c eisenegger et al. nature 463 , 356 - 359 (2010) doi:10.1038/nature08 711

1

C Eisenegger et al. Nature 463, 356-359 (2010) doi:10.1038/nature08711 Sequence of events in the double-blind study with testosterone and placebo administration.

Upload: inge

Post on 05-Jan-2016

30 views

Category:

Documents

1 download

Report

Download

Embed Size (px):

DESCRIPTION

Sequence of events in the double-blind study with testosterone and placebo administration. C Eisenegger et al. Nature 463 , 356 - 359 (2010) doi:10.1038/nature08 711. - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: C Eisenegger et al. Nature 463 , 356 - 359 (2010) doi:10.1038/nature08 711

C Eisenegger et al. Nature 463, 356-359 (2010) doi:10.1038/nature08711

Sequence of events in the double-blind study with testosterone and placebo administration.

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

Vol 451 doi:10.1038/nature06451 LETTERS - The Pierce Labpiercelab.caltech.edu/assets/papers/nature08.pdf · disassembly reaction (3) ... 1Department of Bioengineering, 2Department

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

GI Motility online (May 2006) | doi:10.1038/gimo46

DOI: 10.1038/NPHOTON.2015 - media.nature.com PHOTONICS | . 3. DOI: 10.1038/NPHOTON.2015. 181. SUPPEENTAR INORATION 1 polarized laser beams to …

SUPPLEMENTARY INFORMATION - Nature · SUPPLEMENTARY INFORMATION doi: 10.1038/nmat2460 nature materials ... Sulfur outside of structure of ... 10.1038/nmat2460 SUPPLEMENTARY INFORMATION

DOI: 10.1038/ncomms1280 molecular dynamics of single

REVUE DES REVUES DE LANGUE FRANÇAISEcnlj.bnf.fr/sites/default/files/revues_document_joint/PUBLICATION_3475.pdfREVUE REVUES DE LANGUE FRANÇAISE par Aline Eisenegger Le Français aujourd'hui

Ecosystem turnover in palaeoecological records: …€¦ · Web viewNature Publishing Group: 53–59. DOI: 10.1038/nature08227. DOI: 10.1038/nature08227. Seddon AW, Macias-Fauria

Nature , 2008, Doi:10.1038/nature07103

DOI: 10.1038/NMAT4228 - imechanicaimechanica.org/files/nmat4228-s1_0.pdf · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4228. NATURE MATERIALS | . 1. 1. In Situ Atomic-Scale Observation

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

DOI: 10.1038/NPHYS3211 Supplementary Information for

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

revues de langue française,par Aline Eisenegger

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

CD Putnam et al. Nature 000 , 1 - 6 (2009) doi:10.1038/nature08 217

JB Kim et al. Nature 461 , 649 - 653 (2009) doi:10.1038/nature08 436

GI Motility online (May 2006) | doi:10.1038/gimo31

DOI: 10.1038/NMAT4204 Supplementary Information...NATURE MATERIALS | . DOI: 10.1038/NMAT4204. , , – – |

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

Supplementary information - Nature · © 200 9 Macmillan Publishers Limited. ... 10.1038/nchem.290 Supplementary information 6 ... 10.1038/nchem.290 Supplementary information 7 Preparation

Six Sigma Yellow Beltsixsigma.ch/index_htm_files/E-BookYellowBeltProzessfaehigkeit.pdf · Six Sigma Yellow Belt Prozessfähigkeit Kilian Eisenegger 0 6 Tief Hoch Z.Bench = -0.36 0

SCIENTIFIC REPORTS | 2 : 592 | DOI: 10.1038/srep00592

Nature, 2008, Doi:10.1038/nature07103 Semrah Kati 09.02.2009

Published in Nature Materials (2016) doi:10.1038/nmat4569

hdrpanohdrpano.ch/DroneBlocks/DroneBlocks.pdfhdrpano Technische Fotografie Tutorial Kilian Eisenegger Page 9 optimize the number of pictures and to have better stitching results. 5.1

doi:10.1038/nature05150 LETTERS

GI Motility online (May 2006) | doi:10.1038/gimo6

Technische Fotografie Tutorial Kilian Eisenegger DJI Inspire … Inspire 45mm Full Size... · 2016-10-23 · hdrpano Technische Fotografie Tutorial Kilian Eisenegger Page 1 DJI Inspire

1 November 2007 doi:10.1038/nature06221 LETTERS

Nature Biotechnology: doi:10.1038/nbt

GI Motility online (May 2006) | doi:10.1038/gimo48

doi:10.1038/nature12886 Neanderthal from the Altai