isolation

Tissue fragments (proteinase K chelex resin)

Adding100 to 200 microliter lysis buffer overnight incubation at 56 CDissolved DNA is separated from cell debris by

centrifugation for 10 min ( 13,000 rpm)

The DNA-containing supernatant is separated from the Chelex resin

(Chelex resin inhibits polymerase activity)

Transferred to another test tube

Markers for MSI Marker Gene MS repeats Chromosomal

location

D2S123 Linked to MHS2 CA(n) 2p16

D5S346 Linked to APC CA(n) 5q22-23

D17S250 Linked to p53 CA(n) 17q12

BAT-25 C-kit A(25) 4q12

BAT-26 MSH2 A(26) 2p21

Pentaplex panel of mononucleotide repeat markers

Markers Genes MS repeats Chromosomal location

BAT-25 c-kit A(25) 4q12

BAT-26 MSH2 A(26) 2p21

NR-21 SLC7A8 T(21) 14q11

NR-24 Zinc finger 2 (ZNF-2) T(24) 2q11

NR-27 Inhibitor of apoptosis protein-1

T(27) 11q22

• Multiplex fluorescent PCR is done to identify the MSI

• Here the markers will be labeled with the fluorescent

dyes

• Amplified PCR products are passed through gel

electrophoresis

• The tumor gene length is compared with the normal gene

and the interpretation is done

Tumors were classified as

(a) tumors with instability for >30%

of the markers ( > one marker ) (MSI-H),

(b) tumors with instability for <30% of

the markers ( only one marker ) (MSI-L),

(c) tumors with no instability [microsatellite stability (MSS)]

Prognosis

• Tests for MSI can be useful prognostic tool

• Have a better overall survival rate

• Responsive to chemotherapy like 5-FU than

tumors without MSI

Summary

References

1. Kumar, Abbas, Aster. Neoplasia in Robbins and Cotran Pathologic Basis of Disease. 9th ed. New Delhi: Reed Elsevier India Private limited; 2014.

2. Turner RJ. The Gastrointestinal Tract in Robbins and Cotran Pathologic Basis of Disease. 9th ed. New Delhi: Reed Elsevier India Private limited; 2014.

3. Antonarakis SE. Human Genome sequence and variation in Vogel and Motulsky’s Human Genetics. 4 th ed. London: Springer; 2010. p. 31-54.4. Horshthemke B. Epigenetics in Vogel and Motulsky’s Human Genetics. 4 th ed. London: Springer; 2010. p. 299- 318.

5.de Jong AE, van Puijenbroek M, Hendriks Y, Tops C, Wijnen J, Ausems MG, et al. Microsatellite Instability immunohistochemistry, and Additional PMS2 Staining in Suspected Hereditary Nonpolyposis Colorectal Cancer. Clin Cancer Res. 2004 Feb 1;10(3):972-80

6. Boland CR, Goel A. Microsatellite Instability in Colorectal Cancer. Gastroenterology. 2010 Jun;138(6):2073-2087.7. Bresalier RS. Colorectal Cancer in Sleisenger’s and Fordtran Gastrointestinal and liver diseases. 10 ed. Philadelphia: Elsevier; p 2248-2296