8/14/2019 AUF-1-Erhan

1/10

ARTHRITIS & RHEUMATISM

Vol. 58, No. 2, February 2008, pp 511520

DOI 10.1002/art.23306

2008, American College of Rheumatology

AUF1, the Regulator of Tumor Necrosis Factor

Messenger RNA Decay, Is Targeted by Autoantibodiesof Patients With Systemic Rheumatic Diseases

Karl Skriner,1 Wolfgang Hueber,2 Erhan Suleymanoglu,3 Elisabeth Hofler,2 Veit Krenn,4

Josef Smolen,5 and Gunter Steiner6

Objective. To investigate which members of the

heterogeneous nuclear RNP (hnRNP) family are tar-

geted by autoantibodies from patients with systemic

rheumatic diseases.

Methods. Using a semipurified preparation of

natural hnRNP proteins, 365 sera from patients with

rheumatic diseases and control subjects were screened

by immunoblotting for the presence of autoantibodies.

Bacterially expressed recombinant hnRNP D (AUF1)

proteins were used for confirming the data obtained.

Binding of RNA and autoantibody to AUF1 was inves-

tigated by gel retardation assays. Expression of AUF1 in

cultivated cells and synovial tissue was analyzed by

indirect immunofluorescence and immunohistochemis-

try.

Results. Autoantibodies to AUF1 proteins were

detected in 33% of patients with systemic lupus ery-thematosus, 20% of patients with rheumatoid arthritis,

17% of patients with mixed connective tissue disease,

and

8/14/2019 AUF-1-Erhan

2/10

transcribed by RNA polymerase II into large precursorRNAs that are known as heterogeneous nuclear RNAsor premessenger RNA (mRNA). During their entirenuclear life, these RNAs are associated with a set ofproteins that have been termed heterogeneous nuclear

RNPs (hnRNP), thereby forming large complexes whosecomposition may be specific for each mRNA (5). Inassociation with the small nuclear RNPs (snRNP) andother protein factors, they form the spliceosome. Dataobtained in recent years have revealed that apart fromsnRNP, several other splicesomal proteins are targetedby patients with systemic autoimmune diseases. Interest-ingly, although snRNP and certain splicing factors suchas serine/arginine-rich proteins appear to be targetedmainly, if not exclusively, in patients with SLE orMCTD, autoantibodies to hnRNP have also been ob-served in patients with other rheumatic diseases, partic-

ularly RA (6,7). Thus, antibodies to hnRNP A2 (alsoknown as the RA33 antigen), as well as antibodies to theclosely related hnRNP A1, have been repeatedly foundin patients with RA and those with SLE, and antibodiesto hnRNP I have been described to occur especially inpatients with SSc (8,9). Apart from their establishedroles in pre-mRNA splicing, hnRNP are involved incytoplasmic export of mature mRNA and in variousaspects of posttranscriptional regulation of gene expres-sion, including translation and regulation of mRNAstability (10).

The hnRNP D proteins are a subgroup of at least4 proteins generated by alternative splicing, which are

also known as AUF1 (AU-rich element [ARE]bindingfactor 1) because they preferentially bind to adenine-and uridine-rich sequences in the 3untranslated region(3-UTR) of short-lived mRNA such as c-fos or tumornecrosis factor (TNF) mRNA (11). Binding of AUF1leads to destabilization of the mRNA, resulting in theirrapid degradation by RNases (12). These proteins areclosely related to the hnRNP A/B proteins, showing asimilar general structure, i.e., 2 adjacent RNA recogni-tion motives (RRMs), which are followed by a glycine-rich C-terminal auxiliary domain (13). In this study, wepresent strong evidence for the existence of such auto-

antibodies to AUF1 and demonstrate these antibodiesto be directed to the functionally important N-terminalregion of the protein.

PATIENTS AND METHODS

Patients. A total of 365 sera from patients with RA(n 101), SLE (n 70), MCTD (n 30), SSc (n 44),polymyositis/dermatomyositis (n 17), primary Sjogrens syn-drome (n 11), reactive arthritis (n 31), psoriatic arthritis

(n 10), and osteoarthritis (OA; n 26), and healthy controlsubjects (n 25) were assessed. The sera were derived fromclinically and serologically well-characterized patients andwere obtained from the serum bank of the 2nd Department ofMedicine, Hietzing Hospital, with institutional ethics approval.All patients with RA fulfilled the 1987 revised criteria of the

American College of Rheumatology (ACR; formerly, the American Rheumatism Association) (14), all patients withSLE met the 1982 criteria of the ACR (15), and all patientswith MCTD met the criteria described by Alarcon-Segovia andVillareal (16).

Preparation of natural hnRNP proteins. To obtain asemipurified preparation of hnRNP proteins, extracts wereprepared from HeLa nuclei and partially purified by heparinSepharose chromatography, essentially as previously described(17).

Oligonucleotides. Oligoribonucleotides and polymer-ase chain reaction (PCR) primers were obtained from theDNA synthesis and sequencing unit of the Vienna Biocenter.The following PCR primers were used: for N10, GACGACG- ACAAGATGGCGGCGGCAGCGGCAACGGCG; for N20,

GACGACGACAAGATGGGCGGCTCGGCGGGCGAG-CAG; for Ct256, GACGACGACAAGATGGCCATGTCGA- AGGAACAATAT; for Ct145, GAGGAGAAGCCCGGTT-CAAAATAGCACAAAGCC; for N174, GAGGAGGAGA- AGATGGCCATGAAAACAAAAGAGCCG; for Ct173,GAGGAGAAGCCCGGTTCATTTGGCCCTTTTAGG-TCT; for N63, GACGACGACAAGATGTCGGAGGGGGA-CAAG-ATT; for Nt30, GACGACGACAAGATGGTGGCG-GCGACACAGGG. For RNA binding studies, the oligoribo-nucleotides (AUUUA)5 and AACUUGUGAUUAUUUAU-UAUUUAUUUAUUAUUUAUUUAUUUA (derived fromthe 3-UTR of the TNF mRNA) were used (18).

Cloning and expression of recombinant proteins. Thecomplementary DNA (cDNA) encoding the entire sequenceof AUF1 (a kind gift from Gary Brewer, School of Medicine,Wake Forest University) and a series of deletion mutantsconstructed by cloning of PCR fragments were cloned intopET30 vectors (Novagen, Madison, WI) and expressed asHis-tagged fusion proteins, which were purified by Ni-chelateaffinity chromatography (Clontech, Palo Alto, CA). Purity was95% as analyzed by sodium dodecyl sulfatepolyacrylamidegel electrophoresis (SDS-PAGE) and Coomassie protein stain-ing. For RNA binding studies, fragments were cloned into thepET-8c vector and expressed without a His tag. NonHis-tagged proteins were purified by cation exchange chromatog-raphy on CM Sepharose, as previously described (19). The AUF1p45 cDNA was cloned into the pcDNA 3.1/NT-GFP-TOPO vector (Invitrogen) and transfected into HeLa cells, aspreviously described (11).

Gel electrophoresis and immunoblotting. Samples were separated on 12% SDS minigels and transferred tonitrocellulose membranes (BAS53; Schleicher & Schuell, Das-sel, Germany), as previously described (18). After blocking thenitrocellulose with blocking buffer (3% nonfat dried milk inPBS, pH 7.4) for 60 minutes, the blots were incubated for 30minutes with sera diluted between 1:25 and 1:100 in the samebuffer. The blots were washed 3 times for 5 minutes with PBScontaining 0.1% Triton X-100 (PBSTriton) and subsequentlyincubated for 30 minutes with an alkaline phosphatasecoupled anti-human IgG (Fc) secondary antibody (Accurate,

512 SKRINER ET AL

8/14/2019 AUF-1-Erhan

3/10

Westbury, NY), as previously described. All steps were per-formed at room temperature.

Immunoaffinity purification of antibodies. Autoanti-bodies to AUF1 from 1 patient with RA and 2 patients withSLE were affinity-purified by the blot elution technique, aspreviously described (19). Autoantibodies to hnRNP A2 puri-

fied by the same method were used as controls. Briefly,nitrocellulose strips containing the blotted antigens were incu-bated overnight at 4C with sera diluted 1:10 in blocking buffer,washed thoroughly, cut into small pieces, and finally incubatedfor 2 minutes with 0.1M Tris, pH 10.5. The eluate wasimmediately neutralized with 1/10 volume of 1MTris HCl, pH6.8. Eluted antibodies were concentrated in Centricon-30 tubes(Amicon, Danvers, MA) by centrifugation for 20 minutes at5,000g. To estimate the yield, affinity-purified antibodies wereanalyzed by SDS-PAGE and Coomassie blue staining, usingpurified human IgG (Sigma, St. Louis, MO) as standard.Finally,elutedantibodies(100ng/ml)wereanalyzedbyimmuno-blotting, using either nuclear extracts or purified AUF1 asantigen.

Indirect immunofluorescence microscopy. Commer-

cial acetone-fixed HEp-2 cell slides (ANA HEp-2 slides;Generic Assays, Dahlewitz, Germany) were used in immuno-fluorescence studies. Slides were incubated with serum (di-luted 1:200 in PBS) or affinity-purified anti-AUF1 antibody(100 ng/ml in PBS) for 60 minutes at room temperature,washed 3 times with PBS, and subsequently incubated for 30minutes with fluorescein isothiocyanateconjugated goat anti-human IgG (Caltag, South San Francisco, CA).

Preparation of rabbit antibodies. AUF1-specific anti-sera were generated by immunizing rabbits with a keyholelimpet hemocyanincoupled AUF1-derived peptide (theN-terminal 12amino acid motif contained in all 4 AUF1isoforms). Animals were immunized subcutaneously with 0.8mg peptide and boosted intravenously with 0.6 mg peptideevery 6 weeks. Antisera were collected and were used either

unpurified or peptide affinity-purified. Affinity-purified serawere monospecific for AUF1, as tested by immunoblottingusing HeLa cellular extracts.

Immunohistochemical analysis. For immunohisto-chemical analyses, 13-m paraffin sections of synovial tissueobtained from patients with RA, patients with OA, and normalsubjects were mounted on poly-L-lysincoated slides (Oligene,Berlin, Germany), incubated overnight at 58C, and deparaf-finized with xylene. The affinity-purified anti-AUF1 rabbitantibody was applied at a 1:1,500 dilution, and anti-AUF1binding was detected using the LSAB/AP kit (Dako, Glostrup,Denmark).

RNA protein crosslink assay. Equimolar amounts (0.3M) of32P-labeled RNA oligonucleotide and purified recom-binant AUF1p45 or deletion mutants, respectively, were mixed

and incubated at room temperature for 20 minutes in 20

l ofbinding buffer (10 mM Tris HCl, pH 7.5, 1 mM EDTA, 4%glycerol, 0.1% Triton X-100, 10 mM 2-mercaptoethanol). Thereaction mixture was transferred to a microtiter plate, put onice, and irradiated with an ultraviolet (UV) lamp (Stratalinker;Stratagene, La Jolla, CA) at 254 nm at a dose of 9.9 mJ/mm2.After the addition of Laemmli sample buffer (50 mMTris HCl,pH 6.8, 2% weight/volume SDS, 10% volume/volume glycerol,5% w/v 2-mercaptoethanol, 0.01% w/v bromophenol blue), thesamples were boiled for 10 minutes and analyzed on 10%SDSpolyacrylamide gels. The gels were dried and autoradio-

graphed. For quantitative analysis, an electronic autoradio-graphy system (InstantImager; Packard, Meriden, CT) wasused.

Gel retardation assay. The binding and competitionassays were performed essentially as described above exceptthat samples were not UV irradiated but were immediately

transferred to 5% nondenaturing polyacrylamide gels run inelectrophoresis buffer (25 mM Tris HCl, 192 mM glycine, pH8.3) and separated for 60 minutes at 10 V/cm. For supershiftexperiments, the reactions were initially incubated for 15minutes at 30C, subsequently 1 l of affinity-purified antibody was added, and incubation continued for an additional 15minutes. Finally, gels were dried and analyzed by autoradiog-raphy.

Statistical analysis. Fishers exact test was used toanalyze the significance of anti-AUF1 antibody prevalencesbetween patient groups and between patients and healthycontrol subjects and for analyzing correlations of anti-AUF1autoantibodies with clinical features.

RESULTS

Autoantibodies to hnRNP D (AUF1) in sera from

patients with rheumatic diseases. In routine immuno-blot analyses of patient sera, in which a preparation ofsemipurified hnRNP proteins was used as an antigenicsource, prominent autoreactivity to 2 proteins withestimated molecular masses of 45 kd and 42 kd, respec-tively, was repeatedly observed, and was particularlypronounced in sera from patients with SLE. To furtherinvestigate this finding, a total of 266 sera from patients

with various rheumatic diseases were selected from theserum bank and analyzed by immunoblotting. In these

studies,

30% of SLE sera and

20% of RA sera wereshown to be reactive with the 45/42 doublet (Figure 1A).The molecular masses of the 2 proteins suggested thatthey belong to the subgroup of hnRNP D proteins,

which comprises 4 members with molecular massesbetween 38 kd and 45 kd generated by alternativesplicing. These proteins are better known as AUF1,because they selectively bind to certain AU-rich ele-ments that are frequently present in the 3-UTR ofshort-lived mRNA.

Therefore, we expressed the 45-kd variant ofAUF1 in Escherichia coli and investigated by immuno-blotting whether sera reactive with the 45/42-kd antigen

also recognized the recombinant protein. In these stud-ies, the majority of positive sera (89%) were indeedreactive with recombinant AUF1. Moreover, antibodiesaffinity-purified from recombinant AUF1 cross-reacted

with both the 45-kd and 42-kd antigens (Figure 1B), andantibodies affinity-purified from the natural proteinsclearly recognized the recombinant protein (Figure 1C).

The 4 AUF1 isoforms differ by 2 insertions of 19and 49 amino acids, respectively, which are contained in

AUF1 PROTEINS IN SLE AND RELATED AUTOIMMUNE DISORDERS 513

8/14/2019 AUF-1-Erhan

4/10

the first RRM and the C-terminal portion of the protein

(11). In order to test whether these insertions wererequired for recognition by autoantibodies, the 3 shortervariants were analyzed by immunoblotting for reactivitywith sera recognizing AUF1p45. All 4 proteins showedcomparable reactivity, demonstrating that the insertions

were not essential for antibody binding (results not

shown).As visualized using indirect immunofluorescencemicroscopy, AUF1-positive sera produced a large speck-led nucleoplasmic staining sparing the nucleoli in inter-phase cells (Figure 2A). To demonstrate the specificity

Figure 1. Autoantibodies to AUF1 in sera from patients with systemic lupus erythematosus (SLE).

A, Immunoblot analysis of SLE sera using a semipurified preparation of heterogeneous nuclear

RNP proteins. Arrows indicate the positions of the 45-kd and 42-kd antigens corresponding to the2 larger variants of AUF1. A human serum strongly reactive with both proteins was used as

reference (R) throughout the study. Pronounced anti-45/42 (AUF1) reactivities can be seen in lanes

2, 9, 13, 16, and 18. B, Immune reactivity of human autoantibodies with natural AUF1 purified fromrecombinant protein p45 (lane 2). C, Recombinant 45-kd variant (AUF1p45) analyzed by Western

blotting. Serum antibodies were affinity-purified by blot elution from the native p45 (lane 2) and

p42 kd AUF1 (lane 3) proteins. Lane 1 (B and C) shows serum from a patient with rheumatoidarthritis.

Figure 2. Localization of AUF1 as determined by fluorescence microscopy. A, Indirect immuno-fluorescence staining of HEp-2 cells obtained with an anti-AUF1positive serum sample. B,Indirect immunofluorescence staining of HEp-2 cells obtained with an affinity-purified anti-AUF1

patient antibody. C, Localization of AUF1 in HeLa cells transfected with green fluorescent

proteintagged AUF1. Arrows indicate staining of discrete cytoplasmic foci.

514 SKRINER ET AL

8/14/2019 AUF-1-Erhan

5/10

of this pattern, antibodies affinity-purified from patientsera were used (Figure 2B). In addition to the nucleo-plasmic staining, affinity-purified anti-AUF1 antibodystained discrete cytoplasmic foci, which were (by mor-phologic criteria) clearly distinct from other organelles

such as mitochondria, endosomes/lysosomes, or theGolgi complex. The location and size of discrete cyto-plasmic foci were similar to the size and location ofP-bodies (also known as GW bodies), and these foci

concentrate enzymes involved in mRNA turnover andsequester mRNA away from the translational machinery(20). To further analyze localization of AUF1, HeLacells were transfected with green fluorescent protein(GFP)tagged AUF1p45, which showed a staining pat-

tern that was similar to that obtained with the affinity-purified anti-AUF1 antibody (Figure 2C).

To investigate the autoimmune response to AUF1 in greater detail, 365 sera from patients with various rheumatic diseases were tested for reactivitywith purified recombinant AUF1p45 (Table 1). Thesestudies largely confirmed the findings obtained with thenatural proteins: IgG antibodies to AUF1 were observed

in one-third of sera from patients with SLE, in 20% ofsera from patients with RA, and in 17% of sera frompatients with MCTD, whereas no antibodies were foundin sera from patients with scleroderma or polymyositis/dermatomyositis and, apart from a few exceptions (1patient with primar y Sjogrens syndrome, 2 patients withreactive arthritis, 1 patient with osteoarthritis), wereabsent in patients with other rheumatic diseases.

Correlation of anti-AUF1 antibodies with other

autoantibodies. Sera from patients with RA or SLE areknown to contain antibodies to hnRNP A2 (9), which isclosely related to AUF1, showing a similar generalstructure and 70% homology in the 2 RRMs. How-

ever, although some sera contained autoantibodies toboth proteins, the correlation between the 2 antibodyspecies did not reach the level of statistical significance,in neither patients with RA nor patients with SLE. Inpatients with RA, there was also no correlation ofanti-AUF1 with rheumatoid factor or antibodies tocitrullinated peptides. In patients with SLE, there was nocorrelation with anti-DNA, anti-Ro, or anti-La autoan-tibodies. Interestingly, however, an association wasfound with anti-Sm antibodies, because among the 5anti-Smpositive sera, 4 also contained antibodies to

AUF1 (P 0.04). Significant associations of anti-AUF1

antibodies with clinical features were not observed inpatients with SLE, patients with RA, or patients withMCTD.

Epitope mapping. To identify the epitopes recog-nized by anti-AUF1 autoantibodies, a series of deletionmutants of AUF1p45 were generated. These fragments

were probed by immunoblotting with 21 selected serafrom patients with SLE (n 7), patients with RA (n 9), and patients with MCTD (n 5). Figure 3A shows atypical result obtained with serum from a patient withSLE; this serum showed full reactivity with fragments1262, 10262, and 1173 and weak reactivity withfragment 1145, while no reactivity was observed with

any of the other fragments. Figure 3B shows the com-bined results obtained with 11 fragments of AUF1. Allsera showed comparable reactivity with the full-lengthprotein and deletion mutant 1262, and the majority ofthem (i.e., 16 of 21) were also fully reactive withfragment 1173 (containing the complete RRM 1),suggesting that RRM 2 and the C-terminal part were notessential for immunoreactivity.

In contrast, a short C-terminal truncation ofRRM 1 (fragment 1145) led to a significant reductionor complete loss of reactivity of all sera analyzed, andfragment 170 (containing only the N-terminal domain)

was completely nonreactive. In a similar manner,N-terminal truncations of fragment 1262 graduallyreduced or abolished the reactivities. Thus, fragment10262 was still recognized by 19 sera, and fragment30262 was recognized by 14 of them, whereas fragment62262 containing both RRMs but lacking theN-terminal domain was recognized by only 2 RA and 3MCTD sera. Only 2 of these sera recognized fragment105262, while they showed no reactivity with fragment

Table 1. Frequency of autoantibodies to recombinant AUF1, asdetermined by immunoblotting, in sera from patients and healthy

controls*

Diagnosis

No. of

sera

No.

(%)

positiveSystemic lupus erythematosus 70 23 (33)Rheumatoid arthritis 101 20 (20)Mixed connective tissue disease 30 5 (17)Primary Sjogrens syndrome 11 1 (9)Polymyositis/dermatomyositis 17 0Scleroderma 44 0Psoriatic arthritis 10 0Reactive arthritis 31 2 (7)Osteoarthritis 26 1 (4)Healthy controls 25 0

* Specificity for systemic lupus erythematosus versus all other diseases,90%; versus connective tissue diseases, 94%. Twenty-two patients had diffuse scleroderma, and 22 patients hadlimited scleroderma.

AUF1 PROTEINS IN SLE AND RELATED AUTOIMMUNE DISORDERS 515

8/14/2019 AUF-1-Erhan

6/10

137262. No serum was reactive with either theN-terminal or the C-terminal auxiliary domain alone.

Taken together, these analyses identified a major,presumably discontinuous epitope composed of se-quences contained in the N-terminal auxiliary domainand RRM 1 (Figure 3B). This unique epitope recogni-tion explains the lack of cross-reactivity with hnRNP A2

and A1, because these proteins do not have similarN-terminal domains (21).

Localization of the binding site for oligonucleo-

tides containing AREs. Rapid degradation of manyunstable mRNA is regulated in part by AREs, which arelocated in the 3-UTR (22). It has been shown previouslythat both cellular and recombinant AUF1 can bind

Figure 3. Epitope mapping of AUF1. A, Reactivity of recombinant AUF1p45 fragments with a representative serum from a patient

with systemic lupus erythematosus (SLE). The positions of the NH2- and COOH-terminal amino acids of the fragments are indicatedat the top of the lanes. The top panel shows Coomassie blue staining, and the bottom panel shows results of immunoblot analysis. Lane

1, Full-length AUF1p45; lane 2, fragment 1262 lacking the C-terminal auxiliary domain; lane 3, fragment 10262; lane 4, fragment

20262; lane 5, fragment 30262; lane 6, fragment 62262 lacking the N-terminal auxiliary domain; lane 7, fragment 1173 comprising

the N-terminal domain and RNA recognition motif 1 (RRM 1); lane 8, fragment 1145 lacking 28 C-terminal amino acids from RRM1; lane 9, fragment 170 corresponding to the N-terminal auxiliary domain; lane 10, fragment 256362 containing the glycine-rich

C-terminal auxiliary domain. B, Summary of the immunoblotting results obtained with 11 recombinant fragments of AUF1. The

N-terminal region of RRM 1 and RRM 2 and the glycine-rich auxiliary domain are schematically drawn; numbers above the AUF1model designate the amino acid positions at the border of each domain. The amino acids bordering the deletion mutants are indicated.

The numbers of reactive sera are shown on the right side. The major epitope recognized by most sera was located between amino acids

1 and 173, and a minor epitope recognized by sera from some patients with rheumatoid arthritis (RA) or mixed connective tissuedisease (MCTD) was identified between amino acids 62 and 262. RBD RNA binding domain.

516 SKRINER ET AL

8/14/2019 AUF-1-Erhan

7/10

specifically to AREs. Using the oligonucleotide(AUUUA)4 as a prototype ARE, the RNA-bindingproperties of AUF1 fragments were investigated in UVcrosslinking assays (Figure 4A). Similar results wereobtained with the p42 and p45 variants. Compared withthe binding capacity of full-length proteins, the bindingcapacity of fragment 1262 was 70%, while binding ofthe RNA to fragment 1239 (lacking 17 amino acidsfrom the C-terminal part of RRM 2) was reduced to40%. Fragment 1189 (lacking RRM 2) and fragment137262 (lacking most of RRM 1) showed only 20%binding capacity, and no binding was visible with frag-

ment 167262 (corresponding to RRM 2) and fragment1173 (N-terminus plus RRM 1) (data not shown). Incontrast, fragment 167354, containing RRM 2 and theentire C-terminal part, showed 70% binding activity.

The C-terminal auxiliary domain also contributesto binding, because truncation of this part led to reducedbinding capacity, and the fragment containing RRM 2plus the C-terminal domain showed a binding capacitysimilar to that of fragment 1262. Thus, these results

were in good agreement with previous findings fromother investigators (21). Of note, fragment 1173 (N-terminal domain plus RRM 1), comprising the majorepitope, did not interact with the (AUUUA)4 oligo-nucleotide. Furthermore, anti-AUF1 antibodies frompatients with SLE, RA, or MCTD did not inhibit RNAbinding (data not shown), indicating that the bindingsites for RNA and those for autoantibodies are different.

AUF1ARE complexes are supershifted by anti-

AUF1 autoantibodies. To investigate the simultaneousinteraction of autoantibodies and ARE with AUF1,supershift experiments were performed in which the

recombinant protein was incubated simultaneously withRNA oligonucleotides and sera or affinity-purified pa-tient antibodies. In these experiments, both (AUUUA)4and the ARE of human TNF mRNA were used (Figure4B); both sequences were supershifted by affinity-purified anti-AUF1 antibodies but not by antibodies tohnRNP A2 obtained from the same patient. In controlcompetition experiments, unlabeled homologous AREcould abolish supercomplex formation, whereas a

Figure 4. Interaction of AUF1 with AU-rich element (ARE). A, Binding of AUF1 anddeletion mutants to the 32P-labeled oligoribonucleotide (AUUUA)4 representing a proto-

type ARE as determined by ultraviolet crosslinking assay. Crosslinked products were

resolved by sodium dodecyl sulfatepolyacrylamide gel electrophoresis and autoradio-graphed. B, AUF1ARE gel-shift assays performed with AUF1p45 and (AUUUA)4 or the

ARE regulatory sequence of human tumor necrosis factor (TNF) mRNA (TNFARE).

For supershift assays, affinity-purified patient antibodies to AUF1 or heterogeneous nuclearRNP A2 (hnRNP A2; Ab2) were used. The anti-AUF1 antibody was able to shift both

AUF1ARE complexes (lanes 2 and 7), while the affinity-purified antihnRNP A2 control

antibody did not (lane 5). Lane 1, Complex of AUF1 with TNFARE; lane 2, complexformed by the addition of anti-AUF1 antibody; lane 3, competition with nonradioactive

TNF oligoribonucleotide (10 molar excess); lane 4, competition with 10 molar excess

of -globin oligoribonucleotide; lane 5, addition of affinity-purified antihnRNP A2

autoantibody; lane 6, complex of AUF1 with (AUUUA)4; lane 7, complex formed by theaddition of anti-AUF1; lane 8, oligoribonucleotide (AUUUA)4. Cterm C-terminal; COI

cold inhibition.

AUF1 PROTEINS IN SLE AND RELATED AUTOIMMUNE DISORDERS 517

8/14/2019 AUF-1-Erhan

8/10

-globin RNA oligoribonucleotide had little effect.Taken together, these data confirmed the existence ofdifferent binding sites on AUF1 for ARE and autoanti-

bodies.Expression of AUF1 in synovial tissue. Because

previous studies had revealed hnRNP A2 to be highlyexpressed in synovial tissue from patients with RA andarthritic mice (23,24), we analyzed the expression of

AUF1 in synovial tissue from patients with RA andcontrol subjects. Using rabbit antibodies recognizing theN-terminal amino acid sequence of AUF1, expression

was investigated by immunohistochemistry in synovialtissue from patients with RA or patients with OA, as wellas in tissue derived from normal subjects. These analysesrevealed AUF1 to be highly expressed in RA tissue,

particularly in type A synoviocytes of the lining layer andin type B synoviocytes of the sublining areas (Figures 5Aand D). Interestingly, both nuclear expression and cyto-plasmic expression were seen in the cells of RA synovialtissue, especially in the lining layer, in contrast to theexclusive nuclear staining observed in OA and normaltissue (Figures 5B, C, and E). High expression was alsoseen in endothelial cells, while weaker expression wasobserved in infiltrating lymphocytes (results not shown).

DISCUSSION

In this study, we describe autoantibody responses

to the AUF1 proteins in sera from patients with rheu-matic diseases. The antibodies were most frequentlydetected in sera from patients with SLE, were reactive

with both natural and recombinant AUF1 proteins, anddid not cross-react with other nuclear proteins, includingthe closely related hnRNP A/B proteins. The AUF1proteins are multifunctional proteins that show a pre-dominant nuclear localization. They partially colocalize

with snRNP, but are also part of cytoplasmic mRNAdecay complexes, where they mediate mRNA degrada-tion via the exosome (25). The high expression andpartial cytoplasmic localization of AUF1 in HEp-2 andHeLa cells as well as in synovial cells from patients with

RA leads us to suggest that non-spliceosomal structuresin the cytoplasm such as mRNA transport or mRNAdecay complexes may form autoimmune targets.

Thus, we hypothesize that cytoplasmic mRNAdecay complexes, in which AUF1 seems to play a crucialrole, might induce loss of tolerance to AUF1 not only inpatients with RA but also in patients with SLE. This

would explain the lack of association of anti-AUF1 withantibodies to spliceosomal proteins, because the major-

Figure 5. Immunohistochemical analysis of AUF1 expression in synovial tissue. Paraffin-embedded

sections of synovial tissue obtained from patients with rheumatoid arthritis (RA) (A and D), patients with

osteoarthritis (OA) (B and E), and a healthy subject (C) were stained with a polyclonal rabbit anti-AUF1antibody (red). Strong nuclear staining (white arrows) and cytoplasmic staining (black arrows) can be seen

in RA synovial tissue, while staining appears to be strictly nuclear in OA synovial tissue. (Original

magnification 200 in AC; 400 in D and E.)

518 SKRINER ET AL

8/14/2019 AUF-1-Erhan

9/10

ity of anti-AUF1positive patients with SLE did nothave antibodies to Sm or U1 snRNP. Because in patients

with SLE, anti-AUF1 antibodies occurred indepen-dently of other serologic markers for this disorder suchas antidouble-stranded DNA or anti-Ro antibodies,

they might have some diagnostic value for SLE, partic-ularly because they were absent or rare in other connec-tive t issue diseases such as scleroderma andpolymyositis/dermatomyositis. Thus, their sensitivity andspecificity for SLE were 33% and 90%, respectively,

which is comparable with antiU1 snRNP antibodies.The detailed epitope mapping study performed

with sera from patients with SLE, patients with RA, andpatients with MCTD revealed that the major antigenicregion is presumably conformation dependent. The ma-

jor epitope appears to be composed of sequences con-tained in the unique N-terminal region, which is not

shared by any other hnRNP protein, and part of RRM 1, which shows70% homology with RRM 1 of hnRNPA2. This epitope was recognized by most sera, whereas afragment containing RRM 2 was not reactive at all. Thisresult explains the lack of cross-reactivity with theclosely related hnRNP A2, whose major epitope islocated in RRM 2 (19). No difference in epitope recog-nition was observed between RA and SLE sera, while 3of 5 MCTD sera were reactive with a fragment contain-ing both RRMs, which was not recognized at all by SLEsera and was recognized by only 2 of 9 sera from patients

with RA. Remarkably, the C-terminal glycine-rich partof AUF1 was not recognized by autoantibodies, a find-

ing that is consistent with the results obtained previouslyfor hnRNP A2 (19).

Mapping the binding site of the oligonucleotidecontaining the AUUUA decay sequence confirmed thatboth RRMs and the unique N-terminal domain arerequired for interaction with this and other AREs.Because anti-AUF1 antibodies can bind simultaneously

with the RNA, as demonstrated by gel-shift assays, wespeculate that the autoimmune response might be di-rected to an initiating mRNA decay complex. Some ofthe enzymes involved in mRNA degradation are con-centrated in discrete cytoplasmic foci known as mRNA

processing bodies (P-bodies; also known as GW bodies)(20,26,27). The most common clinical diagnosis of pa-tients with anti-GW182 antibodies is Sjogrens syn-drome, followed by neurologic disease and SLE. AUF1might be part of this decay complex, because GFP-tagged AUF1 and affinity-purified anti-AUF1 antibod-ies stained discrete cytoplasmic regions that might cor-respond to P-bodies. Thus, it remains to be shown

whether AUF1 is indeed localized in such bodies or is

rather part of another structure formed during mRNAdecay.

One of these structures might be the exosome.This is a large multiprotein complex of which proteinssuch as AUF1, HuR, and TTP are part (28,29). These

proteins bind directly to the ARE before other proteinsassociate. Binding of AUF1 seems to be essential toform the exosome, and AUF1 is part of mRNA com-plexes that are degraded or exported. Interestingly, 2human exosome components, PMScl-100 and PMScl-75, are recognized by sera from patients with thepolymyositisscleroderma overlap syndrome (30,31).However, the complete absence of anti-AUF1 antibod-ies in patients with scleroderma or polymyositis/dermatomyositis along with the absence of antiexosomalantibodies in patients with SLE suggest that patients

with SLE do not target AUF1 contained in exosomalcomplexes, while mRNA decay complexes do not appearto form major target structures in scleroderma andrelated disorders.

The investigation of AUF1 protein expression insynovial tissue demonstrated that AUF1 proteins wereexpressed in tissue from patients with RA, patients withOA, and normal subjects. Of note, the number of cellsexpressing the antigen was higher in RA synovial tissuethan in OA and normal tissue samples. Interestingly, inRA but not OA synoviocytes, AUF1 proteins appearedto be expressed not only in the nucleus but also in thecytoplasm, which might be related to their establishedfunction in regulating mRNA decay of TNF and other

proinflammatory cytokines. Evidence from mice withaltered cytokine mRNA stability, along with humandata, suggests that the imbalance between the stabilityand decay of inflammatory cytokine mRNA regulated by

AUF1 could represent a basic mechanism leading toautoimmunity (32,33).

In conclusion, the AUF1 proteins have beenidentified as a novel group of autoantigens in patients

with systemic autoimmune diseases, particularly SLE,RA, and MCTD. These findings suggest that anti-AUF1antibodies target the mRNA decay complex, which mayform another large RNP target structure in systemicautoimmunity. We hypothesize that increased formation

of such complexes (e.g., due to overexpression of insta-ble mRNA such as those for interleukin-1 and TNF)may lead to pathologic autoimmune reactions against

AUF1 and other proteins of mRNA decay complexes.

AUTHOR CONTRIBUTIONS

Dr. Skriner had full access to all of the data in the study andtakes responsibility for the integrity of the data and the accuracy of thedata analysis.

AUF1 PROTEINS IN SLE AND RELATED AUTOIMMUNE DISORDERS 519

8/14/2019 AUF-1-Erhan

10/10

Study design. Skriner.Acquisition of data. Skriner, Hueber, Suleymanoglu, Hofler, Krenn.Analysis and interpretation of data. Skriner, Steiner.Manuscript preparation. Skriner, Smolen, Steiner.Statistical analysis. Skriner, Steiner.

REFERENCES

1. Von Muhlen CA, Tan EM. Autoantibodies in the diagnosis ofsystemic rheumatic diseases. Semin Arthritis Rheum 1995;24:32358.

2. Van Venrooij W, Pruijn GJ. Ribonucleoprotein complexes asautoantigens. Curr Opin Immunol 1995;7:81924.

3. Tan EM. Antinuclear antibodies: diagnostic markers of autoim-mune diseases and probes for cell biology [review]. Adv Immunol1989;4:93151.

4. Hardin JA. The lupus autoantigens and the pathogenesis ofsystemic lupus erythematosus. Arthritis Rheum 1986;29:45760.

5. Dreyfuss G, Matunis MJ, Pinol-Roma S, Burd CG. hnRNPproteins and the biogenesis of mRNA. Annu Rev Biochem1993;62:289321.

6. Tighe H, Carson DA. Rheumatoid factors. In: Kelley WN, HarrisED Jr, Ruddy S, Sledge CB, editors. Textbook of rheumatology.5th ed. Philadelphia: WB Saunders: 1997. p. 2419.

7. Astaldi-Ricotti GC, Bestagno M, Cerini A, Negri R, Caporali R,Cobianchi F, et al. Antibodies to hnRNP core protein A1 inconnective tissue diseases. J Cell Biochem 1989;40:15.

8. Montecucco C, Caporali R, Cobianchi F, Biamonti G. Identifica-tion of autoantibodies to the I protein of the heterogeneousnuclear ribonucleoprotein complex in patients with systemic scle-rosis. Arthritis Rheum 1996;39:166976.

9. Hassfeld W, Steiner G, Studnicka-Benke A, Skriner K, GraningerW, Fischer I, et al. Autoimmune response to the spliceosome: animmunologic link between rheumatoid arthritis, mixed connectivetissue disease, and systemic lupus erythematosus. Arthritis Rheum1995;38:77785.

10. Pinol-Roma S, Dreyfuss G. Shuttling of pre-mRNA bindingproteins between nucleus and cytoplasm. Nature 1992;355:7302.

11. Xu N, Chen CY, Shyu AB. Versatile role for hnRNP D isoformsin the differential regulation of cytoplasmic mRNA turnover. MolCell Biol 2001;21:696071.

12. Moraes KC, Quaresma AJ, Maehnss K, Kobarg J. Identificationand characterization of proteins that selectively interact withisoforms of the mRNA binding protein AUF1 (hnRNP D). BiolChem 2003;384:2537.

13. Wagner BJ, DeMaria CT, Sun Y, Wilson GM, Brewer G. Struc-ture and genomic organization of the human AUF1 gene: alter-native pre-mRNA splicing generates four protein isoforms.Genomics 1998;48:195202.

14. Arnett FC, Edworthy SM, Bloch DA, McShane DJ, Fries JF,Cooper NS, et al. The American Rheumatism Association 1987revised criteria for the classification of rheumatoid arthritis.

Arthritis Rheum 1988;31:31524.15. Tan EM, Cohen AS, Fries JF, Masi AT, McShane DJ, Rothfield

NF, et al. The 1982 revised criteria for the classification of systemiclupus erythematosus. Arthritis Rheum 1982;25:12717.

16. Alarcon-Segovia D, Villareal M. Classification and diagnosticcriteria for mixed connective tissue diseases. In: Kasukawa R,Sharp GC, editors. Mixed connective tissue diseases and anti-nuclear antibodies. Amsterdam: Elsevier; 1987. p. 3340.

17. Steiner G, Hartmuth K, Skriner K, Maurer-Fogy I, Sinski A,Thalmann E, et al. Purification and partial sequencing of thenuclear autoantigen RA33 shows that it is indistinguishable from

the A2 protein of the heterogeneous nuclear ribonucleoproteincomplex. J Clin Invest 1992;90:10616.

18. Hel Z, Di Marco S, Radzioch D. Characterization of the RNAbinding proteins forming complexes with a novel putative regula-tory region in the 3-UTR of TNF- mRNA. Nucleic Acids Res1998;26:280312.

19. Skriner K, Sommergruber WH, Tremmel V, Fischer I, Barta A,Smolen JS, et al. Anti-A2/RA33 autoantibodies are directed to theRNA binding region of the A2 protein of the heterogeneousnuclear ribonucleoprotein complex: differential epitope recogni-tion in rheumatoid arthritis, systemic lupus erythematosus, andmixed connective tissue disease. J Clin Invest 1997;100:12735.

20. Sheth U, Parker R. Decapping and decay of messenger RNAoccur in cytoplasmic processing bodies. Science 2003;300:8058.

21. DeMaria CT, Sun Y, Long L, Wagner BJ, Brewer G. Structuraldeterminants in AUF1 required for high affinity binding to A U-rich elements. J Biol Chem 1997;272:2763543.

22. Loflin P, Chen CY, Shyu AB. Unraveling a cytoplasmic role forhnRNP D in the in vivo mRNA destabilization directed by the

AU-rich element. Genes Dev 1999;13:188497.23. Fritsch R, Eselbock D, Skriner K, Jahn-Schmid B, Scheinecker C,

Bohle B, et al. Characterization of autoreactive T cells to theautoantigens heterogeneous nuclear ribonucleoprotein A2(RA33) and filaggrin in patients with rheumatoid arthritis. J Im-munol 2002;169:106876.

24. Hayer S, Tohidast-Akrad M, Haralambous S, Jahn-Schmid B,Skriner K, Trembleau S, et al. Aberrant expression of the autoan-tigen heterogeneous nuclear ribonucleoprotein-A2 (RA33) andspontaneous formation of rheumatoid arthritis-associated anti-RA33 autoantibodies in TNF- transgenic mice. J Immunol2005;175:832736.

25. Lal A, Mazan-Mamczarz K, Kawai T, Yang X, Martindale JL,Gorospe M. Concurrent versus individual binding of HuR and

AUF1 to common labile target mRNAs. EMBO J 2004;23:3092102.

26. Eystathioy T, Chan EK, Tenenbaum SA, Keene JD, Griffith K,Fritzler MJ. A phosphorylated cytoplasmic autoantigen, GW182,associates with a unique population of human mRNAs withinnovel cytoplasmic speckles. Mol Biol Cell 2002;13:133851.

27. Cougot N, Babajko S, Seraphin B. Cytoplasmic foci are sites ofmRNA decay in human cells. J Cell Biol 2004;165:3140.

28. Van Hoof A, Parker R. The exosome: a proteasome for RNA?Cell 1999;99:34750.

29. Sully G, Dean JL, Wait R, Rawlinson L, Santalucia T, SaklatvalaJ, et al. Structural and functional dissection of a conserveddestabilizing element of cyclo-oxygenase-2 mRNA: evidenceagainst the involvement of AUF-1 (AU-rich element/poly[U]-binding/degradation factor-1), AUF-2, tristetraprolin, HuR (Huantigen R) or FBP1 (far-upstream-sequence-element-binding pro-tein 1). Biochem J 2004;377(Pt 3):62939.

30. Ge Q, Frank MB, OBrien C, Targoff. Cloning of a complemen-tary DNA coding for the 100-kD antigenic protein of the PM-Sclautoantigen. J Clin Invest 1992;90:55970.

31. Alderuccio F, Chan EK, Tan EM. Molecular characterization ofan autoantigen of PM-Scl in the polymyositis/scleroderma overlapsyndrome: a unique and complete human cDNA encoding anapparent 75-kD acidic protein of the nucleolar complex. J ExpMed 1991;173:94152.

32. Kontoyiannis D, Pasparakis M, Pizarro TT, Cominelli F, KolliasG. Impaired on/off regulation of TNF biosynthesis in mice lackingTNF AU-rich elements: implications for joint and gut-associatedimmunopathologies. Immunity 1999;10:38798.

33. Vassalli P. The pathophysiology of tumor necrosis factors. AnnuRev Immunol 1992;10:41152.

520 SKRINER ET AL