1

Inflammatory Molecule, PSGL-1, Deficiency Activates Macrophages to Promote Colorectal

Cancer Growth Through NF-κB Signaling

Jiangchao Li#1, Zeqi Zhou#1, Xiaohan Zhang1, Li Zheng1, Dan He2，Yuxiang Ye1, Qian-Qian Zhang1,

Cui-Ling Qi1, Xiao-Dong He1, Chen Yu4, Chun-kui Shao2，Liang Qiao3，Lijing Wang*1

1.Vascular Biology Research Institute, School of Basic Course, Guangdong Pharmaceutical University,

Guangzhou 510006, China;

2. Department of Pathology, The Third Affiliated Hospital of Sun Yat-Sen University, Guangzhou

510630, China.

3. Storr Liver Centre, the Westmead Institute for Medical Research, the University of Sydney at the

Westmead, NSW 2145, Australia.

4.Department of Gastroenterology, The First Affiliated Hospital of Pharmaceutical University,

Guangzhou, China.

Running title: PSGL-1 Deficiency Promotes Intestinal Tumor Growth

#These authors contributed to this work equally.

*Corresponding authors: Lijing Wang (E-mail: wanglijing62@163.com)

2

Abstract

P-selectin glycoprotein ligand 1 (SELPLG/PSGL-1) is an inflammatory molecule that is functionally

related to immune cell differentiation and leukocyte mobilization. However, the role of PSGL-1 in

tumor development remains unknown. Therefore, this study investigates the mechanistic role of

PSGL-1 in the development of intestinal tumors in colorectal cancer (CRC). ApcMin/+ mice, are

highly susceptible to spontaneous intestinal adenoma formation, and were crossbred with PSGL1-null

mice to generate compound transgenic mice with a ApcMin/+;PSGL-1-/- genotype. The incidence and

pathological features of the intestinal tumors were compared between the ApcMin/+ mice and

ApcMin/+;PSGL-1-/- mice. Importantly, PSGL-1 deficient mice showed increased susceptibility to

develop intestinal tumors and accelerated tumor growth. Mechanistically, increased production of the

mouse chemokine ligand 9 (CCL9/MIP-1γ) was found in the PSGL-1 deficient mice, and the

macrophages are likely the major source of MIP-1γ. Studies in vitro demonstrated that

macrophage-derived MIP-1γ promoted CRC tumor cell growth through activating NF-κB signaling.

Conversely, restoration of the PSGL-1 signaling via bone marrow transplantation reduced MIP-1γ

production and attenuated the ability of ApcMin/+;PSGL-1-/- mice to generate intestinal tumors. In

human CRC clinical specimens, the presence of PSGL-1 positive cells was associated with a favorable

TNM staging and decreased lymph node metastasis.

Implications: PSGL-1 deficiency and inflammation render intestinal tissue more vulnerable to develop

colorectal tumors through a MIP-1γ/NF-κB signaling axis.

KEYWORDS: PSGL-1, MIP-1γ, ApcMin/+ mice, Intestinal tumor

3

Introduction

Colorectal cancer (CRC) is one of the leading causes of cancer-related death in developed countries and

some developing countries(1,2). Genetic alterations of the tumor-suppressor genes such as mutation of

Adenomatous Polyposis Coli (APC) have been shown to drive the transformation of normal epithelium

to adenomatous polyp and finally lead to invasive CRC(3,4). Apart from the altered genetic

susceptibility, chronic inflammation in the gut has also been implicated as a critical risk factor for the

development of CRC(5).

P-selectin glycoprotein ligand 1 (PSGL-1) is a member of the selection family of adhesion molecules.

It is mainly expressed in immune and inflammatory cells, and is involved in the recruitment of immune

and inflammatory cells to the site of inflammation by rolling and tethering(6). PSGL-1 is also essential

for cell differentiation as deficiency of PSGL-1 was found to affect the differentiation of myeloid cells

and maturation of lymphocytes.(7,8) P-selectin deficient mice manifested impaired leukocyte adhesion

which could be restored by administration of soluble P-selectin(9). Previous studies have indicated that

P-selectin is important in regulating leukocyte adhesion. PSGL-1 can form a constitutive complex with

Nef-associated factor 1 (Naf1), which is then phosphorylated by Src family kinase and subsequent

recruitment of phosphoinositide-3-OH kinase p85-p110 delta heterodimer, leading to activation of

leukocyte integrins(9). These studies suggest that PSGL-1 is essential for inflammatory response.

In process of inflammatory response, Macrophages play a key role, PSGL-1 and P-selectin are

expressed in peritoneal macrophages(10). Macrophages secrete many cytokines and chemkines which

can provoke either anti-tumor or pro-tumor immune response. In procaryotic organism, chemokines are

small molecule proteins with crucial roles in mediating inflammatory responses and tumor immune

responses, in that they can direct trafficking of leukocytes into tumor microenvironment and guide cell

movements away from poisons in response to cellular insults(11). In addition, chemokines are critical

to early development (for example, they can facilitate the movement of sperm towards the egg during

4

fertilization and subsequent phases of development)(12). Recent studies have shown that chemokines

can either promote or inhibit tumor growth and metastasis(13-16). Thus, the biological functions of

chemokines are rather complicated and are likely cellular context dependent.

In this study, we investigated if PSGL-1 deficiency facilitates the growth of CRC using ApcMin/+

mice as a model.

Materials and Methods

Mice and animal care

ApcMin/+ mice and P-selectin glycoprotein ligand-1 (PSGL-1) homozygous knockout mice were

purchased from Jackson laboratory (Stock No:002020, https://www.jax.org/strain/002020 and Stock

No:004201, https://www.jax.org/strain/004201) by Prof. Jianhguo Geng. The two kind of mice are

C57BL/6 background (C57). ApcMin/+ mice were crossbred with PSGL-1-/- mice to generate

ApcMin/+;PSGL-1-/- mice(S. Fig. 1). Mice were housed under specific pathogen-free conditions in

Animal Center of Guangdong Pharmaceutical University. All animal experiments were performed in

accordance with institutional guidelines and were approved by the Animal Ethics Committee of

Guangdong Pharmaceutical University.

Analysis of intestinal tumors

After mice being sacrificed, the intestines were removed and sliced longitudinally, rinsed with 0.9%

NaCl, fixed with 4% paraformaldehyde (PFA) for overnight, and spread onto slides which were treated

with 3-Aminopropyl-Triethoxysilane(APES). Each small intestine was divided into three equal sections:

proximal, middle, and distal segments. Then stained with 0.1% methylene blue. The number of tumors

was counted in each section, and a digital caliper was used to measure the tumor length (L) and width

(W) under the dissecting microscope. Tumor diameter is equal to or less than 2 mm were indicated as

microadenomas, while tumor diameter more than 2 mm indicated adenomena (S. Fig. 2) and

reference(17). Tumor volume was calculated by the formula V= 0.5 ×L×W2. In order to assess and

5

compare the tumor incidence in each group, all separate intestinal sections from each animal were

rolled into concentric circles that it mean to “restore” intestines construction. The “restored” intestines

were then embedded in paraffin blocks, cut into sections of 5 μm thickness, and then are used in H&E

or IHC procedures using assess the intestinal tumors foci under the microscope or detect.

H&E staining, Immunohistochemistry and immunofluorescent staining

Intestinal tumors were fixed in 4% formalin overnight, then were rinsed with PBS, subsequently

dehydrated in 35, 50, and 75% ethanol, and then embedded in paraffin. 5μm sections were

deparrafinized in xylene and rehydrated in 100, 95, 70, and 50% ethanol then PBS. The sections was

carried out H&E staining as our previously described. The score of H&E staining was assessed and

rating by tumor Pathologist. Immunohistochemistry (IHC) was performed as described on the website

of Cell Signaling Technology, Inc (MA, USA). Primary antibodies include Ki67 (1:100, Abcam, USA),

CD34 (1:50, Abcam, USA), PSGL-1 antibody(1:50, Cat: sc-18855, Santa Cruze) ， CCR1

antibody(1:100, Cat:BA2231-1, Boster, Wuhan, China), pp65 antibody (1:500, Phosho-NF-κB p65

(93H1), CST, MA, USA), TNF-α(1:100, Boster, Wuhan, China), Second Antibody detection

system(LSAB™2 Kits, Universal，HRP anti-Rabbit/Mouse, Glostrup, Denmark). The slides were

pre-treated with EDTA solution (pH=8.5) for antigen retrieval, and then incubated with the primary

antibody at 4℃ overnight. Second antibody detection system was used to visualize IHC staining results.

For immunofluorescent staining, the tumor specimens were fixed in 4% PFA and subsequently

incubated in PBS containing 30% sucrose and frozen at ℃−80 . The frozen sections were incubated with

anti-TNF-α or anti-pp65 antibody and imaged using confocal microscopy (Leica).

Cell culture and transfection

Colorectal carcinoma cell lines HCT-116, SW620, and SW480, were obtained from the cell bank of the

Chinese Academy of Sciences (Shanghai, China) in recent 2 years. They were authenticated by

Guangzhou Cellcook Cell Biotechnology, LTD. using PowerPlex® 16 HS System (Promega). and The

6

murine tumor cell lines CT26 ( derived colorectal carcinoma) and murine macrophage RAW264.7

purchased from the cell bank of the Chinese Academy of Sciences were cultured less than 10 weeks

from frozen stock for this study. Primary culture macrophage was collected from peritoneal wash

obtained with 0.9% NaCl. The cells were incubated at 37°C in a humidified chamber containing 5%

CO2 and cultured with Dulbecco’s Modified Eagle’s Medium (DMEM, GIBCO, USA) with 10% fetal

bovine serum, plus 100 U/mL penicillin, and 100 μg/mL streptomycin. Lipofectamine 2000 (Invitrogen,

USA) was used to transfect siRNAs to Raw 264.7 cells (final concentration 100 nM). Human PSGL-1

siRNA and control siRNA were purchased from Ribobio Inc. (Guangzhou, China), and transfections

were performed using lipofectamine 2000(Invitrogen, USA).

Measurement of serum cytokines

Serum sample from each mouse was obtained by centrifuging the whole blood at 3000g for 5 minutes.

Cytokines in each sample were analyzed using the RayBio® Mouse Cytokine Antibody Array Kit or

Mip-1γ Elisa kit (Raybiotech, Inc., GA, USA) as described in details in the manufacturer instructions.

Western blotting

Detailed procedures for Western blotting were described in our previous publications(?). Briefly, whole

proteins from the intestinal tumors and cultured CRC cells were extracted using the lysis buffer (Cell

Signaling Technology, Inc, MA, USA). Approximately 30μg of protein from each sample was

subjected to 10% SDS-PAGE by electrophoresis under reducing conditions and transferred to

polyvinylidene fluoride (PVDF) membranes (Millipore Corporation, Billerica, MA, USA), and blocked

overnight with 5% skim milk for 1 h. The membranes were then incubated at 4°C for overnight,

washed in TBST, and incubated with the secondary antibody (anti American hamster horseradish

peroxidase-IgG). The blots were then developed with chemiluminescent (ECL) reagents and imaged on

X-ray film by autoradiography. Anti β-actin or anti-Lamin A was used as the loading control. Quantity

One software (Bio-Rad, CA, USA) was used to measure the band intensity. Anti-bodyTNF-α

body(Boster, Wuhan, China), Anti-body pP65(Cat: #3033, CST, USA), antibody Lamin A(Boster,

7

Wuhan, China), antibody β-actin(Cat:#4970, CST, USA).

Flow cytometry analysis

Tumor tissues and spleen were made into single cell suspensions in PBS supplemented with 1% BSA

as previously described. Blood samples were collected and the red blood cells were lyzed with lysis

buffer (Life technologies, NY, USA). Gallios Flow Cytometer (Beckman, CA, USA ) was used to

determine the expression of F4/80 which is regarded as macrophage surface markers. The anti-mouse

F4/80-FITC antibody (clone: REA126) were purchased from Miltenyl Biotec Cologne Germany,

anti-mouse CD3e PE-Cy5 (clone:145-2C11), anti-mouse CD8a PE (clone:53-6.7), anti-mouse CD4

FITC (clone:GK1.5), anti-mouse CD45RO APC, anti-mouse CD19 PE (clone:1D3), anti-mouse CD11b

Alexa Fluor488 (clone:M1/70), anti-mouse CD11c (clone:53-0114) all were purchased from

ebioscience Inc.(MA, USA). An isotope control was included in the quadrant analysis. The percentage

of cells of interest, as indicated by mean fluorescence intensity, was analyzed using FlowJo software

(Tree Star, Inc. OR, USA). At least three independent experiments were conducted for each group.

Detecting DNA Content by Flow Cytometry

Cells were seeded to 6-well plates at 30% confluence. Serum-free medium with L-Mimosine (400 lM)

was added for G1 synchronization. After 24 hours, medium containing 10% fetal bovine serum(FBS)

was added for an additional 12 hours. Cells were fixed in 75% ethanol, stained with 100ng/ml

4',6-diamidino-2-phenylindole (DAPI), and analyzed by flow cytometry. The results of cell cycle were

analyzed with FlowJo software (Tree Star, Inc. OR, USA) according to the manufacturer’s instructions.

RNA isolation and Real time PCR

Total RNA of blood and spleen cells was isolated using Trizol reagent (Invitrogen, USA) according to

the manufacturer's instructions. The first cDNA chain was obtained using oligo dT primers with cDNA

Reverse transcription kit (Takara，Japan). Quatitative PCR(qPCR) was performed with PCR Master

Mix(Takara, Japan) on Applied Biosystems 7500. The PCR amplification was carried out with a 3-min

8

pre-denaturation at 95℃min, and 35 cycles: 95℃ for 35s; 57℃, for 40s and 72℃for 50 s, followed by a

10-min extension at 72℃. GAPDH served as an internal control to normalize the starting cDNA levels.

PCR primers were listed as follows: Mip-1γ: F:5’-3’ CCCTCTCCTTCCTCATTCTTACA, R: 5’-3’

AGTCTTGAAAGCCCATGTGAAA, which amplify fragment located in C-C motif chemokine

9,192-332.

PCR array

To explore which signal pathway accelerated tumor growth after stimulating by MIP-1γ. We analyze

the mRNA expression level of the signal pathways relevant genes with RT2 Profiler PCR Arrays kit

(Qiagen kit,Cat:PAMM-014, CA, USA). According to the experimental workflow, we prepared sample

as 25 ng of RNA and obtained cDNA with the RT² PreAMP cDNA Synthesis Kit, and analysed the

PCR data with analysis software on web site of Qiagen. The RT2 Profiler PCR Array incorporates

laboratory-verified assays for 96 pathway-focused genes, 5 housekeeping genes for normalization, and

controls that check for sample quality and reaction quality .

Enzyme-linked immunosorbent assay

The serum levels of MIP-1γ were analyzed using commercially available enzyme-linked

immunosorbent assay (Mouse MIP-1 gamma ELISA) (Cat No.: P51670, Raybiotech, Inc., USA). The

serum was centrifuged and then stored at −80◦C until analysis. The measurements were conducted

according to the manufacturer’s instructions. All samples were assayed in triplicate, and mean values

were calculated.

Proliferation assay

Cell Counting Kit-8 (Dojindo, Japan) was used to determine the proliferation rates of a series of cancer

and control cell lines. Cells were seeded at a density of 1×103 cells/well on 96-well plates and cultured

for 5 days (n = 4 per cell line).

Bone marrow transplantation

9

Recipient mice were given full-body irradiation at the dose of 8.5Gy within 3 times, 5 min each time..

Donor mice (C57, male, 6-8 weeks old) were sacrificed under anesthesia by diethyl ether. Following a

3-week recovery period, the mice were further subjected to the experimental conditions described

elsewhere in the manuscript and animals were monitored for tumor development.

Statistical analysis

SPSS 16.0 was used to analyze the results expressed as the mean ± SD. The mRNA level in cell lines

and tissue was compared using paired Student t test to examine the differences between groups. The

graph was drawn and performed with Prism5 software (GraphPad). A X2 test or Fisher’s exact test was

used to analyze the significance of PSGL-1 expression in the tumor tissue and notumor tumor. The

clinical pathologic factors, including age, sex, histologic, and pathologic stage, invasion, as well as the

TNM stage, were considered, and a Log-rank test for survival was performed to compare the positive

and negative staining results. Kaplan-Meier curves were plotted according to overall survival. Cox

proportional hazards models were adopted to analyze all clinical factors. P<0.05 was considered

significant.

Results

PSGL-1-/- mice exhibit increased susceptibility to develop intestinal tumors

To investigate if PSGL-1 deficiency would affect the susceptibility of mice to develop intestinal tumors,

we crossbred ApcMin/+ mice with PSGL-1-/- mice to generate ApcMin/+;PSGL-1-/- mice, as detailed in the

Supplemental Figure 1 (S Fig. 1). As shown in Fig. 1A, compared to ApcMin/+ mice, ApcMin/+;PSGL-1-/-

mice were significantly more susceptible to develop intestinal tumors as macroscopically revealed by

methylene blue staining of in different intestinal segments ( ileum section) (Fig.1A), and quantitatively

demonstrated by the markedly increased tumor volume(Fig.1B) and tumor number (Fig.1C) of the

intestinal tumors (including microadenoma, ≤2 mm in ameter; and adenoma, >2 mm in diameter) in the

ApcMin/+;PSGL-1-/- mice at 9, 18 and 24 weeks of treatment (* P<0.05; ** P<0.01; *** P<0.01). And

10

these mice displayed more signifcicantly worse survival compared to the ApcMin/+ mice (Fig. 1D,

P<0.01). In addition, ApcMin/+;PSGL-1-/- mice lose more body weight than the ApcMin/+ mice after 9, 18

and 24 weeks of treatment (S Fig. 3). To further confirm the role of PSGL-1 signaling in intestinal

carcinogenesis, we conducted a study where the PSGL-1 signalling was eliminated by total body

iradiation and then restored by transplanting the normal bone marrow cells from the wild type C57BL/6

mice. As expected, following tumorigenic treatment, there was no significant difference in the tumor

incidence between the C57:ApcMin/+;PSGL-1-/- mice chimeras and the C57:ApcMin/+ mice(S Fig.8,

P<0.01). Clearly, PSGL-1 deficiency promotes intestinal tumorigenesis.

PSGL-1-/- mice displayed an accelerated tumor progression

To further reveal the impact of PSGL-1 deficiency on the development and progression of

intestinal tumors, the pathological features of the intestinal tumor tissues from each group of

mice were microscopically analyzed. An overview of the H&E stained entire intestines revealed

more tumors in the ApcMin/+;PSGL-1-/- mice than in the ApcMin/+ mice (Fig. 2A). Three stages of

tumor development were observed, ranging from the very mild hyperplasia to the adenoma and

finally the adenocarcinoma, as exemplified in the intestines of ApcMin/+ mice (Fig. 2B).

Detailed breakdown analysis revealed that 37.7% of the intestinal tumors in ApcMin/+ mice were

hyperplasia, 52.5% were adenomas, and 9.8% were adenocarcinomas. In contrast, most intestinal

tumors in the ApcMin/+;PSGL-1-/- mice were adenomas and adenocarinomas (Fig. 2C, ** P<0.01).

By immunohistochemistry (IHC), the tumors in the ApcMin/+;PSGL-1-/- mice were more

proliferative than the tumors of the ApcMin/+ mice as demonstrated by the significantly increased

number of Ki67 positive cells in the former group (Figs. 2D and 2E, * P<0.05). Tumors in the

ApcMin/+;PSGL-1-/- mice also showed increased microvascular density as indicated by the

increased expression of CD34 (Figs. 2F and 2G, * P<0.05).

Macrophage inflammatory protein 1-gamma is up-regulated in PSGL-1-/- mice

PSGL-1 is mainly expressed in inflammatory cells including leukocytes, and can be recruited to and

11

accumulate in tumor or adjacent non-tumoral tissues. We have revealed an increase of neutrophils in

blood of PSGL-1-/- mice (S Fig. 4), and this is consistent with the mouse data provided by Yang J(18).

Neutrophil and other type immune cells may explain the tumor fast growth or tumor development in

tumor environment(19). In contrast, there was a marked decrease in the number of leukocytes in tumor

of the ApcMin/+;PSGL-1-/- mice as compared to ApcMin/+ mice, suggesting that PSGL-1 knock out would

not increase but decrease immune cell recruitment in ApcMin/+ and PSGL-1-/- tumor-bearing mice(S Fig.

5). The other potential mechanism is that PSGL-1 may affect the differentiation of hematopoietic stem

cells and disturb the cells of myeloid lineage to develop into granulocytes, monocytes, megakaryocytes

and dendritic cells, thereby affecting the homeostasis of immune system, and impairing the

self-renewal and differentiation of hematopoietic stem cells(20). In order to reveal the mechanisms by

which PSGL-1 deficiency contributes to the tumor development, we used a commercial cytokine array

kit (the RayBio® Mouse Cytokine Antibody Array Kit, USA) to determine the cytokine levels in the

serum samples of tumor-free PSGL-1 deficient mice and wild type mice. As shown in Fig. 3A. higher

serum level of macrophage inflammatory protein 1-gamma (MIP-1γ, also known as MIP-1γ) was found

in PSGL-1-/- mice than in wild type mice (Dots were semi-quantitatively scanned with Image J software

As shown in Fig3A, PSGL-1-/-:C57=3.7, normalized by GAPDH).

Meanwhile, significantly higher level of MIP-1γ mRNA was found in the white cells of PSGL-1-/-

and ApcMin/+;PSGL-1-/- mice, as compared to those of the C57 mice and ApcMin/+ mice, respectively (**,

P<0.01, ***<0.001) (Fig. 3B). Using ELISA, we found the similar patterns of the serum MIP-1γ

protein in these mice (Fig. 3C. a: C57 and PSGL-1-/- mice without tumors; b: C57 and PSGL-1-/- mice

bearing tumors but less than four weeks. * P<0.05).

In order to investigate the source of MIP-1γ, we isolated macrophages from the mouse peripheral blood

and spleen tissues by flow cytometry using F4/80 as a marker. Collected cells were first stained with

anti-CD45 (a marker for bone marrow-derived cell), and CD45+ cells were gated (Fig. 3D, a). The cells

were then stained for F4/80. We observed a significantly increased percentage of F4/80+ cells in blood

12

(Fig. 3D, b) and spleen (Fig. 3D, c) of the PSGL-1-/- and ApcMin/+;PSGL-1-/- mice, as compared to the

C57 and ApcMin/+ mice, respectively (*P<0.05, **P<0.01). Furthermore, the macrophages derived from

the ApcMin/+;PSGL-1-/- mice showed a significantly increased expression of MIP-1γ mRNA (Fig. 3E)

and protein (Fig. 3F), as opposed to the ApcMin/+ mice (** P<0.05). In addition, we co-localized F4/80

expression with PSGL-1 expression in ApcMin/+ mice and human colorectal tissue(S Fig.10).

To confirm these data, we knocked down PSGL-1 in Raw 264.7 cells (a macrophage cell line), and

measured the expression of MIP-1γ in the treated cell lysates. Knockdown of PSGL-1 by si-PSGL1

(Fig. G) led to a significant increase of MIP-1γ (Fig. H, *P<0.01). To reconstruct the PSGL-1

signaling, we performed bone marrow transplantation assay. ApcMin/+ mice or ApcMin/+;PSGL-1-/- were

lethally irradiated to wipe out the bone marrow, followed by reconstitution of bone marrow with that

from C57BL/6 mice. This way, we generated C57/PSGL-1+/+ chimeras. As shown in S Fig. 8, following

an 8-week recovery, there was a significant decrease in the serum level of MIP-1γ in the bone marrow

recipient mice, and no significant compared to ApcMin+ mice.

MIP-1γ promotes tumor cell growth in vitro

The above data indicate that MIP-1γ derived from the macrophages may play a tumorigenic role in the

intestinal tumorigenesis in PSGL-1 deficiency mice. We further confirmed the mRNA expression of

MIP-1γ in the macrophages isolated from mouse peripheral blood and Raw264.7 cells (MIP-1γ primer

amplify: C-C motif chemokine 9,192-332), and MIP-1γ is not found in human tumor cell such as

HCT116, SW620, SW480 (Fig. 4A), which expression were confirmed only in mouse before study(21).

Previous studies have shown that the receptor for MIP-1γ termed CCR1 is generally present on the

lymphocytes and tumor cells(22-28), and this receptor may facilitate tumor metastasis(29,30). We

confirmed the expression of CCR1 in the intestinal tumor tissues of ApcMin/+ mice by IHC analysis and

murine tumor cell line CT26 by Western Blot (Fig. 4B).

To further confirm the tumorigenic role of MIP-1γ, colorectal tumor cells(CT26) were treated with

enxogenous MIP-1γ, and the effect on cell growth and cell cycle progression was studied. As shown in

13

Fig. 4C, MIP-1γ could significantly stimulate the tumor cell growth in a time- and dose-dependent

manner, and these changes were associated with an increased proportion of G2/M cells (Fig. 4D) and

increased ability of cells to migrate (Fig. 4E). These effects were partially reversed by the treatment of

cells with the neutralizing antibody against MIP-1γ (data not shown). Taken together, these results

indicate that MIP-1γ may exert a tumorigenic role.

MIP-1γ activates NF-κB pathway in tumor cells

To investigate the molecular mechanisms of MIP-1γ promoting tumorigenesis, a commercial PCR

array kit (S Table 2) was used to evaluate the possible singling pathway(s) that is (are) activated by

MIP-1γ. We use qPCR to detecting mRNA of the MIP-1γ treatment group and control group using

CT26 cell lines. As shown in Fig. 5A, the mRNA expression of several genes related to the NF-κB

pathway were up-regulated in tumor cells treated by MIP-1γ. Furthermore, significantly increased

expression level of TNF-α protein was found in the intestinal tumor tissues of the ApcMin/+;PSGL-1-/-

mice compared to ApcMin/+ mice, as determined by ELISA (Fig. 5B) and immunohistochemistry (Fig.

5C). These immunohistochemical findings were further confirmed by Western blot analysis(Fig. 5D).

Moreover, a significant activation of NF-κB, as indicated by a significantly up-regulated expression

level of pp65 in the nuclear compartments of the intestinal tumor tissues from ApcMin/+;PSGL-1-/- mice

as compared to the ApcMin/+ mice (Fig. 5C, Down). Additionally, treatment of CT26 cells by MIP-1γ led

to a marked activation of NF-κB, as indicated by increased expression of pp65 in the nuclear

compartment (Fig. 5E) and increased translocation of pp65 (Fig. 5F). Taken together, these data

strongly suggest that MIP-1γ activates NF-κB pathway in tumors.

Infiltration of tumor tissues by the PSGL-1 positive cells is positively associated with TNM stage

and lymph metastasis in CRC patients

Almost 100% of the PSGL-1 positive cells were found in the adjacent non-tumorous intestinal tissues

and tumor tissues in mice (S Fig. 9A).To investigate the correlation between the infiltration of PSGL-1

positive cells in the tumor tissues and the clinicopathological features of the tumors, expression of

14

PSGL-1 was detected in 38 cases of human CRC tissues by immunohistochemistry. The PSGL-1 was

mainly expressed on the membrane of non-tumor cells, and these PSGL-1 positive cells were present

around the cancer tissues in CRC patients (Fig. 6).

We further divided the intestinal tumor tissues into two subgroups according to the number of PSGL-1

positive cells infiltrating the tissues: low infiltrating tissues <50 cells per low magnification (10×)

field](17) and high infiltrating tissues [≥50 cells per field high magnification (100×) field]. Patients

with low level of PSGL-1 cell infiltration showed more advanced TNM stages (Fig. 6 and Table 1,

P=0.00065) and more lymph node metastasis (Table 1, P=0.0008)., as exemplified in S Fig. 9B and 9C

(** P<0.01). No statistically significant association was found between the level of PSGL-1 expression

and the rest of the clinicopathological features including gender and age (Table 1, P=0.7205 and 0.4417,

respectively).

Discussion

The role of PSGL-1 in tumor metastasis was not recognized until recently(31). In the present study, we

observed that PSGL-1 may play an oncogenic role in the development of intestinal tumors, and this is

likely mediated through activation of NF-κB signaling by MIP-1γ. We first observed that PSGL-1

deficient mice (i.e., ApcMin/+;PSGL-1-/- mice and and PSGL-1-/- transgenic mice) showed an accelerated

growth of intestinal tumors and xenograft tumors, respectively. We then demonstrated an up-regulation

of MIP-1γ in the PSGL-1 deficient mice, and the increased MIP-1γ level was likely derived from the

macrophages which may have produced MIP-1γ via activation of NF-κB pathway, promoting the

intestinal tumorigenesis, as schematically shown in Fig. 6H.

PSGL-1 was reported to assist the rolling and migration of macrophages, T cells and B cells(32), which

are believed to be the key effector cells linking the tumor microenvironment and tumor development.

Blockade of PSGL-1 was reported to decrease the recruitment of CD14+ monocytic cells and T cells to

15

the intestinal mucosa and attenuate the established colitis in experimental murine models(33,34). These

data are consistent with our results in PSGL-1 deficient mice (S Fig.5). These published data and our

own results suggest that PSGL-1 deficiency could impair the recruitment of key immune cells such as

leukocytes to the inflammatory sites(35). PSGL-1 positive cells is associated with clinic TNM stage,

suggesting PSGL-1 positive cell play important role in CRC development. The role of PSGL-1 in

gastrointestinal tumorigenesis is further supported by our findings in clinical study, which shows that

the presence of PSGL-1 positive cells in the tumor tissues is positively correlated with a favorable

TNM staging and lymph node metastasis, but the lymph node metastasis in ApcMin+; PSGL-1-/- mice

would need clear in next work.

The mechanisms by which PSGL-1 deficiency promotes tumorigenesis are not clear. We proposed that

key cytokines or chemokines produced in the PSGL-1 deficient mice are likely responsible for

increased tumor growth in these animals. We have shown that PSGL-1 is mainly expressed in immune

cells rather than in cancer cells, and PSGL-1-/- mice exhibit increased serum level of

macrophage-derived MIP-1γ suggesting that up-regulation of MIP-1γ may play a major role in

accelerating the intestinal tumorigenesis. These findings are in accordance with the published data in

that many chemokines were found to promote tumor growth through various mechanisms such as

stimulating angiogenesis, enhancing tumor cell proliferation and dissemination(26,28,36,37). In

support of these data, previous studies have demonstrated that up-regulation of many chemokines (such

as CCL7, CCL20, CCL25, CXCL1 and CCL26) and chemokine receptors (such as CCR8, CCR6, and

CXCR2) in tumor tissues was mechanistically linked to the tumor growth(38). The other potential

mechanism is that PSGL-1 may affect the differentiation of hematopoietic stem cells and disturb the

cells of myeloid lineage to develop into granulocytes, monocytes, megakaryocytes and dendritic cells,

thereby affecting the homeostasis of immune system, and impairing the self-renewal and differentiation

of hematopoietic stem cells(20).

16

The tumor promoting effect of chemokines is believed to be related to their role in facilitating

trafficking of leukocytes into tumor microenvironment. In our study, we demonstrated that tumor cells

express MIP-1γ receptor (CCR1) and MIP-1γ could directly promote tumor cell growth via a

ligand-receptor interaction. Our data are supported by the previous reports that tumor cells express

chemokine receptors and they can acquire the ability of direct responding to chemokines.(39) It should

be mentioned here that MIP-1γ expression was only found in the immune cells of mouse but not human

origin, and tumor cells do not express MIP-1γ. We also identified the presence of the conserved domain

of MIP-1γ in IL-8, CCL5, and other chmokines (data not shown). On the other hand, nearly all

cytokine domains can be found on MIP-1γ, and some domains have been explored as the therapeutic

targets for inflammatory diseases and cancers. These data suggest that MIP-1γ contains a highly

conserved domain that is related to the classical function of chemokines. This is supported by our

finding that MIP-1γ could activate NF-κB, a classical transcription factor involved in innate immunity,

inflammation and cancer development. Previous studies have revealed that MIP-1γ could promote

osteoclast formation and survival through activation of canonical NF-κB signaling pathway(40). In our

study, MIP-1γ was found to potently activate the NF-κB signaling. We therefore propose that the

tumorigenic effect of PSGL-1 deficiency may be mediated through enhancing the secretion of MIP-1γ

via NF-κB signaling. Additionally, up-regulation of MIP-1γ may stimulate the WNT/β-Catenin

signaling which is also a tumorigenic pathway for intestinal cancers (S Fig. 7). activation of

WNT/β-catenin pathway by MIP-1γ may also play a role, but this awaits further studies to confirm.

Previous studies have shown that PSGL-1 deficiency may affect the immune cell differentiation and

neutrophil function, and therefore contribute to tumor growth(41). Our data has confirmed that

macrophages are the major source of MIP-1γ in PSGL-1 deficient mice, and it is not clear whether

MIP-1γ drives the transition of M1 macrophages to M2 macrophages, which have been shown to extert

tumor-promoting effect(42-44). Detailed mechanisms for MIP-1γ up-regulation in the setting of

17

PSGL-1 deficiency and the mechanisms by which MIP-1γ promotes tumorigenesis require further

studies.

In summary, our data convincingly show that PSGL-1 deficiency promotes tumor growth by secreting

MIP-1γ, and the presence of PSGL-1 positive cells in tumor tissues is associated with a favorable

patient survival in CRC patients. Further studies to clarify the molecular mechanisms involved in the

oncogenic effect of MIP-1γ and whether MIP-1γ holds any potential as a therapeutic target for

intestinal cancers are warranted.

Disclosure of Potential Conflicts

No potential conflicts interest were disclosed.

Authors’ Contributions

Study design: Lijing Wang, Jiangchao Li.

Data collection, analysis, and interpretation: Zeqi Zhou, Li Zheng, Xiaohan Zhang, Jiangchao Li,

Samples collection: Chun-kui Shao, Dan He, Yuxiang Ye,Yu Chen.

Statistical analysis: Jiangchao Li, Zeqi Zhou, Li Zheng.

Manuscript writing and Critical revisions of manuscript: Jiangchao Li, Liang Qiao.

Technical support and clinical samples: Dan He, Chunkui Shao, Yu Chen, Qianqian Zhang, Cui-Ling

Qi, Xiao-Dong He.

Acknowledgments

All flow cytometry work was supported by and performed in the School of Life Science, Sun Yat-sen

University and Guangdong Provincial Key Laboratory of Malignant Tumor Epigenetics and Gene

Regulation, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University. We thank Qiaobing Yuan for her

18

assistance in animal raising and histological staining. The clinical samples were collected from the

Department of Pathology, the Third Affiliated Hospital of Sun Yat-sen University.

Grant support

This work was supported by National Natural Science Foundation of China (Grant ID 81472336 and

31471290), the research and capacity building for public welfare of Guangdong Province (Grant ID

2015A030302086 and 2014A020212313), Pearl River S&T Nova Program of Guangzhou (Grant ID

201610010045), and Technology Planning Project of Guangdong Province(Grant ID

2014B020212012 ).

References：

1. Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Global cancer statistics. CA: a cancer journal for clinicians 2011;61(2):69-90 doi 10.3322/caac.20107.

2. Chen W, Zheng R, Zeng H, Zhang S. The incidence and mortality of major cancers in China, 2012. Chinese journal of cancer 2016;35(1):73 doi 10.1186/s40880-016-0137-8.

3. Su LK, Kinzler KW, Vogelstein B, Preisinger AC, Moser AR, Luongo C, et al. Multiple intestinal neoplasia caused by a mutation in the murine homolog of the APC gene. Science 1992;256(5057):668-70.

4. Dove WF, Clipson L, Gould KA, Luongo C, Marshall DJ, Moser AR, et al. Intestinal neoplasia in the ApcMin mouse: independence from the microbial and natural killer (beige locus) status. Cancer Res 1997;57(5):812-4.

5. Slattery ML, Wolff RK, Herrick J, Caan BJ, Samowitz W. Tumor markers and rectal cancer: support for an inflammation-related pathway. Int J Cancer 2009;125(7):1698-704 doi 10.1002/ijc.24467.

6. Laszik Z, Jansen PJ, Cummings RD, Tedder TF, McEver RP, Moore KL. P-selectin glycoprotein ligand-1 is broadly expressed in cells of myeloid, lymphoid, and dendritic lineage and in some nonhematopoietic cells. Blood 1996;88(8):3010-21.

7. Sultana DA, Zhang SL, Todd SP, Bhandoola A. Expression of functional P-selectin glycoprotein ligand 1 on hematopoietic progenitors is developmentally regulated. J Immunol 2012;188(9):4385-93 doi 10.4049/jimmunol.1101116.

8. Zarbock A, Muller H, Kuwano Y, Ley K. PSGL-1-dependent myeloid leukocyte activation. J Leukoc Biol 2009;86(5):1119-24 doi 10.1189/jlb.0209117.

9. Wang HB, Wang JT, Zhang L, Geng ZH, Xu WL, Xu T, et al. P-selectin primes leukocyte integrin activation during inflammation. Nat Immunol 2007;8(8):882-92 doi 10.1038/ni1491.

10. Tchernychev B, Furie B, Furie BC. Peritoneal macrophages express both P-selectin and PSGL-1. J Cell Biol 2003;163(5):1145-55 doi 10.1083/jcb.200310079.

11. Baggiolini M. Chemokines and leukocyte traffic. Nature 1998;392(6676):565-8 doi 10.1038/33340. 12. Tamba S, Yodoi R, Segi-Nishida E, Ichikawa A, Narumiya S, Sugimoto Y. Timely interaction between prostaglandin

and chemokine signaling is a prerequisite for successful fertilization. Proc Natl Acad Sci U S A 2008;105(38):14539-44 doi 10.1073/pnas.0805699105.

13. Raman D, Baugher PJ, Thu YM, Richmond A. Role of chemokines in tumor growth. Cancer letters 2007;256(2):137-65 doi 10.1016/j.canlet.2007.05.013.

14. Payne AS, Cornelius LA. The role of chemokines in melanoma tumor growth and metastasis. J Invest Dermatol

19

2002;118(6):915-22 doi 10.1046/j.1523-1747.2002.01725.x. 15. Wang JM, Deng X, Gong W, Su S. Chemokines and their role in tumor growth and metastasis. J Immunol Methods

1998;220(1-2):1-17. 16. Sun Y, Peng D, Lecanda J, Schmitz V, Barajas M, Qian C, et al. In vivo gene transfer of CD40 ligand into colon cancer

cells induces local production of cytokines and chemokines, tumor eradication and protective antitumor immunity. Gene therapy 2000;7(17):1467-76 doi 10.1038/sj.gt.3301264.

17. Xiao H, Yin W, Khan MA, Gulen MF, Zhou H, Sham HP, et al. Loss of single immunoglobulin interlukin-1 receptor-related molecule leads to enhanced colonic polyposis in Apc(min) mice. Gastroenterology 2010;139(2):574-85 doi 10.1053/j.gastro.2010.04.043.

18. Yang J, Hirata T, Croce K, Merrill-Skoloff G, Tchernychev B, Williams E, et al. Targeted gene disruption demonstrates that P-selectin glycoprotein ligand 1 (PSGL-1) is required for P-selectin-mediated but not E-selectin-mediated neutrophil rolling and migration. J Exp Med 1999;190(12):1769-82.

19. Noh H, Eomm M, Han A. Usefulness of pretreatment neutrophil to lymphocyte ratio in predicting disease-specific survival in breast cancer patients. Journal of breast cancer 2013;16(1):55-9 doi 10.4048/jbc.2013.16.1.55.

20. Carlow DA, Gossens K, Naus S, Veerman KM, Seo W, Ziltener HJ. PSGL-1 function in immunity and steady state homeostasis. Immunol Rev 2009;230(1):75-96 doi 10.1111/j.1600-065X.2009.00797.x.

21. Poltorak AN, Bazzoni F, Smirnova, II, Alejos E, Thompson P, Luheshi G, et al. MIP-1 gamma: molecular cloning, expression, and biological activities of a novel CC chemokine that is constitutively secreted in vivo. Journal of inflammation 1995;45(3):207-19.

22. Razmkhah M, Arabpour F, Taghipour M, Mehrafshan A, Chenari N, Ghaderi A. Expression of chemokines and chemokine receptors in brain tumor tissue derived cells. Asian Pacific journal of cancer prevention : APJCP 2014;15(17):7201-5.

23. Fusi A, Liu Z, Kummerlen V, Nonnemacher A, Jeske J, Keilholz U. Expression of chemokine receptors on circulating tumor cells in patients with solid tumors. J Transl Med 2012;10:52 doi 10.1186/1479-5876-10-52.

24. Masai K, Iwashita Y, Tominaga M, Hirano S, Shibata K, Matsumoto T, et al. mRNA expression of chemokine receptors in hepatic and pancreatic tumor cell lines. Gan to kagaku ryoho Cancer & chemotherapy 2004;31(8):1261-3.

25. Clemetson KJ, Clemetson JM, Proudfoot AE, Power CA, Baggiolini M, Wells TN. Functional expression of CCR1, CCR3, CCR4, and CXCR4 chemokine receptors on human platelets. Blood 2000;96(13):4046-54.

26. Dairaghi DJ, Oyajobi BO, Gupta A, McCluskey B, Miao S, Powers JP, et al. CCR1 blockade reduces tumor burden and osteolysis in vivo in a mouse model of myeloma bone disease. Blood 2012;120(7):1449-57 doi 10.1182/blood-2011-10-384784.

27. Bignon A, Gaudin F, Hemon P, Tharinger H, Mayol K, Walzer T, et al. CCR1 inhibition ameliorates the progression of lupus nephritis in NZB/W mice. J Immunol 2014;192(3):886-96 doi 10.4049/jimmunol.1300123.

28. Lee MM, Chui RK, Tam IY, Lau AH, Wong YH. CCR1-mediated STAT3 tyrosine phosphorylation and CXCL8 expression in THP-1 macrophage-like cells involve pertussis toxin-insensitive Galpha(14/16) signaling and IL-6 release. J Immunol 2012;189(11):5266-76 doi 10.4049/jimmunol.1103359.

29. Kitamura T, Fujishita T, Loetscher P, Revesz L, Hashida H, Kizaka-Kondoh S, et al. Inactivation of chemokine (C-C motif) receptor 1 (CCR1) suppresses colon cancer liver metastasis by blocking accumulation of immature myeloid cells in a mouse model. Proc Natl Acad Sci U S A 2010;107(29):13063-8 doi 10.1073/pnas.1002372107.

30. Rodero MP, Auvynet C, Poupel L, Combadiere B, Combadiere C. Control of both myeloid cell infiltration and angiogenesis by CCR1 promotes liver cancer metastasis development in mice. Neoplasia 2013;15(6):641-8.

31. Hoos A, Protsyuk D, Borsig L. Metastatic growth progression caused by PSGL-1-mediated recruitment of monocytes to metastatic sites. Cancer Res 2014;74(3):695-704 doi 10.1158/0008-5472.CAN-13-0946.

32. Moore KL, Patel KD, Bruehl RE, Li F, Johnson DA, Lichenstein HS, et al. P-selectin glycoprotein ligand-1 mediates rolling of human neutrophils on P-selectin. J Cell Biol 1995;128(4):661-71.

33. Rijcken EM, Laukoetter MG, Anthoni C, Meier S, Mennigen R, Spiegel HU, et al. Immunoblockade of PSGL-1 attenuates established experimental murine colitis by reduction of leukocyte rolling. Am J Physiol Gastrointest Liver Physiol 2004;287(1):G115-24 doi 10.1152/ajpgi.00207.2003.

34. Inoue T, Tsuzuki Y, Matsuzaki K, Matsunaga H, Miyazaki J, Hokari R, et al. Blockade of PSGL-1 attenuates CD14+ monocytic cell recruitment in intestinal mucosa and ameliorates ileitis in SAMP1/Yit mice. J Leukoc Biol 2005;77(3):287-95 doi jlb.0204104 [pii].

35. Sreeramkumar V, Adrover JM, Ballesteros I, Cuartero MI, Rossaint J, Bilbao I, et al. Neutrophils scan for activated platelets to initiate inflammation. Science 2014;346(6214):1234-8 doi 10.1126/science.1256478.

36. Swamydas M, Ricci K, Rego SL, Dreau D. Mesenchymal stem cell-derived CCL-9 and CCL-5 promote mammary

20

tumor cell invasion and the activation of matrix metalloproteinases. Cell Adh Migr 2013;7(3):315-24 doi 10.4161/cam.25138.

37. Long H, Xie R, Xiang T, Zhao Z, Lin S, Liang Z, et al. Autocrine CCL5 signaling promotes invasion and migration of CD133+ ovarian cancer stem-like cells via NF-kappaB-mediated MMP-9 upregulation. Stem Cells 2012;30(10):2309-19 doi 10.1002/stem.1194.

38. Acharyya S, Oskarsson T, Vanharanta S, Malladi S, Kim J, Morris PG, et al. A CXCL1 paracrine network links cancer chemoresistance and metastasis. Cell 2012;150(1):165-78 doi 10.1016/j.cell.2012.04.042.

39. Schimanski CC, Schwald S, Simiantonaki N, Jayasinghe C, Gonner U, Wilsberg V, et al. Effect of chemokine receptors CXCR4 and CCR7 on the metastatic behavior of human colorectal cancer. Clin Cancer Res 2005;11(5):1743-50 doi 10.1158/1078-0432.CCR-04-1195.

40. Okamatsu Y, Kim D, Battaglino R, Sasaki H, Spate U, Stashenko P. MIP-1 gamma promotes receptor-activator-of-NF-kappa-B-ligand-induced osteoclast formation and survival. J Immunol 2004;173(3):2084-90.

41. Coffelt SB, Kersten K, Doornebal CW, Weiden J, Vrijland K, Hau CS, et al. IL-17-producing gammadelta T cells and neutrophils conspire to promote breast cancer metastasis. Nature 2015 doi 10.1038/nature14282.

42. Wynn TA, Chawla A, Pollard JW. Macrophage biology in development, homeostasis and disease. Nature 2013;496(7446):445-55 doi 10.1038/nature12034.

43. Qian BZ, Pollard JW. Macrophage diversity enhances tumor progression and metastasis. Cell 2010;141(1):39-51 doi 10.1016/j.cell.2010.03.014.

44. Pollard JW. Tumour-educated macrophages promote tumour progression and metastasis. Nature reviews Cancer 2004;4(1):71-8 doi 10.1038/nrc1256.

21

Table 1 Table 1. Clinicopathological data and correlation with PSGL-1 expression in 38 patients with primary colorectal cancers. Clinical Feature Number Number of PSGL-1 cell P value High Low Gender 0.7205 Male 28 8 (28.57%) 20 (71.42%) Female 10 4 (40%) 6 (60%) Age 0.4417 >60 33 10 (56%) 24(47%) ≤60 5 2 (49%) 3 (51%) Lymph node Metastasisa,b 0.0008 N0 18 9 (50%) 9 (50%) N1 7 0 (0%) 5 (71.42%)

N2 7 1 (14.28%) 6 (85.71%) TNM stagea,b 0.00065

I-II 21 16 (76.19%) 5 (23.8%) III-IV 17 1 (5.8%) 16(94.12%)

a Partial data is not available, and the all statistic was based on the informative data. b Lymph node Metastasis was defined by results on final pathological analysis. Note：The low of number of PSGL-1 cell indicate less 20 cells in each 400×field under microscope.

22

Figure legends

Figure 1. Accelerated growth of intestinal tumors in PSGL-1-/- mice.

A. The representative photos of the intestinal tumors stained by methylene blue (ileum segment). More

intestinal tumor nodules are visible in ApcMin/+;PSGL-1-/- mice than in ApcMin/+ mice. B. The

microadenomas and adenomas were of larger size in ApcMin/+;PSGL-1-/- mice than in ApcMin/+ mice. **

P<0.01; *** P<0.001. C. The number of tumor nodules (microadenoma and adenoma) in each

experimental mouse was counted at different time points. Increased tumor incidence was clearly seen in

ApcMin/+;PSGL-1-/- mice than in ApcMin/+ mice, *P<0.05; ** P<0.01; *** P<0.00. D. ApcMin/+;PSGL-1-/-

mice (n=32) with the intestinal tumors showed poorer survival than the tumor-bearing ApcMin/+ mice

(n=42). Survival was analyzed by Kaplan-meier analysis (SPSS software, 17.0).

Figure 2. Pathological features of intestinal tumors in ApcMin/+ and ApcMin/+;PSGL-1-/- mice

A. An overview of the intestinal tumors of ApcMin/+ and ApcMin/+;PSGL-1-/- mice. Intestines were

stained with H&E. B. The representative 3-stage development of intestinal tumors in ApcMin/+ mice:

hyperplasia, adenoma and adenocarcinoma. Tissue sections were stained with H&E. C. A quantitative

analysis of the percentage of the intestinal adenomas and adenocarcinomas in ApcMin/+;PSGL-1-/- mice,

as compared to ApcMin/+ mice. D. IHC staining of ki67 in the intestinal tumor tissues of ApcMin/+ and

ApcMin/+;PSGL-1-/- mice. E. Quantitative analysis of the ki67 positivity in the intestinal tumors of

ApcMin/+ and ApcMin/+;PSGL-1-/- mice. F. IHC staining of the micro-vessel density as indicated by

CD34 in the intestinal tumors of the ApcMin/+ and ApcMin/+;PSGL-1-/- mice. G. Quantitative analysis of

CD34 positivity in the intestinal tumors of ApcMin/+ and ApcMin/+;PSGL-1-/- mice. * P<0.01.

Magnification: 40× for Fig.A, 200× for Fig.B, 400× Fig.D and F.

Figure 3. Down-regulation of PSGL-1 leads to an increased production of MIP-1γ.

A.With cytokine array analysis, significantly increased serum level of MIP-1γ(CCL9) was found in

23

tumor-bearing PSGL-1-/- mice compared to tumor-bearing C57BL/6 mice. B. By qPCR assay, increased

mRNA expression of MIP-1γ in the blood cells was found in the ApcMin/+;PSGL-1-/- and PSGL-1-/- mice,

as compared to the ApcMin/+ (no tumors by 4 weeks) and C57 mice, respectively. ** P<0.01;

***P<0.001: C. The protein expression level of MIP-1γ in the mouse blood cells was detected by

ELISA. Significantly increased MIP-1γ level was found in the ApcMin/+;PSGL-1-/- and PSGL-1-/- mice,

as compared to the ApcMin/+ and C57 mice, respectively. * P<0.05. D. The percentage of `F4/80+

macrophages in the entire CD45+ cell populations isolated from the mouse peripheral blood and spleen

was determined by flow cytometry (a). Increased percentage of F4/80+ macrophages was found in the

ApcMin/+;PSGL-1-/- and PSGL-1-/- mice, as compared to the ApcMin/+ and C57 mice, respectively. (b:

blood; c: spleen. * P<0.05; ** P<0.01). E. Expression of MIP-1γ mRNA by qPCR in the macrophages

collected from the peripheral blood of ApcMin/+ and ApcMin/+;PSGL-1-/- mice. **P<0.01. F. Expression

of MIP-1γ protein by ELISA in the macrophages collected from the peripheral blood of ApcMin/+ and

ApcMin/+;PSGL-1-/- mice. ** P<0.01. G, H. Knockdown of PSGL-1 in Raw264.7 cells (G) led to an

increased production of MIP-1γ (H). * P<0.05.

Figure 4. MIP-1γ promotes tumor cell growth in vitro.

A. Expression of MIP-1γ mRNA was clearly detected by RT-PCR in macrophages isolated from the

peripheral blood of mice and RAW264.7 cells (a mouse macrophage cell line), but not in the intestinal

tumor cell lines HCT116, SW620, SW480 and CT26. B. Expression of the MIP-1γ receptor CCR1 was

detected in the intestinal tumor tissues from the ApcMin/+ mice by IHC analysis, and CT26 cell line was

detected with antibody CCR1 by Western blotting. #1and #2 indicated the repeat assays.. C. CT26 cells

were treated with various concentrations of MIP-1γ for 24, 48, and 72 h, and the effect on cell

proliferation was examined by MTT assay. MIP-1γ induced a time- but not dose-dependent increase in

the proliferation of CT26 cells. D. As demonstrated by flow cytometry, MIP-1γ promotes cell cycle

progression to G2/M phase. E. MIP-1γ also promotes migration of CT26 cells, as demonstrated by the

24

wound healing assay.

Figure 5. MIP-1γ activate NF-κB pathway in tumor cells.

A. A commercial PCR kit specific for NF-κB pathway related gene of mRNA expression was used to

examine the effect of MIP-1γ on NF-κB signaling. B. The level of TNF-α tumor tissues of ApcMin/+ and

ApcMin/+;PSGL-1-/- mice were determined using an ELISA kit. Data are expressed as mean±SD. *

P<0.05. C. The expression levels of TNF-α and pP65 in the tumor tissues were also determined by

immunohistochemistry. A significantly increased expression of TNF-α was found in the

ApcMin/+;PSGL-1-/- mice as compared to ApcMin/+ mice (b and a, respectively). Similarly, there was a

significant increase in the expression of pp65 in the nuclei of the tumor cells derived from the

ApcMin/+;PSGL-1-/- mice as compared to ApcMin/+ mice (d and c, respectively). Magnification: 400. D.

Expression level of TNF-in the intestinal tumor tissues of ApcMin/+;PSGL-1-/- and ApcMin/+ mice was

determined by Western blot. E. CT26 cells with MIP-1γ treatment (20 ng/mL) led to a significant

up-regulation of pP65 in cell unclear and cytoplasmic protein, as determined by Western blotting assay.

F. Immunofluorescent staining of pp65 in CT26 cells treated with or without MIP-1γ. Magnification:

400×.

Figure 6. PSGL-1 positive cells in tumor were associated with clinical chanractital.

A.Immunohistochemistry analysis representative image shows that cell membranous immunoreactivity

for PSGL-1 were present in different clinic stage –Adenoma(Fig. A, PSGL-1 positive cells present in

peritumoral of adenoma), I (Fig. B), II (Fig. C), III(Fig. D), and IV(Fig. E) stage ((brown, DAB,

PSGL-1; blue，haematoxylin stain, Nucleus). B. Statistical diagram show that the PSGL-1 positive cells

appear in different clinic stage of 0/I, II, IV and were negative correlation with clinic stage（Fig. F,

*P<0.05,**P<0.01, and ***P<0.001）in CRC patients. C.The number of PSGL-1 positive cells is

associated with lymphatic metastasis (Fig. G, ***P<0.001, ns= no significance). D.A schematic

25

diagram showing the possible mechanisms of the tumor-promoting role of MIP-1γ in intestinal tumors

in mice(Fig. H).