association of renin-angiotensin system genetic

CLINICAL ARTICLEJ Neurosurg 128:86–93, 2018

ABBREVIATIONS ACE = angiotensin-converting enzyme; AGT = angiotensinogen; aSAH = aneurysmal subarachnoid hemorrhage; AT1 = angiotensin II receptor Type 1; AT2 = angiotensin II receptor Type 2; CARAS = Cerebral Aneurysm Renin-Angiotensin System; CTA = CT angiography; HWE = Hardy-Weinberg equilibrium; I/D = inser-tion/deletion; MAF = minor allele frequency; PCR = polymerase chain reaction; RAS = renin-angiotensin system; SNP = single-nucleotide polymorphism; VSMC = vascular smooth-muscle cell.SUBMITTED June 16, 2016. ACCEPTED September 13, 2016.INCLUDE WHEN CITING Published online January 20, 2017; DOI: 10.3171/2016.9.JNS161593.

Association of renin-angiotensin system genetic polymorphisms and aneurysmal subarachnoid hemorrhageChristoph J. Griessenauer, MD,1–4 R. Shane Tubbs, PhD,3 Paul M. Foreman, MD,4 Michelle H. Chua, BS,2 Nilesh A. Vyas, MD,5 Robert H. Lipsky, PhD,5,6 Mingkuan Lin, PhD,6 Ramaswamy Iyer, PhD,7 Rishikesh Haridas, MS,7 Beverly C. Walters, MD, MSc, FRCSC,4,5 Salman Chaudry, BS,6 Aisana Malieva, BS,6 Samantha Wilkins, MA,6 Mark R. Harrigan, MD,4 Winfield S. Fisher III, MD,4 and Mohammadali M. Shoja, MD3

1Beth Israel Deaconess Medical Center; 2Harvard Medical School, Boston, Massachusetts; 3Children’s of Alabama; 4Department of Neurosurgery, University of Alabama at Birmingham, Alabama; 5Department of Neurosciences; 7Inova Translational Medicine Institute, Inova Health System, Falls Church; and 6Department of Molecular Neuroscience, George Mason University, Fairfax, Virginia

OBJECTIVE Renin-angiotensin system (RAS) genetic polymorphisms are thought to play a role in cerebral aneurysm formation and rupture. The Cerebral Aneurysm Renin-Angiotensin System (CARAS) study prospectively evaluated com-mon RAS polymorphisms and their relation to aneurysmal subarachnoid hemorrhage (aSAH).METHODS The CARAS study prospectively enrolled aSAH patients and controls at 2 academic centers in the United States. A blood sample was obtained from all patients for genetic evaluation and measurement of plasma angiotensin-converting enzyme (ACE) concentration. Common RAS polymorphisms were detected using 5′ exonuclease (TaqMan) genotyping assays and restriction fragment length polymorphism analysis.RESULTS Two hundred forty-eight patients were screened, and 149 aSAH patients and 50 controls were available for analysis. There was a recessive effect of the C allele of the angiotensinogen (AGT) C/T single-nucleotide polymorphism (SNP) (OR 1.94, 95% CI 0.912–4.12, p = 0.0853) and a dominant effect of the G allele of the angiotensin II receptor Type 2 (AT2) G/A SNP (OR 2.11, 95% CI 0.972–4.57, p = 0.0590) on aSAH that did not reach statistical significance after adjustment for potential confounders. The ACE level was significantly lower in aSAH patients with the II genotype (17.6 ± 8.0 U/L) as compared with the ID (22.5 ± 12.1 U/L) and DD genotypes (26.6 ± 14.2 U/L) (p = 0.0195).CONCLUSIONS The AGT C/T and AT2 G/A polymorphisms were not significantly associated with aSAH after control-ling for potential confounders. However, a strong trend was identified for a dominant effect of the G allele of the AT2 G/A SNP. Downregulation of the local RAS may contribute to the formation of cerebral aneurysms and subsequent presenta-tion with aSAH. Further studies are required to elucidate the relevant pathophysiology and its potential implication in treatment of patients with aSAH.https://thejns.org/doi/abs/10.3171/2016.9.JNS161593KEY WORDS renin; angiotensin; cerebral aneurysm; rupture; subarachnoid hemorrhage; vascular disorders

Cerebral aneurysm formation is a multifactorial process involving a complex interplay among en-vironmental exposures (e.g., tobacco smoking,

alcohol consumption), biomechanical features (i.e., shear stress, vessel geometry), cellular and molecular charac-teristics (i.e., extracellular matrix degradation, inflam-

mation), and genetic predisposition.2,4 While triggers for aneurysmal subarachnoid hemorrhage (aSAH) remain poorly understood, mounting evidence suggests that ge-netic factors not only contribute to aneurysm formation, but also to aneurysm rupture.13,22

The renin-angiotensin system (RAS), composed of 2

J Neurosurg Volume 128 • January 201886 ©AANS 2018, except where prohibited by US copyright law

Unauthenticated | Downloaded 04/20/22 12:53 PM UTC

Renin-angiotensin system in aneurysmal SAH

J Neurosurg Volume 128 • January 2018 87

major enzymes (renin and angiotensin-converting enzyme [ACE]) and their substrates (angiontensinogen and angio-tensin I), plays a crucial role in physiological vasorelax-ation/vasoconstriction,3,6 vascular remodeling, and mainte-nance of arterial wall integrity.15 The main effector of the RAS is angiotensin II. Dysfunction of the RAS has been implicated in systemic and local vascular diseases that in-clude hypertension, atherosclerosis, abdominal aortic an-eurysms, and cerebral aneurysms.21 The existence of the RAS in the cerebral vasculature is well established.10 As compared with unruptured aneurysms and normal arterial walls, ruptured aneurysms express significantly less ACE and angiotensin II receptor Type 1 (AT1) protein,15 indicat-ing a lack of vascular remodeling that prevents the arterial wall from undergoing physiological thickening under he-modynamic stress and predisposing to aneurysm rupture.

The significance of the ACE insertion/deletion (I/D) polymorphism in aSAH has been assessed in multiple studies with inconclusive results. Whereas the I allele and the II genotype of this polymorphism were associated with aSAH in studies from Poland22 and the United King-dom,13 no such association was identified in Denmark23 and the United States.16 The significance of other RAS genetic polymophisms as a risk factor for aSAH has not been studied. We sought to evaluate the association be-tween common RAS polymorphisms (involving the an-giotensinogen [AGT], ACE, AT1 [also known as AGTR1], and angiotensin II receptor Type 2 [AT2, also known as AGTR2] genes) and aSAH.

MethodsThe prospective Cerebral Aneurysm Renin-Angioten-

sin System (CARAS) study was performed at 2 academic institutions in the United States from September 2012 to January 2015 with a primary objective of evaluating the role of common RAS genetic polymorphisms in aSAH.7–9 The aSAH group included all patients presenting with aSAH in the absence of exclusion criteria. The diagnosis of aSAH was established on the basis of the admission CT scan or xanthochromia of cerebrospinal fluid. A ruptured aneurysm as the source of hemorrhage was confirmed by CT angiography (CTA) or digital subtraction angiogra-phy. Exclusion criteria were age under 19 years and any associated genetic predisposition known to contribute to cerebral aneurysm formation (polycystic kidney disease, Turner syndrome, Noonan syndrome, Ehlers-Danlos syn-drome Type 4, Marfan syndrome, or neurofibromatosis Type 1), as well as systemic diseases (congestive heart fail-ure or cirrhosis) that could interfere with RAS activity.14 The control group comprised trauma patients, 19 years of age and older, with unremarkable findings on CTA of the head and neck (no cerebral aneurysm or other vascular malformation) and without known genetic risk factors for cerebral aneurysm formation. Controls underwent CTA due to suspicion for traumatic cerebrovascular injury and were matched to aSAH patients for age and sex. Both aSAH patients and controls were enrolled within 72 hours of hospital admission.

Laboratory and Genetic EvaluationA blood sample was obtained from all patients within

72 hours of admission for genetic evaluation and mea-surement of plasma ACE concentration. Plasma ACE concentration was measured solely in aSAH patients. Common RAS genetic polymorphisms (Table 1) were detected using 5′ exonuclease (TaqMan, Thermo Fisher Scientific Inc.) genotyping assays [single nucleotide poly-morphisms (SNPs) AGT C/T (rs699), AT1 A/C (rs5186), AT2 A/C (rs11091046) and G/A (rs1403543)] and restric-tion fragment length polymorphism analysis [ACE I/D (rs4340)]. Commercial TaqMan assays were designed and performed according to the vendor’s specifications. Ap-proximately 10% of the DNA samples were randomly se-lected to test reproducibility of TaqMan assays. All of the replication samples produced concordant genotypes. For the ACE I/D polymorphism, a polymerase chain reaction (PCR)–based gel assay was used for the first round of ge-notyping with a second round replication performed using an amplification reaction containing 5 ng/ml of genomic DNA, 2 mM of forward and reverse primers in a FailSafe PCR premix B 1× reaction (Epicentre). Polymerase chain reactions were performed in a C100 Touch thermal cycler (Bio-Rad), using cycling conditions as follows: 30 cycles with denaturation at 94°C for 1 minute, annealing at 58°C for 1 minute, and extension at 72°C for 2 minutes. The PCR primers were: forward primer, sense oligo 5′CTG GAGACCACTCCCATCCTTCT3′; and reverse primer, 5′GATGTGGCCATCACATTCGTCAGAT3′. PCR prod-ucts were resolved using a Qiagen QIAxcel system to discriminate 490-bp (insertion) from 202-bp (deletion) alleles.

Statistical AnalysisAllele frequencies for the individual SNPs and the

ACE I/D were compared between aSAH patients and con-trols by Fisher’s exact test. Hardy-Weinberg equilibrium (HWE) was assessed by chi-square test in aSAH patients and controls separately. To identify potential confound-ing variables, we tested for associations between relevant baseline characteristics (age, sex, race, ischemic vascular disease, hypertension, family history, and smoking) and outcome (aSAH), allele distribution, and genotype. Cat-egorical variables and numerical variables were compared by Fisher’s exact test and the Wilcoxon signed-rank test, respectively. The association of genotype and aSAH was tested using logistic regression with standard methods for dominant and recessive models adjusting for potential confounders.

ResultsBetween September 2012 and February 2015, 166

aSAH patients were admitted at 2 academic institutions in the United States and screened for study inclusion. Nine patients who were screened were not eligible or did not consent. A total of 157 aSAH patients were enrolled. One aSAH patient withdrew from the study, and blood samples from 7 aSAH patients could not be processed; data from the remaining 149 aSAH cases were analyzed. Eighty-two patients with a history of trauma and unremarkable CTA of head and neck were screened as controls. Samples from 50 controls were suitable for analysis (Fig. 1).


C. J. Griessenauer et al.

J Neurosurg Volume 128 • January 201888

Patient CharacteristicsThe mean ages of the aSAH patients and controls

were 54.9 ± 12.5 and 50.6 ± 18.6 years, respectively (p = 0.239). Sex was evenly distributed between the 2 groups. There was a higher proportion of African Americans in the aSAH group than in the control group (p = 0.00136). History of hypertension (p = 0.0140) and family history of cerebral aneurysms (p = 0.0233) were more frequent in the aSAH group (Table 2).

ACE ConcentrationThe ACE concentration was significantly lower in

aSAH patients with the II genotype (17.6 ± 8.0 U/L) than in those with the ID (22.5 ± 12.1 U/L) or DD genotype (26.6 ± 14.2 U/L) (p = 0.0195). The enzyme level was not available in all 28 patients recruited at one of the study sites. No patient had any of the conditions known to be associated with elevated ACE levels.14

Association of RAS Polymorphisms and aSAHGenotype frequencies of the individual SNPs and ACE

I/D polymorphism were found to be in HWE. The X-linked AT2 SNPs were in HWE in males and females (Table 3).

AGT C/T Polymorphism (rs699)The C allele (59.1% vs 51.0%, p = 0.196) of the AGT

C/T polymorphism was more common in aSAH patients than in controls, but the association did not reach statisti-cal significance (Table 3). In logistic regression, there was a recessive effect (CC vs CT + TT) of the C allele of the AGT C/T SNP (OR 1.94, 95% CI 0.912–4.12, p = 0.0853) on aSAH that did not reach statistical significance after adjusting for potential confounders (Table 4). The minor allele frequency (MAF) of the T allele reported in the 1000-genome project was 29%.1

ACE I/D Polymorphism (rs4340)No allele association of the ACE I/D polymorphism

with aSAH was identified (Table 3).

AT1 A/C Polymorphism (rs5186)No allele association of the AT1 A/C polymorphism

with aSAH was identified (Table 3). The MAF of the C allele reported in the 1000-genome project was 11%.1

AT2 C/A (rs11091046) PolymorphismNo allele association of the AT2 C/A polymorphism

with aSAH was identified (Table 3). The MAF of the A allele reported in the 1000-genome project was 47%.1

TABLE 1. Common renin-angiotensin system polymorphisms

Gene Symbol (rsID) Variant

AGT (C/T, rs699) Methionine → threonine (Met235Thr/M235T)ACE (I/D, rs4340) Insertion/deletion in intron 16AT1 (A/C, rs5186) Adenine → cytosine (A1166C)AT2 (C/A, rs11091046) Adenine → cytosine (C3123A)AT2 (G/A, rs1403543) Guanine → adenine (G1675A)

FIG. 1. Flowchart of participant enrollment.




AT2 G/A (rs1403543) PolymorphismThe G allele (56.7% vs 47.6%, p = 0.164) of the AT2

G/A polymorphism was more common in aSAH patients than in controls, but the association did not reach statisti-cal significance (Table 3). In logistic regression, there was a dominant effect (XGXG + XAXG + XGY vs XAXA + XAY) of the G allele of the AT2 G/A SNP (OR 2.11, 95% CI 0.972–4.57, p = 0.0590) on aSAH that did not reach sta-tistical significance after adjusting for potential confound-ers (Table 4). The MAF of the G allele reported in the 1000-genome project was 49%.1

DiscussionRenin-angiotensin system (RAS) polymorphisms have

widespread associations with pathologic conditions in the cerebrovascular and cardiovascular systems.5,17,19,21,24 Al-though previous reports have implicated the ACE I/D poly-morphism13,22 in aSAH, the role of other common RAS polymorphisms had not been explored. Despite the lack of statistically significant findings in the current study, the as-sociation of the C allele of the AGT C/T SNP and the G allele of the AT2 G/A SNP with aSAH is novel. The results from the CARAS study investigating associations of RAS polymorphisms and clinical course after aSAH were recent-ly published and identified significant associations with an-eurysm size at rupture, Hunt and Hess grade, clinical vaso-spasm, delayed cerebral ischemia, and functional outcome.9

RAS SNPs and aSAHAngiotensin-converting enzyme (ACE) circulates in

the plasma and mediates the conversion of angiotensin I to angiotensin II on the surface of pulmonary and renal endothelial cells. Angiotensin II is a potent vasoconstric-tor that increases vascular smooth-muscle cell (VSMC)

growth under conditions of hemodynamic stress.21 In the wall of cerebral aneurysms, particularly ruptured brain aneurysms, this process is dysfunctional. The function of the RAS is locally downregulated and results in thin-ning and weakening of the arterial wall.15 ACE also in-activates bradykinin. Bradykinin is a vasodilator that in-hibits VSMC proliferation (Fig. 2). The enzymatic activity of ACE is correlated with the I/D polymorphism. The II genotype is associated with the lowest ACE activity, thus bradykinin levels are predicted to be increased, resulting in more vascular dilation and less VSMC proliferation.27 In the present study, patients with the II genotype had the lowest serum ACE levels (17.6 ± 8.0 U/L). Both the I allele (OR 1.3)13 and the II genotype (OR 4.57)22 of the ACE I/D polymorphism have been associated with aSAH in Cau-casians in the United Kingdom and Poland, respectively, but studies in Caucasians from Denmark (I vs D allele OR 1.08)23 and the United States (II vs ID OR 0.98 and II vs DD OR 0.87)16 did not corroborate these findings. The only study in non-Caucasians detected a low frequency of DD genotype in Japanese patients with cerebral sac-

TABLE 3. Allele frequencies of RAS polymorphisms

Polymorphism & Allele

Group p Value*aSAH Controls

AGT C/T (rs699) C 176 (59.1%) 51 (51.0%)

0.196 T 122 (40.9%) 49 (49.0%) HWE p = 0.0412† p = 0.570†ACE I/D (rs4340) D 170 (57.0%) 55 (55.0%)

0.728 I 128 (43.0%) 45 (45.0%) HWE p = 0.241† p = 0.520†AT1 A/C (rs5186) A 235 (78.9%) 80 (80.0%)

0.920 C 63 (21.1%) 20 (20.0%) HWE p = 0.867† p = 0.377†AT2 C/A

(rs11091046)‡ C 138 (52.9%) 39 (48.1%)

0.525 A 123 (47.1%) 42 (51.9%) HWE p = 0.280† (males),

p = 0.261† (fe-males)

p > 0.99† (males), p = 0.391†

(females)AT2 G/A (rs1403543) A 114 (43.3%) 43 (52.4%)

0.164 G 149 (56.7%) 39 (47.6%) HWE p = 0.364† (males),

p = 0.473† (fe-males)

p = 0.371† (males),

p = 0.559† (females)

HWE = Hardy-Weinberg equilibrium.Data are given as n (%).* Fisher’s exact test.† Chi-square test.‡ Alleles were not available for 2 patients.

TABLE 2. Patient characteristics

CharacteristicGroup p

Value*aSAH (n = 149) Controls (n = 50)

Mean age, yrs 54.9 ± 12.5 50.6 ± 18.6 0.239Sex Male Female

35 (23.5%)114 (76.5%)

18 (36%)32 (64%)

0.0972

Race White African American Other

85 (57.0%)60 (40.3%)

4 (2.7%)

41 (82%)7 (14%)2 (4%)

0.00136

Ischemic vascular disease

13 (8.6%) 8 (16%) 0.183

Hypertension 90 (60.4%) 20 (40%) 0.0140Family history 14 (9.4%) 0 (0%) 0.0233Smoking Never Former Current

58 (38.9%)18 (12.1%)73 (49%)

21 (42%)9 (18%)

20 (40%)

0.407

Data are given in the form of n (%) unless otherwise indicated. Mean values are given with SDs.* Fisher’s exact test.




cular aneurysm (6% vs 15% in control patients, p = 0.044). Importantly, these patients did not experience aSAH.25 In our study, there was no association between the ACE I/D polymorphism and aSAH.

The association of the C allele of the AGT C/T polymor-phism with aSAH did not reach statistical significance. It is possible that our study was underpowered to detect a

significant difference between genotype groups. In other studies, the AGT CC genotype, encoding the threonine variant, has been associated with hypertension in women and increased plasma AGT levels,17,19 not the TT genotype, as erroneously stated in a related publication.9

Of the AT2 polymorphisms studied, the G allele of the AT2 G/A SNP demonstrated the strongest trend toward

TABLE 4. Significant and near-significant dominant and recessive effects of RAS polymorphisms

Polymorphism Effect Unadjusted OR (95% CI) p Value Adjusted OR (95% CI)* p Value

AGT C/T (rs699) Recessive effect of C allele (CC vs CT + TT) 2.02 (0.974–4.18) 0.0586 1.94 (0.912–4.12) 0.0853AT2 G/A (rs1403543) Dominant effect of G allele (XGXG + XAXG +

XGY vs XAXA + XAY)1.91 (0.979–3.72) 0.0577 2.11 (0.972–4.57) 0.0590

* Adjusted for age (years), sex, race, hypertension, and family history of intracranial aneurysms.

FIG. 2. The role of RAS in the pathogenesis of intracranial aneurysms. AT1 receptor = angiotensin II receptor Type 1 (defined as AT1 in the text); AT2 receptor = angiotensin II receptor Type 2 (defined as AT2 in the text). Reproduced with permission from Shoja MM, et al: The role of the renin–angiotensin system in the pathogenesis of intracranial aneurysms. J Renin Angiotensin Aldoste-rone Syst 12:262–273, 2011. Figure is available in color online only.




association with aSAH. This polymorphism has not previ-ously been assessed in the context of aSAH. The A allele of the AT2 G/A SNP has previously been associated with greater left ventricular wall thickness in young males with no or mild hypertension.18 Among male athletes, carriers of the A allele were also more likely to harbor left ventric-ular hypertrophy.11 Given these findings, the G allele may have antitrophic effects mediated through AT2 on VSMC and may thus be relevant to the formation and rupture of cerebral aneurysms.

RAS and aSAH: A HypothesisData from both human and animal studies indicate

that downregulation of the RAS contributes to aSAH. In patients with ruptured aneurysms, the aneurysm wall ex-pressed significantly less ACE, AT1 receptors, and angio-tensin II.15 The I allele of the ACE I/D polymorphism and the G allele of the AT2 G/A result in downregulated RAS activity and have been associated with aSAH.13,22

Angiotensin-(1–7), converted from angiotensin II by ACE2, was found to protect against the development of aSAH in mice through interactions with AT2. In absence of angiotensin-(1–7) or knockout of AT2, both surrogates for a downregulated RAS, the protective effect against aSAH was lost. Angiotensin-(1–7) is an important regula-tor of vascular remodeling and inflammation,20 making its association with aSAH plausible.

AT1 antagonists were found to inhibit platelet adhe-sion and aggregation.12 Accordingly, downregulation of RAS may increase the severity of aSAH via an antiplate-let effect. In the CARAS study, the I allele of the ACE I/D polymorphism was also associated with worse Hunt and Hess grade and functional outcome after aSAH.9 While aneurysm rupture may be associated with decreased lo-cal RAS activity, decreased systemic RAS activity may be responsible for the association with worse Hunt and Hess grade. Early studies on ACE and cerebral circula-tion showed that inhibition of ACE shifts the limits of ce-rebral autoregulation to lower blood pressure values.26 A sudden surge in intracranial pressure and deterioration of cerebral autoregulation due to decreased systemic RAS activity may complicate maintenance of cerebral perfu-sion. The potential effects of RAS on aSAH are summa-rized in Fig. 3.

Strengths and LimitationsA strength of this study lies in the meticulous control

for potential confounders and the identification of suit-able controls. In particular, adjustment for hypertension, a major risk factor for aSAH and important regulator of blood pressure, is critical. No other study that assessed the role of the ACE I/D polymorphism in aSAH13,16,22,23 radio-graphically ensured that controls did not harbor a cerebral aneurysm. All controls enrolled in the present study had

FIG. 3. Potential effects of RAS on aSAH.




unremarkable screening CTAs. Another obstacle in the interpretation of results from prior studies13,16,22, 23,25 is the focused approach to an interrelated system of enzymes and substrates. A change in the activity or level of a single molecule can be offset or modulated by others. Hence, studies of this kind should account for possible interac-tions between common polymorphisms as opposed to be-ing limited to a single component.21 A limitation of the study is the sample size. As such, the findings should be interpreted with caution until larger data sets are available for analysis. Another limitation is the considerable number of missing ACE levels in subjects recruited at one of the study sites.

ConclusionsThe AGT C/T and AT2 G/A polymorphisms were not

significantly associated with aSAH after controlling for potential confounders. However, a strong trend was identi-fied for a dominant effect of the G allele in the AT2 G/A SNP. The G allele of the AT2 G/A has been associated with decreased RAS activity. Downregulation of local RAS ac-tivity mediated through AT2 may affect vascular remodel-ing and promote antitrophic effects on VSMC relevant to the formation and rupture of cerebral aneurysms. Further studies are required to elucidate the relevant pathogenetics and the potential therapeutic implication of this finding.

AcknowledgmentsWe would like to thank the participants in this study and the

efforts of the neurosurgical research coordinators at Inova Health System for their work and contribution to the CARAS Study.

This work was conducted with support from Harvard Catalyst | The Harvard Clinical and Translational Science Center (National Center for Research Resources and the National Center for Advancing Translational Sciences, National Institutes of Health Award UL1 TR001102) and financial contributions from Harvard University and its affiliated academic health care centers. The content is solely the responsibility of the authors and does not nec-essarily represent the official views of Harvard Catalyst, Harvard University and its affiliated academic health care centers, or the National Institutes of Health.

We would like to thank the Brain Aneurysm Foundation and family of Timothy P. Susco for their generous support of the CARAS Study.

References 1. Abecasis GR, Auton A, Brooks LD, DePristo MA, Durbin

RM, Handsaker RE, et al: An integrated map of genetic vari-ation from 1,092 human genomes. Nature 491:56–65, 2012

2. Aoki T, Nishimura M: Targeting chronic inflammation in cerebral aneurysms: focusing on NF-kB as a putative target of medical therapy. Expert Opin Ther Targets 14:265–273, 2010

3. Brooks DP, Ruffolo RR: Functions mediated by peripheral angiotensin II receptors, in Ruffolo RR (ed): Angiotensin II Receptors, Vol 1: Molecular Biology, Biochemistry, Phar-macology and Clinical Perspectives. Boca Raton, FL: CRC Press, 1994, pp 71–102

4. Chalouhi N, Ali MS, Jabbour PM, Tjoumakaris SI, Gonzalez LF, Rosenwasser RH, et al: Biology of intracranial aneu-rysms: role of inflammation. J Cereb Blood Flow Metab 32:1659–1676, 2012

5. Chandra S, Narang R, Sreenivas V, Bhatia J, Saluja D,

Srivastava K: Association of angiotensin II type 1 receptor (A1166C) gene polymorphism and its increased expression in essential hypertension: a case-control study. PLoS One 9:e101502, 2014

6. Drenjancevic-Peric I, Phillips SA, Falck JR, Lombard JH: Restoration of normal vascular relaxation mechanisms in cerebral arteries by chromosomal substitution in consomic SS.13BN rats. Am J Physiol Heart Circ Physiol 289:H188–H195, 2005

7. Foreman PM, Chua M, Harrigan MR, Fisher WS III, Tubbs RS, Shoja MM, et al: Antifibrinolytic therapy in aneurysmal subarachnoid hemorrhage increases the risk for deep venous thrombosis: A case-control study. Clin Neurol Neurosurg 139:66–69, 2015

8. Foreman PM, Chua M, Harrigan MR, Fisher WS III, Vyas NA, Lipsky RH, et al: Association of nosocomial infections with delayed cerebral ischemia in aneurysmal subarachnoid hemorrhage. J Neurosurg 125:1383–1389, 2016

9. Griessenauer CJ, Tubbs RS, Foreman PM, Chua MH, Vyas NA, Lipsky RH, et al: Associations of renin-angiotensin sys-tem genetic polymorphisms and clinical course after aneu-rysmal subarachnoid hemorrhage. J Neurosurg [epub ahead of print June 10, 2016. DOI: 10.3171/2016.4.JNS16409]

10. Haberl RL, Decker-Hermann PJ, Hermann K: Effect of re-nin on brain arterioles and cerebral blood flow in rabbits. J Cereb Blood Flow Metab 16:714–719, 1996

11. Herrmann SM, Nicaud V, Schmidt-Petersen K, Pfeifer J, Erdmann J, McDonagh T, et al: Angiotensin II type 2 recep-tor gene polymorphism and cardiovascular phenotypes: the GLAECO and GLAOLD studies. Eur J Heart Fail 4:707–712, 2002

12. Kalinowski L, Matys T, Chabielska E, Buczko W, Malinski T: Angiotensin II AT1 receptor antagonists inhibit platelet adhesion and aggregation by nitric oxide release. Hyperten-sion 40:521–527, 2002

13. Keramatipour M, McConnell RS, Kirkpatrick P, Tebbs S, Furlong RA, Rubinsztein DC: The ACE I allele is associated with increased risk for ruptured intracranial aneurysms. J Med Genet 37:498–500, 2000

14. Lieberman J: Elevation of serum angiotensin-converting-en-zyme (ACE) level in sarcoidosis. Am J Med 59:365–372, 1975

15. Ohkuma H, Suzuki S, Fujita S, Nakamura W: Role of a de-creased expression of the local renin-angiotensin system in the etiology of cerebral aneurysms. Circulation 108:785–787, 2003

16. Pannu H, Kim DH, Seaman CR, Van Ginhoven G, Shete S, Milewicz DM: Lack of an association between the angio-tensin-converting enzyme insertion/deletion polymorphism and intracranial aneurysms in a Caucasian population in the United States. J Neurosurg 103:92–96, 2005

17. Petkeviciene J, Klumbiene J, Simonyte S, Ceponiene I, Jureniene K, Kriaucioniene V, et al: Physical, behavioural and genetic predictors of adult hypertension: the findings of the Kaunas Cardiovascular Risk Cohort study. PLoS One 9:e109974, 2014

18. Schmieder RE, Erdmann J, Delles C, Jacobi J, Fleck E, Hilg-ers K, et al: Effect of the angiotensin II type 2-receptor gene (+1675 G/A) on left ventricular structure in humans. J Am Coll Cardiol 37:175–182, 2001

19. Sethi AA, Nordestgaard BG, Agerholm-Larsen B, Frandsen E, Jensen G, Tybjaerg-Hansen A: Angiotensinogen polymor-phisms and elevated blood pressure in the general population: the Copenhagen City Heart Study. Hypertension 37:875–881, 2001

20. Shimada K, Furukawa H, Wada K, Wei Y, Tada Y, Kuwabara A, et al: Angiotensin-(1-7) protects against the development of aneurysmal subarachnoid hemorrhage in mice. J Cereb Blood Flow Metab 35:1163–1168, 2015

21. Shoja MM, Agutter PS, Tubbs RS, Payner TD, Ghabili K,




Cohen-Gadol AA: The role of the renin–angiotensin system in the pathogenesis of intracranial aneurysms. J Renin An-giotensin Aldosterone Syst 12:262–273, 2011

22. Slowik A, Borratynska A, Pera J, Betlej M, Dziedzic T, Krzyszkowski T, et al: II genotype of the angiotensin-convert-ing enzyme gene increases the risk for subarachnoid hemor-rhage from ruptured aneurysm. Stroke 35:1594–1597, 2004

23. Staalsø JM, Nielsen M, Edsen T, Koefoed P, Springborg JB, Moltke FB, et al: Common variants of the ACE gene and an-eurysmal subarachnoid hemorrhage in a Danish population: a case-control study. J Neurosurg Anesthesiol 23:304–309, 2011

24. Takami S, Imai Y, Katsuya T, Ohkubo T, Tsuji I, Nagai K, et al: Gene polymorphism of the renin-angiotensin system as-sociates with risk for lacunar infarction. The Ohasama study. Am J Hypertens 13:121–127, 2000

25. Takenaka K, Yamakawa H, Sakai H, Yoshimura S, Murase S, Okumura A, et al: Angiotensin I-converting enzyme gene polymorphism in intracranial saccular aneurysm individuals. Neurol Res 20:607–611, 1998

26. Waldemar G, Paulson OB: Angiotensin converting enzyme inhibition and cerebral circulation—a review. Br J Clin Pharmacol 28 (Suppl 2):177S–182S, 1989

27. Yayama K, Okamoto H: Angiotensin II-induced vasodilation via type 2 receptor: role of bradykinin and nitric oxide. Int Immunopharmacol 8:312–318, 2008

DisclosuresThe authors report no conflict of interest concerning the materi-

als or methods used in this study or the findings specified in this paper.

Author ContributionsConception and design: Griessenauer, Tubbs, Shoja. Acquisition of data: Griessenauer, Foreman, Vyas. Analysis and interpretation of data: Griessenauer, Foreman, Vyas, Lipsky, Lin, Iyer, Haridas, Chaudry, Malieva, Wilkins, Shoja. Drafting the article: Griessenauer, Foreman. Critically revising the article: Griessenauer, Tubbs, Foreman, Chua, Vyas, Lipsky, Harrigan, Fisher. Reviewed submitted version of manuscript: Griessenauer, Chua, Walters, Harrigan, Fisher, Shoja. Approved the final version of the manuscript on behalf of all authors: Griessenauer, Shoja. Statistical analysis: Griessenauer, Chua, Shoja. Administrative/technical/material support: Griessenauer, Lipsky, Harrigan, Fisher, Shoja. Study supervision: Griessenauer, Tubbs, Foreman, Walters, Harrigan, Fisher, Shoja.

Supplemental InformationCurrent AffiliationsDr. Shoja: Neuroscience Research Center, Tabriz University of Medical Sciences, Tabriz, Iran.Dr. Tubbs: Seattle Science Foundation, Seattle, WA.

CorrespondenceChristoph J. Griessenauer, Beth Israel Deaconess Medical Center, Harvard Medical School, 110 Francis St., Ste. 3B, Boston, MA 02215. email: [email protected].


association of renin-angiotensin system genetic

Documents