European Journal of Obstetrics & Gynecology and Reproductive Biology 176 (2014) 68–74

Contents lists available at ScienceDirect

European Journal of Obstetrics & Gynecology andReproductive Biology

journal homepage: www.e lsev ier .com/ locate /e jogrb

Association of CYP1A1 gene variants rs4646903 (T>C) and rs1048943

(A>G) with cervical cancer in a North Indian population

Mohammad Abbas a, Kirti Srivastava b, Mohd Imran c, Monisha Banerjee a,*a Molecular and Human Genetics Laboratory, Department of Zoology, University of Lucknow, Lucknow 226007, Uttar Pradesh, Indiab Department of Radiotherapy, King George’s Medical University, Lucknow 226003, Uttar Pradesh, Indiac Department of Microbiology, Integral University, Lucknow 226026, Uttar Pradesh, India

A R T I C L E I N F O

Article history:

Received 11 October 2013

Received in revised form 13 February 2014

Accepted 22 February 2014

Keywords:

SNP

Cervical cancer

CYP1A1

North India

PCR-RFLP

A B S T R A C T

Objective: To evaluate the association of CYP1A1 gene polymorphisms with cervical cancer susceptibility

in general and in relation to tobacco smoking.

Study design: The study included 408 subjects from North India (208 controls and 200 cases). All subjects

were genotyped for CYP1A1 m1 T>C (rs4646903) and m2 A>G (rs1048943) by polymerase chain

reaction-restriction fragment length polymorphism (PCR-RFLP) followed by statistical analysis (SPSS,

version 15.0; SHEsis online version).

Results: In our population, individuals with TC and CC genotypes of CYP1A1 m1 polymorphism have

significantly higher risk of cervical cancer (adjusted odds (OR) 2.76, P = 0.001; 3.13, P = 0.006

respectively). In the case of m2 polymorphism, individuals with AG and GG genotypes show increased

risk of cervical cancer (OR 1.90, P = 0.021; and 3.05, P = 0.285 respectively). The ‘C’ allele of m1 and ‘G’

allele of m2 polymorphism were strongly associated with the disease (P < 0.0001 and 0.008

respectively). Multiple combinations showed that women carrying the genotypes viz. TC/AA (+/�),

TC/AG (+/+), CC/AG (�/+) and CC/AG (+/+) were at higher risk of developing cervical cancer. The

relationship between CYP1A1 m1 and m2 genotypes and tobacco smoking showed an 8–11-fold higher

risk of cervical cancer amongst active smokers and 3–4-fold in passive smokers as well. Linkage

disequilibrium between m1 and m2 showed highly significant association in the case of TA* (P < 0.0001)

haplotype, while ‘CG’ appeared to be the risk haplotype (P = 0.002).

Conclusion: Our results suggest that presence of the ‘C’ allele of m1 (T>C) and ‘G’ of m2 (A>G) may be the

risk alleles for cervical cancer susceptibility. Moreover, CYP1A1 m1 and m2 polymorphisms show

considerable association with tobacco smoking in our study population.

� 2014 Elsevier Ireland Ltd. All rights reserved.

1. Introduction

Cervical cancer is the second most common cancer in womenworldwide. Approximately 530,000 new cases are diagnosed and275,000 deaths occur each year. More than 80% of cervical cancercases occur in developing countries, while incidence and mortalityhave substantially declined in developed countries [1,2]. Each year,132,000 new cases are diagnosed in India, out of which 74,000deaths occur annually, accounting for nearly one-third of globalcervical cancer deaths [3]. Apart from the high-risk humanpapillomavirus, there are several etiological co-factors such as ageat marriage, early and multiple child births, low socio-economic

* Corresponding author. Tel.: +91 9839500439.

E-mail addresses: rizvi.109@gmail.com (M. Abbas), drkirtis@rediffmail.com

(K. Srivastava), imranmohdkhan@rediffmail.com (M. Imran),

banerjee_monisha30@rediffmail.com, mhglucknow@yahoo.com (M. Banerjee).

http://dx.doi.org/10.1016/j.ejogrb.2014.02.036

0301-2115/� 2014 Elsevier Ireland Ltd. All rights reserved.

status, heavy cigarette smoking, drinking and long duration of oralcontraceptive use [4–6]. Environmental factors such as lifestyle,exposure to tobacco-derived carcinogens and kitchen smoke alongwith genetic factors have been confirmed to be related to thedevelopment of cervical cancer [7–9]. Activation or detoxification ofchemical carcinogens in tobacco smoke by metabolic enzymes(phase I and phase II respectively) has received a great deal ofattention, as possible genetic factors for a variety of cancers [10,11].Polymorphisms in the genes encoding the metabolic enzymes resultin their altered expressions which lead to increased or decreasedactivation/detoxification of carcinogens [12].

The cytochrome P450s (CYPs) belong to the phase I family ofmetabolizing enzymes participating in detoxification of manycarcinogens by formation of reactive intermediates that candamage DNA, lipids and proteins [13,14]. CYP1A1 metabolicallyconverts environmental procarcinogens into reactive intermediatemetabolites that have carcinogenic effects [15]. Polymorphicvariants influencing the enzyme activity of CYP1A1 along with

M. Abbas et al. / European Journal of Obstetrics & Gynecology and Reproductive Biology 176 (2014) 68–74 69

environmental factors such as tobacco smoking play importantroles in different interindividual susceptibilities to gynecologicalcancers in women as well as other cancers [6]. The CYP1A1 genelocated on chromosome 15q22-q24 encodes an enzyme with arylhydrocarbon hydroxylase activity which plays a role in themetabolism of polycyclic aromatic hydrocarbons (PAH) fromcigarette smoke, and inherited differences in metabolic capacityare thought to play a primary role in carcinogenesis [12]. Certainpolymorphisms in the CYP1A1 gene and prolonged exposure tofirewood along with tobacco smoke might lead to high levels ofreactive metabolites, thereby causing DNA damage in addition to apre-existing HPV infection. Considering the prevalence of tobaccochewing and use of wood for cooking among Indian women, it ispossible that polymorphisms in genes encoding xenobioticmetabolizing enzymes could throw light on disease susceptibility[16]. Therefore, a hospital-based case-control study was under-taken to evaluate the potential role of m1 (T>C, rs4646903) and m2

(A>G, rs1048943) polymorphisms in the CYP1A1 gene onsusceptibility to cervical cancer in a North Indian populations.

2. Materials and methods

2.1. Sample collection

Five milliliters venous blood was taken in EDTA vials from allsubjects after approval of the Institutional Ethics Committee (No.274/R.Cell-10 dated 10th May, 2010) and informed consent. Thestudy subjects comprised 208 healthy controls and 200 cervicalcancer patients between 30 and70 years of age with similarethnicity. The patients with cervical cancer and age-matchedcontrols were enrolled in the Radiotherapy Department andDepartment of Obstetrics and Gynecology of King George’s MedicalUniversity (KGMU), Lucknow, India as per the inclusion/exclusioncriteria. Both cases and controls were interviewed extensivelyregarding age, marriage age, parity, smoking status, etc. Theinterviews were conducted by expert clinicians for both cases andcontrols, following a structured proforma. Clinical diagnosis andstaging of patients were performed by expert medical personnelfollowing the guidelines of the International Federation ofGynecology and Obstetrics (FIGO).

Inclusion criteria for patients:

� A

ge between 30 and70 years with similar ethnicity. � d e novo histopathologically proven carcinoma cervix. � A ll stages (I–IV) as per the guidelines of International Federation

of Gynecology and Obstetrics (FIGO).

Exclusion criteria for patients:

� A

ge >70 years. � H istory of other cancers. � P rior chemotherapy, radiotherapy or chemoradiotherapy. � A ny co-morbid conditions such as allergy, cardiovascular

disease, diabetes, infection and inflammatory response.

Criteria for selection of control subjects:

� N

ormal healthy age-matched subjects of similar ethnicity andfree from cervical cancer.

2.2. DNA isolation and genotyping of CYP1A1 m1 T>C (rs4646903)

and m2 A>G (rs1048943) variants

Genomic DNA was extracted from peripheral blood leucocytesby a standard salting-out method with slight modifications

[17,18]. The DNA quality and quantity were estimated using abiophotometer (Eppendorf, USA).

The CYP1A1 m1 (T>C) and m2 (A>G) polymorphisms wereanalyzed using polymerase chain reaction-restriction fragmentlength polymorphism (PCR-RFLP). Amplification was performed ina 25 ml reaction mixture containing genomic DNA (100–150 ng),5 pmol of each primer, 200 mM dNTPs, and 0.5U of Taq DNApolymerase (MBI-Fermentas, USA) using gradient Master Cycler(Eppendorf, USA). Primer 3 online software was used to designprimers F-50ACTCACCCTGAACCCCATTC-30 and R-50GGCCCCAA-CTACTCAGAGGCT-30; F-50CTGTCTCCCTCTGGTTACAGGAAGC-30 andR-50TTCCACCCGTTGCAGCAGGATAGC C-30 for CYP1A1 m1 T>C andm2 A>G respectively. The PCR products were checked on ethidiumbromide (EtBr) stained 2% agarose gels and visualized in a geldocumentation system (Vilber Lourmat, France). The PCR productswere digested with 2 units of restriction enzymes (MspI and BsrD1respectively) at 37 8C for 16 h. The digested products wereelectrophoresed on 12% polyacrylamide gel (PAGE) and visualizedwith EtBr.

2.3. Statistical analysis

The sample size for each single nucleotide polymorphism (SNP)was calculated by QUANTO software (v.online) using minor allelefrequency (MAF) and prevalence. The continuous variables of eachgroup were summarized as mean � SD and compared by Student’s t-test after ascertaining the normality by the Kolmogorov–Smirnov Z

test. The Hardy–Weinberg equilibrium at individual locus was assessedby the chi-square (x2) test. Allele frequencies and carriage rate of allelesin both groups were compared using a 2 � 2 contingency table andgenotype frequencies in a 2 � 3 contingency table by using the chi-square test and Fisher’s exact test. Differences were consideredstatistically significant for P < 0.05. Odds ratio (OR) at 95% confidenceintervals (CI) was determined to describe the strength of associationbetween the two SNPs by the logistic regression model. Most of theanalyses were performed by SPSS (Version 15.0). Haplotype analysis ofthe two SNPs was performed using SHEsis software (online version).

3. Results

3.1. Clinical stage, histopathological and demographic

characterization of cases

Out of 200 cases, 58% were in stage II while 38.5 and 5.5% werein stages III/IV and I respectively. All 200 cases were histopatho-logically confirmed, of which 5.5% (11 out of 200) wereadenocarcinoma and remaining 94.5% were squamous cellcarcinoma. Squamous cell carcinoma was further differentiatedaccording to cell types; well (40.5%), moderately (28.5%), andpoorly differentiated (4.5%) and no differentiation (21.0%) accord-ing to the histopathological report.

The demographic variables of the study population recorded forboth squamous cell carcinoma and adenocarcinoma subtypesshowed no difference in age distribution between controls andcases, the mean ages being 48.09� 8.347 and 48.54� 9.529 yearsrespectively (P = 0.605). It was observed, however, that cervical cancerpatients were married at a younger age (18.06� 2.106) and had morenumber of children (4.48). Marriage age, parity and hemoglobin in casesshowed highly significant association when compared to controls(P < 0.0001). Significant association was also observed betweencontrols and patients in the case of passive smokers (P < 0.0001) (Fig. 1).

3.2. Genetic analysis

Genotype patterns of two SNPs (rs4646903 and rs1048943) inthe CYP1A1 gene are represented in Fig. 2a and b. Distribution of

[(Fig._1)TD$FIG]

Fig. 1. Comparison of clinical parameters in controls (n = 208) and cervical cancer cases (n = 200). Age (in years); Hb (Hemoglobin %); MA (marriage age in years); *P value

between never and active smokers; #P value between never and passive smokers.

M. Abbas et al. / European Journal of Obstetrics & Gynecology and Reproductive Biology 176 (2014) 68–7470

genotypes, allele frequencies and carriage rate among controls andcases are shown in Table 1. The prevalence of TC and CC genotypesof CYP1A1 m1 was more in cases (51% and 16% respectively) whencompared to controls (34% and 10%). The high frequency of TC andCC genotypes was significantly associated with an increased risk ifcervical cancer (2.44-fold, P < 0.0001, and 2.51-fold, P = 0.004respectively). The risk showed a further increase when the datawere adjusted for age, marriage age, parity and smoking inmultivariate logistic regression (2.76-folds P = 0.001, and 3.13-fold, P = 0.006 respectively).

[(Fig._2)TD$FIG]

Fig. 2. Ethidium bromide stained polyacrylamide gels showing different genotypes

of CYP1A1 gene. (a) SNP (T>C) showing CC: 194, 46 bp; TC: 240, 194, 49 bp; TT:

240 bp; M1: pUC 19/Mspl digest. (b) SNP (A>G) showing AA: 149, 55 bp; AG: 204,

149, 55 bp; GG: 204 bp; M2: PhiX174/Hae III digest.

In CYP1A1 m2 polymorphism, there was increase in thefrequency of genotypes AG and GG in cases when compared tocontrols (Table 1). The risk of cervical cancer significantlyincreased with the AG genotype (1.65-fold, P = 0.015). Afteradjusting the risk was found to increase slightly (1.90-fold) thoughit remained statistically significant (P = 0.021). The increasedfrequency of GG genotypes conferred a 3.84-fold increased cervicalcancer risk, which decreased slightly when the data were adjustedfor the confounding factors (3.05-fold). Allele frequencies of thetwo polymorphisms were higher in cases as compared to controlsand showed highly significant association (P < 0.0001 and 0.008respectively). Absence of the ‘C’ allele in m1 and ‘G’ allele in m2

polymorphisms was significantly higher in controls (P < 0.0001and P = 0.013) (Table 1).

Logistic regression analysis showed the possible effect ofdouble combinations of genotypes on the risk of developingcervical cancer. Out of nine possible combinations, six were foundwith frequencies ranging from 5% to 45% in the study population(Table 2). Recessive genotype frequency (CC and GG) was very lowin the population so their combination with other genotypes wasnot considered. The risk of TC/AA (+/�) was 0.65-fold but afteradjusting the risk increased to 2.10-fold. CC/AG (+/+) and TC/AG (+/+) combinations showed 2–2.50-fold higher risk which increasedto 2.90–2.97-fold after adjustment (P = 0.040 and P = 0.002respectively). The risk in the case of CC/AG (�/+) was increased1.80-fold after the data were adjusted (Table 2). For haplotypeanalysis with two loci of CYP1A1 gene polymorphisms, linkagedisequilibrium between m1 rs4646903 and m2 rs1048943 isshown in Fig. 3 (D: 0.535; r2: 0.137). The frequency of haplotypesTA* was 52.2% in cases, which is significantly lower as compared tocontrols (66.0%; P < 0.0001), while the haplotype CG* was morefrequent in cases than controls (17.7% vs. 10.4%, P = 0.002).

Association of SNPs with tobacco smoking status of subjectsshowed that the risk of cervical cancer in active smokers andpassive smokers with AG/GG and TC/CC genotypes was 8–11 and2.95–4.32-fold higher with significant association (Table 3).Another observation was that the genotype frequencies of CYP1A1

Table 1Genotypic, allelic and carriage rate frequencies of CYP1A1 m1 (T>C) and m2 (A>G) gene polymorphisms in controls (n = 208) and cervical cancer cases (n = 200).

Genotypes/alleles Controls (%) Cases (%) Unadjusted OR (95% CI) P value Adjusteda OR (95% CI) P value

CYP1A1 m1

TT 114 (54.8) 66 (33.0) 1.0 (Ref.) 1.0 (Ref.)

TC 72 (34.6) 102 (51.0) 2.44 (1.595–3.753) <0.0001 2.76 (1.542–4.927) 0.001CC 22 (10.6) 32 (16.0) 2.51 (1.349–4.678) 0.004 3.13 (1.395–7.015) 0.006T* allele 300 (72.1) 234 (58.5) 1.0 (Ref.)

C* allele 116 (27.9) 166 (41.5) 1.84 (1.369–2.457) <0.0001

CYP1A1 m2

AA 141 (67.8) 110 (55.0) 1.0 (Ref.) 1.0 (Ref.)

AG 65 (31.2) 84 (42.0) 1.65 (1.101–2.493) 0.015 1.90 (1.102–3.283) 0.021GG 2 (1.0) 6 (3.0) 3.84 (0.761–19.424) 0.103 3.05 (0.396–23.437) 0.285

A* allele 347 (83.4) 304 (76.0) 1.0 (Ref.)

G* allele 69 (16.6) 96 (24.0) 0.63 (0.445–0.889) 0.008

Carriage rate

CYP1A1 m1

T (+) 186 (89.4) 168 (84.0) 1.0 (Ref.) 1.0 (Ref.)

T (�) 22 (10.6) 32 (16.0) 0.62 (0.347–1.111) 0.106 0.51 (0.24–1.09) 0.077

C (+) 94 (45.2) 134 (67.0) 1.0 (Ref.) 1.0 (Ref.)

C (�) 114 (54.8) 66 (33.0) 2.46 (1.648–3.680) <0.0001 2.90 (1.668–5.026) <0.0001

CYP1A1 m2

A (+) 206 (99.0) 194 (97.0) 1.0 (Ref.) 1.0 (Ref.)

A (�) 2 (1.0) 6 (3.0) 0.31 (0.063–1.574) 0.138 0.26 (0.261–0.033) 0.23

G (+) 67 (32.2) 90 (45.0) 1.0 (Ref.) 1.0 (Ref.)

G (�) 141 (67.8) 110 (55.0) 1.72 (1.151–2.576) 0.008 2.00 (1.160–3.437) 0.013

Bold numerals provided in tables show association with disease. CI = confidence interval; OR = odds ratio.a Adjusted for age, marriage age, parity and smoking; 1.0 (Reference), Alleles*, total number of chromosomes in controls = 416 and cases = 400.

M. Abbas et al. / European Journal of Obstetrics & Gynecology and Reproductive Biology 176 (2014) 68–74 71

m1 polymorphism significantly deviated from Hardy–Weinbergequilibrium among controls (Pearson’s x2 = 4.037, df = 1, P = 0.045)and marginally for m2 polymorphism (Pearson’s x2 = 3.480, df = 1,P = 0.062).

4. Comments

Gene variations called polymorphisms in individuals of apopulation result in different responses to xenobiotic metabolizingenzymes. This is evident from the fact that all smokers (active orpassive) do not develop cancer. Polymorphisms in the codingregions may cause amino acid substitution thus altering the

[(Fig._3)TD$FIG]

Fig. 3. Haplotype analysis of SNPs viz. CYP1A1 m1 (rs4646903) and m2 (rs1048943)

diseuiliburim (LD) in subjects is represented as pink square for LD (SHEsis Software, v

enzymatic activity of xenobiotics [15]. Many carcinogens requiremetabolic activation by phase I enzymes like CYP1A1 and thereafterthey are detoxified by phase II enzymes like GSTM1 and GSTT1[19,20]. Some active metabolites which are not detoxified form DNAadducts and eventually lead to mutations causing cancer. Cigarettesmoking, either active or passive, has been linked to the secretion oftumor-specific metabolites in cervical mucus. This mucus maintainscervical HPV infection longer and decreases the potential of clearingan oncogenic infection [21].

The carcinogenic potential of nitrosoamines present withincervical epithelium has been clearly described [7]. The CYP1A1enzyme is responsible for aryl hydrocarbon hydroxylase activity of

for association with cervical cancer cases in North Indian population. Kinkage

er. Online).

Table 2Distribution of double combinations of SNPs CYP1A1 m1 (T>C) and m2 (A>G) in controls (n = 208) and cervical cancer cases (n = 200).

Genotypes Controls (%) Cases (%) Unadjusted OR (95% CI)

P value

Adjusteda OR (95% CI)

P value

TT&AA

(�/�) 46 (22.1) 78 (39.0) 1.0 (Ref.) 1.0 (Ref.)

(�/+) 48 (23.1) 56 (28.0) 0.69 (0.405–1.169)

0.167

0.57 (0.268–1.154)

0.115

(+/�) 21 (10.1) 12 (6.0) 0.34 (0.152–0.748)

0.0080.24 (0.086–0.664)

0.006(+/+) 93 (44.7) 54 (27.0) 0.34 (0.209–0.562)

<0.00010.28 (0.146–0.550)

<0.0001

TT&AG

(�/�) 50 (24.0) 60 (30.0) 1.0 (Ref.) 1.0 (Ref.)

(�/+) 44 (21.2) 74 (37.0) 1.40 (0.826–2.379)

0.211

1.78 (0.858–3.687)

0.121

(+/�) 93 (44.7) 56 (28.0) 0.50 (0.304–0.828)

0.0070.52 (0.257–1.043)

0.065

(+/+) 21 (10.1) 10 (5.0) 0.40 (0.171–0.920)

0.0310.36 (0.120–1.055)

0.062

TC&AA

(�/�) 33 (15.9) 28 (14.0) 1.0 (Ref.) 1.0 (Ref.)

(�/+) 103 (49.5) 70 (35.0) 0.81 (0.412–1.577)

0.529

0.66 (0.315–1.398)

0.281

(+/�) 34 (16.3) 62 (31.0) 0.65 (0.377–1.106)

0.111

2.10 (0.913–4.755)

0.081

(+/+) 38 (18.3) 40 (20.0) 1.73 (0.941–3.188)

0.077

1.09 (0.452–2.608)

0.854

TC&AG

(�/�) 105 (50.5) 73 (36.5) 1.0 (Ref.) 1.0 (Ref.)

(�/+) 31 (15.0) 25 (12.5) 1.16 (0.633–2.126)

0.631

1.36 (0.631–2.919)

0.435

(+/�) 38 (18.2) 43 (21.5) 1.63 (0.959–2.762)

0.071

1.61 (0.765–3.403)

0.209

(+/+) 34 (16.3) 59 (29.5) 2.50 (1.488–4.186)

0.0012.97 (1.483–5.966)

0.002

CC&AA

(�/�) 55 (26.4) 74 (37.0) 1.0 (Ref.) 1.0 (Ref.)

(�/+) 131 (63.0) 94 (47.0) 0.53 (0.344–0.877)

0.0050.52 (0.288–9.42)

0.031(+/�) 12 (5.8) 16 (8.0) 0.99 (0.434–2.263)

0.983

1.45 (0.531–3.976)

0.467

(+/+) 10 (4.8) 16 (8.0) 1.20 (0.501–2.821)

0.694

1.04 (0.314–3.436)

0.950

CC&AG

(�/�) 131 (63.0) 99 (49.5) 1.0 (Ref.) 1.0 (Ref.)

(�/+) 55 (26.4) 69 (34.5) 1.70 (1.069–2.578)

0.0241.80 (0.988–3.244)

0.055

(+/�) 12 (5.8) 17 (8.5) 1.88 (0.856–4.105)

0.116

1.87 (0.636–5.518)

0.255

(+/+) 10 (4.8) 15 (7.5) 2.00 (0.855–4.605)

0.110

2.90 (1.050–8.025)

0.040

Bold numerals provided in tables show association with disease. CI = confidence interval; OR = odds ratio.a Adjusted for age, marriage age, parity and smoking; 1.0 (Reference).

M. Abbas et al. / European Journal of Obstetrics & Gynecology and Reproductive Biology 176 (2014) 68–7472

widespread environmental carcinogens like polyaromatic hydro-carbons, polyaromatic amines, dibenzofurans and biphenyls. Dueto altered CYP1A1 enzyme activity these substances lead toformation of DNA adducts causing cell damage [22,23]. SeveralSNPs have been found in CYP1A1 gene, the most commonly studiedbeing m1 T>C (rs4646903) at nucleotide 3801 in the 3’flankingregion which alters the gene expression level [24,25]. CYP1A1 m2

A>G (rs1048943) is another polymorphism at nucleotide 2455, anisoleucine to valine transition which increases enzyme activityinvolving the activation of specific tobacco carcinogens [26]. Them2 polymorphic variant A>G displays two times higher catalyticactivity compared to wild type [27].

The association of gene polymorphisms of CYP1A1 withsusceptibility to several types of cancer, e.g. lung, bladder,pancreatic, breast, ovarian, prostate, oral and gynecological malig-nancies including cervical cancer, has been evaluated in different

populations [28–36]. Sugawara et al. [37], however, did not find anyrelation between CYP1A1 and gynecological malignancies. A strongcorrelation was found between homozygous m2 polymorphism andlung cancer among Japanese, unlike Caucasians [38]. In the presentstudy, the allele frequencies of m1 (T>C) and m2 (A>G) were higherin cases when compared to controls and showed significantassociation with cervical cancer. The genotypes of m1, TC and CCwere more frequent in cases than controls (Table 1) and revealed athreefold higher risk. In the case of m2 polymorphism, however, theGG genotype showed threefold higher risk while AG showed only amarginal 1.9-fold risk with significant association when comparedto the AA genotype (Table 1). In the case of double combinations ofgenotypes, TC/AA (+/�), TC/AG (+/+), CC/AG (�/+) and CC/AG (+/+)showed 2–3-fold higher risk (Table 2). The significant deviation fromHardy–Weinberg equilibrium observed in controls for CYP1A1 m1

polymorphism may be due to the small sample size.

Table 3CYP1A1m1 (T>C) and m2 (A>G) genotypes and their association with smoking status in controls (n = 208) and cervical cancer cases (n = 200).

Population

(smoking status)

Genotype (%)

CYP1A1m1 (T>C) CYP1A1m2 (A>G)

TT TC/CC OR (95%CI)

P value

AA AG/GG OR (95%CI)

P value

NeverControls 56 (26.9) 63 (30.3) 1.0 (Ref.) 74 (35.6) 45 (21.6) 1.0 (Ref.)

Cases 30 (15.0) 44 (22.0) 1.30 49 (24.5) 25 (12.5) 0.84

(0.725–2.346)

0.376

(0.457–1.541)

0.571

ActiveControls 6 (2.9) 3 (1.4) 1.0 (Ref.) 7 (3.4) 2 (0.9) 1.0 (Ref.)

Cases 2 (1.0) 11 (5.5) 11.00 4 (2.0) 9 (4.5) 7.86(1.420–85.201)

0.022(1.105–56.123)

0.039

PassiveControls 52 (25.0) 28 (13.5) 1.0 (Ref.)

4.3260 (28.9) 20 (9.6) 1.0 (Ref.)

2.95Cases 34 (17.0) 79 (39.5) (2.344–7.945)

<0.000157 (28.5) 56 (28.0) (1.576–5.513)

0.001

Bold numerals provided in tables show association with disease. CI = confidence interval; OR = odds ratio; 1.0 (Reference).

M. Abbas et al. / European Journal of Obstetrics & Gynecology and Reproductive Biology 176 (2014) 68–74 73

Smoking habit (active as well as passive) has been confirmed asa risk factor for cervical cancer [4], where passive smoking is theinhalation of smoke from tobacco products used by others [39,40].Many case-control and cross-sectional studies indicate thatwomen married to smokers experience a higher risk of cervicalneoplasia than those married to nonsmokers [41]. Cotinine, anicotine metabolite, has been found in cervical mucus of womenexposed to passive smoking, which contribute to carcinogenesisthrough the same pathways as active smoking, including genotoxicand immunomodulatory effects [7,42]. The relationship betweenthe CYP1A1 gene and exposure to tobacco smoke revealed a highlysignificant risk of cervical cancer in active smokers with AG/GG andTC/CC genotypes (8–11-fold). The association studies with passivesmoking also showed risk and significant association but to a lesserextent (Table 3). In this study, however, the number of activesmokers was very low because Indian women are rarely smokers.Since our results showed early marriage age and more childrenincrease the susceptibility of Indian women to cervical cancer, itmay be advisable to keep these factors in mind for reducing risk ofthe disease. The haplotype analyses in the present study suggestthat the TA* haplotype of the two SNPs may be protective in naturewhile CG* is the risk haplotype, showing 1.8-fold higher risk withsignificant association (P = 0.002) (Fig. 3).

It is evident from this study that the genetic polymorphisms inmetabolic enzymes play a role in development of cervical cancer.Our results suggest that presence of the ‘C’ allele of rs4646903 and‘G’ allele of rs1048943 might be leading to cervical cancer and maybe the risk alleles for disease susceptibility in our population. Thisis probably the first study to examine the association of CYP1A1

polymorphisms with smoking in North Indian women. The risk ofcervical cancer in tobacco smoking women also increases with m1

and m2 polymorphisms. A larger sample size is required, however,to confirm the possible interactions between CYP1A1 genepolymorphisms and smoking outcomes in cervical cancer casesfrom North India.

Funding

The work was supported by Council of Science & Technology-Uttar Pradesh (CST-UP), Lucknow, ICMR, DST-FIST-PURSE, NewDelhi, India. M.A. is thankful to CST-UP for research fellowship.

Conflicts of interest

The authors declare no conflicts of interest.

References

[1] Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Global cancer statistics.CA Cancer J Clin 2011;61:69–90.

[2] Siegel R, Naishadham D, Jemal A. Cancer statistics, 2012. CA Cancer J Clin2012;62:10–29.

[3] Kaarthigeyan K. Cervical cancer in India and HPV vaccination. Indian J MedPaediatr Oncol 2012;33:7–12.

[4] Sobti RC, Kaur S, Kaur P, Singh J, Gupta I, Nakahara A. Interaction of passivesmoking with GST (GSTM1, GSTT1, and GSTP1) genotypes in the risk of cervicalcancer in India. Cancer Genet Cytogenet 2006;166:117–23.

[5] Vasilevska M, Ross SA, Gesink D, Fisman DN. Relative risk of cervical cancer inindigenous women in Australia, Canada, New Zealand, and the United States:a systematic review and metaanalysis. J Public Health Policy 2012;33:148–64.

[6] Xia L, Gao J, Liu Y, Wu K. Significant association between CYP1A1 T3801Cpolymorphism and cervical neoplasia risk: a systematic review and meta-analysis. Tumor Biol 2013;34:223–30.

[7] Prokopczyk B, Cox JE, Hoffmann D, Waggoner SE. Identification of tobacco-specific carcinogen in the cervical mucus of smokers and non smokers. J NatlCancer Inst 1997;89:868–73.

[8] Simons AM, Philips DH, Coleman DV. Damage to DNA in cervical epitheliumrelated to smoking tobacco. Br Med J 1993;306:1444–8.

[9] Velema JP, Ferrera A, Figueroa M, et al. Burning wood in the kitchen increasesthe risk of cervical neoplasia in HPV-infected women in Honduras. Int J Cancer2002;97:536–41.

[10] Olshan AF, Weissler MC, Bell DA. GSTM1, GSTT1, GSTP1, CYP1A1, and NAT1polymorphisms, tobacco use, and the risk of head and neck cancer. CancerEpidemiol Biomark Prev 2000;9:185–91.

[11] D’Errico A, Taioli E, Xhen X, Vineis P. Genetic metabolic polymorphisms andthe risk of cancer: a review of the literature. Biomarkers 1996;1:149–73.

[12] Sabitha K, Reddy MV, Jamil K. Smoking related risk involved in individualscarrying genetic variants of CYP1A1 gene in head and neck cancer. CancerEpidemiol 2010;34:587–92.

[13] Tsuchiya Y, Nakajima M, Yokoi T. Cytochrome P450-mediated metabolism ofestrogens and its regulation in human. Cancer Lett 2005;227:115–24.

[14] Nebert DW, Dalton TP. The role of cytochrome P450 enzymes in endogenoussignalling pathways and environmental carcinogenesis. Nat Rev Cancer2006;6:947–60.

[15] Taskiran C, Aktas D, Yigit-Celik N, et al. CYP1A1 gene polymorphism as a riskfactor for cervical intraepithelial neoplasia and invasive cervical cancer.Gynecol Oncol 2006;101:503–6.

[16] Joseph T, Chacko P, Wesley R, Jayaprakash PG, James FV, Pillai MR. Germlinegenetic polymorphisms of CYP1A1, GSTM1 and GSTT1 genes in Indian cervicalcancer: associations with tumor progression, age and human papillomavirusinfection. Gynecol Oncol 2006;101:411–7.

[17] Miller SA, Dykes DD, Polesky HF. Simple salting out procedure for extractingDNA from human nucleated cells. Nucleic Acids Res 1988;16:1215.

M. Abbas et al. / European Journal of Obstetrics & Gynecology and Reproductive Biology 176 (2014) 68–7474

[18] Gautam S, Agrawal CG, Bid HK, Banerjee M. Preliminary studies on CD36 genein type 2 diabetic patients from north India. Indian J Med Res 2011;134:107–12.

[19] Nebert DW. Role of genetics and drug metabolism in humancancer risk. MutatRes 1991;247:267–81.

[20] Oude Ophuis MO, van Leishout EM, Roelofs HM, Peters WH, Manni JJ. Gluta-thione S-transferase M1 and T1 and cytochrome P4501A1 polymorphisms inrelation to the risk for benign and malignant head and neck lesions. Cancer1998;82:936–43.

[21] Crofts F, Taioli E, Trachman J, et al. Functional significance of different humanCYP1A1 genotypes. Carcinogenesis 1994;15:2961–3.

[22] Nebert DW, McKinnon RA, Puga A. Human drug–metabolizing enzyme poly-morphisms: effects on risk of toxicity and cancer. DNA Cell Biol 1996;15:273–80.

[23] Crofts F, Cosma GN, Currie D, Taioli E, Toniolo P, Garte SJ. A novel CYP1A1 genepolymorphism in African-Americans. Carcinogenesis 1993;14:1729–31.

[24] Shah PP, Saurabh K, Pant MC, Mathur N, Parmar D. Evidence for increasedcytochrome P450 1A1 expression in blood lymphocytes of lung cancerpatients. Mutat Res 2009;670:74–8.

[25] Agundez JA. Cytochrome P450 gene polymorphism and cancer. Curr DrugMetab 2004;5:211–24.

[26] Autrup H. Genetic polymorphisms in human xenobiotica metabolizingenzymes as susceptibility factors in toxic response. Mutat Res 2000;464:65–76.

[27] Giuliano AR, Sedjo RL, Roe DJ, et al. Clearance of oncogenic human papillomavirus (HPV) infection: effect of smoking (United States). Cancer Causes Control2002;13:839–46.

[28] Li H, Xiao D, He T. Association of CYP1A1 polymorphisms with prostate cancerrisk: an updated meta-analysis. Mol Biol Rep 2012;39:10273–84.

[29] Ozturk T, Kahraman OT, Toptas B, et al. The effect of CYP1A1 and GSTM1 genepolymorphisms in bladder cancer development in a Turkish population. InVivo 2011;25:663–8.

[30] Liu G, Ghadirian P, Vesprini D, et al. Polymorphisms in GSTM1, GSTT1 andCYP1A1 and risk of pancreatic adenocarcinoma. Br J Cancer 2000;82:1646–9.

[31] Chen C, Huang Y, Li Y, Mao Y, Xie Y. Cytochrome P450 1A1 (CYP1A1) T3801Cand A2455G polymorphisms in breast cancer risk: a meta-analysis. J HumGenet 2007;52:423–35.

[32] Mrozikiewicz PM, Grzeskowiak E, Seremak-Mrozikiewicz A, et al. Importanceof CYP1A1 polymorphism and its transcriptional regulation in ovarian andendometrial cancer. Ginekol Pol 2011;82:925–32.

[33] Kumar V, Yadav CS, Singh S, et al. CYP 1A1 polymorphism and organochlorinepesticides levels in the etiology of prostate cancer. Chemosphere 2010;81:464–8.

[34] Aktas D, Guney I, Alikasifoglu M, Yuce K, Tuncbilek E, Ayhan A. CYP1A1 genepolymorphism and risk of epithelial ovarian neoplasm. Gynecol Oncol2002;86:124–8.

[35] Hung RJ, Boffetta P, Brockmoller J, et al. CYP1A1 and GSTM1 genetic poly-morphisms and lung cancer risk in Caucasian non-smokers: a pooled analysis.Carcinogenesis 2003;24:875–82.

[36] Karina C, Iris E, Dante C, et al. Oral cancer susceptibility associated with theCYP1A1 and GSTM1 genotypes in Chilean individuals. Oncol Lett 2010;1:549–53.

[37] Sugawara T, Nomura E, Sagawa T, Sakuragi N, Fujimoto S. CYP1A1 polymor-phism and risk of gynecological malignancy in Japan. Int J Gynecol Cancer2003;13:785–90.

[38] Marchand LL, Sigfried A, Lum A, Wilkins LR, Lau AF. Association of CYP1A1,GSTM1 and CYP2E1 polymorphisms with lung cancer suggest cell type spe-cifications to tobacco carcinogens. Cancer Res 1998;58:4858–63.

[39] Xian-Tao Z, Ping-An X, Chun-Yi L, Yi G. Passive smoking and cervical cancerrisk: a meta-analysis based on 3,230 cases and 2,982 controls. Asian Pacific JCancer Prev 2012;13:2687–93.

[40] Abbas M, Srivastava K, Imran M, Banerjee M. Association of Glutathione S-transferase (GSTM1, GSTT1 and GSTP1) polymorphisms and passive smokingin cervical cancer cases from North India. Int J Biomed Res 2013;12:655–62.

[41] Trimble CL, Genkinger JM, Burke AE, et al. Active and passive cigarette smokingand the risk of cervical neoplasia. Obstet Gynecol 2005;105:174–81.

[42] Szarewski A, Jarvis MJ, Sasieni P, et al. Effect of smoking cessation on cervicallesion size. Lancet 1996;347:941–3.