biotechnology 2015 big idea technology can be used to alter dna and test dna

26
Biotechnology 2015

Upload: darcy-chad-hancock

Post on 18-Jan-2016

216 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: Biotechnology 2015 BIG IDEA Technology can be used to alter DNA and test DNA

Biotechnology

2015

Page 2: Biotechnology 2015 BIG IDEA Technology can be used to alter DNA and test DNA

BIG IDEA

• Technology can be used to alter DNA and test DNA.

Page 3: Biotechnology 2015 BIG IDEA Technology can be used to alter DNA and test DNA

Restriction Enzymes

• Can’t do much with DNA in Biotech unless we can CUT DNA up… Restriction Enzymes do the job!

• Watch video from start-7:00 mins

Page 4: Biotechnology 2015 BIG IDEA Technology can be used to alter DNA and test DNA

Restriction enzymes• Cut DNA at specific sites– Look for palendrome sequence (restriction site)– leave “sticky ends”

GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA

GTAAACGAATTCACGCTTCATTTGCTTAAGTGCGAA

restriction enzyme cut site

restriction enzyme cut site

Page 5: Biotechnology 2015 BIG IDEA Technology can be used to alter DNA and test DNA

Named

Many different enzymes◦named after organism they are

found in (ex: restriction enzyme 1 in e. coli bacteria…EcoRI)

EcoRI, HindIII, BamHI, SmaI

IMPT: TAQ polymerase

Page 6: Biotechnology 2015 BIG IDEA Technology can be used to alter DNA and test DNA

Many uses of restriction enzymes…

• Now that we can cut DNA with restriction enzymes…– we can cut up DNA from different people… or

different organisms… and compare it or splice new combinations together

– why?• forensics• medical diagnostics• paternity• evolutionary relationships • Destroying cancer cells• Making medications• and more…

Page 7: Biotechnology 2015 BIG IDEA Technology can be used to alter DNA and test DNA

Restriction enzymes + Bacteria

• Bacterial Review

Page 8: Biotechnology 2015 BIG IDEA Technology can be used to alter DNA and test DNA

Restriction Enzymes + Bacteria

• Bacteria review – one-celled prokaryotes– reproduce by binary fission– rapid growth• generation every ~20 minutes• 108 (100 million) colony overnight!

– incredibly diverse

Page 9: Biotechnology 2015 BIG IDEA Technology can be used to alter DNA and test DNA

Plasmids • In addition to 1 circular chromosome, bacteria also have

small supplemental circles of DNA called plasmids– FXN: carry extra genes

• 2-30 genes • genes for antibiotic resistance• self-replicating

– Plasmids can be exchanged between bacteria• “bacterial sex”

– can be imported from environment (transformation…remember Griffiths Experiment?)

Page 10: Biotechnology 2015 BIG IDEA Technology can be used to alter DNA and test DNA

plasmids

• Used as vectors to insert new genes into bacteria

plasmid

cut DNA

gene fromother organism

glue DNA

recombinantplasmid

vector

transformedbacteria

Bacteria express the new gene

Page 11: Biotechnology 2015 BIG IDEA Technology can be used to alter DNA and test DNA

Medical Implications

• What would happen if we could splice in the gene for insulin production into bacteria…

• Video

• Only possible because of restriction enzymes

Page 12: Biotechnology 2015 BIG IDEA Technology can be used to alter DNA and test DNA

PCR• Kary Mullins: development of PCR technique– a copying machine for DNA

1985

Page 13: Biotechnology 2015 BIG IDEA Technology can be used to alter DNA and test DNA

PCR

• Polymerase Chain Reaction– method for making

many, many copies of a specific segment of DNA

– only need 1 cell with DNA to start

– WHY? Sometimes the DNA sample you want to run tests on is too small (crime scene)

Page 14: Biotechnology 2015 BIG IDEA Technology can be used to alter DNA and test DNA

pcr

• It’s copying DNA in a test tube!

• What do you need?– template strand– DNA polymerase enzyme– Nucleotides (triphosphate

form)• ATP, GTP, CTP, TTP

– primer

http://www.sumanasinc.com/webcontent/animations/content/pcr.html Thermocycler

Page 15: Biotechnology 2015 BIG IDEA Technology can be used to alter DNA and test DNA

PCR process

• Cycle 1– Heat/Denature H bonds– Cool (Anneling)– Extension– End: 2 DNA

• Cycle 2– Same as 1– End: 4 DNA

• Cycle 3– Same as 1 – End: 8 DNA

PCR20-30 cycles3 steps/cycle30 sec/step

Page 16: Biotechnology 2015 BIG IDEA Technology can be used to alter DNA and test DNA

The polymerase problem• In step 1 must heat DNA to denature– 90°C destroys DNA polymerase so can’t use this to

bind in new nucleotides like normal– have to add new enzyme every cycle• almost impractical!

• Need enzyme that can withstand 90°C…– Taq polymerase• Enzyme found in bacteria living in hot springs– Thermus aquaticus

Page 17: Biotechnology 2015 BIG IDEA Technology can be used to alter DNA and test DNA

DNA FINGERPRINTING

Page 18: Biotechnology 2015 BIG IDEA Technology can be used to alter DNA and test DNA

STR’S AND FINGERPRINTS

• BEFORE starting the notes on this content, watch this video:

http://www.youtube.com/watch?v=DbR9xMXuK7c

Page 19: Biotechnology 2015 BIG IDEA Technology can be used to alter DNA and test DNA

Comparing cut up DNA• How do we compare DNA fragments?– separate fragments by size

• How do we separate DNA fragments?– run it through a gelatin• agarose• made from algae

– Process called: gel electrophoresis

Page 20: Biotechnology 2015 BIG IDEA Technology can be used to alter DNA and test DNA

Gel Electrophoresis• A method of separating

DNA in a gelatin-like material using an electrical field– Phosphate end of each

NT is negatively charged

– DNA moves toward the positive side

– Smaller fragments travel further

http://learn.genetics.utah.edu/content/labs/gel/

Page 21: Biotechnology 2015 BIG IDEA Technology can be used to alter DNA and test DNA

Uses: Medical diagnostic

• Comparing normal allele to disease allele

chromosome with disease-causing

allele 2

chromosomewith normal

allele 1 –

+

allele 1allele 2

DNA

Example: test for Huntington’s disease

Page 22: Biotechnology 2015 BIG IDEA Technology can be used to alter DNA and test DNA

Uses: Forensics• Comparing DNA sample from crime scene

with suspects & victim

+

S1

DNA MOVES

S2 S3 Vsuspects crime

scene sample

Page 23: Biotechnology 2015 BIG IDEA Technology can be used to alter DNA and test DNA

Uses: Paternity

• Who’s yo daddy?

+

DNA

childMom F1 F2–

Page 24: Biotechnology 2015 BIG IDEA Technology can be used to alter DNA and test DNA

Uses of genetic engineering

• Genetically modified organisms (GMO)– enabling plants to produce new proteins• Protect crops from insects: BT corn

– corn produces a bacterial toxin that kills corn borer (caterpillar pest of corn)

• Extend growing season: fishberries – strawberries with an anti-freezing gene from flounder

• Improve quality of food: golden rice – rice producing vitamin A

improves nutritional value

Page 25: Biotechnology 2015 BIG IDEA Technology can be used to alter DNA and test DNA

GMO research

• Follow directions on notes sheet…

Page 26: Biotechnology 2015 BIG IDEA Technology can be used to alter DNA and test DNA

CLONING

• Follow directions on notes sheet (in class if time OR homework)

• Link 1: http://learn.genetics.utah.edu/content/tech/cloning/whatiscloning/

• Link 2: http://learn.genetics.utah.edu/content/tech/cloning/clickandclone/